đánh giá ảnh hưởng in vitro cuả bài thuốc trên thời gian quick pt thời gian cephalin kaolin aptt thời gian thrombin tt
Nghiên cứu bài thuốc chữa huyết khối tĩnh mạch chi về thực vật, hóa học và thăm dò tác dụng in vitro
... tài liệu [22], [29], [30] dựa số tiêu đông máu: thời gian Prothrombin (thời gian Quick) (PT) , thời gian Cephalinkaolin (APTT) , thời gian thrombin (TT) Lấy máu người tình nguyện khỏe mạnh vào buổi ... nhóm chất thuốc phản ứng hóa học Bảng 5: Thành phần mẫu quy trình thử nghiệm đánh giá ảnh hưởng thuốc trình đông máu Bảng 6: Kết đánh giá ảnh hưởng in vitro thuốc thời gian PT, APTT, TT Bảng 7: ... sinh (suy giảm chức gan, thiếu viatamin K, điều trị chống đông dẫn xuất coumarin…) [7] - Thời gian thromboplastin phần hoạt hóa (thời gian Cephalin Kaolin, APTT) (giây): Xét nghiệm cho phép đánh...
- 68
- 694
- 0
Báo cáo y học: "Duration of red blood cell storage is associated with increased incidence of deep vein thrombosis and in hospital mortality in patients with traumatic injuries" potx
... as requiring dialysis or serum creatinine more than mg/dl Patients with traumatic brain injuries who remained intubated at time of death without evidence of lung injury or who were on minimal mechanical ... with increased thrombin generation In these prestorage leukoreduced RBCs increased thrombin generation occurred after 31 days of storage in AS-1 solution [12] Another recent publication indicates ... Mechanism of injury was categorized as either blunt or penetrating injury The incidence of DVT was determined by reviewing ultrasound results for DVT screening tests that are routinely performed...
- 11
- 523
- 0
Báo cáo sinh học: "A population-based study examining the emergence of community-associated methicillin-resistant Staphylococcus aureus USA300 in New York City" pot
... Susceptible ≤.06–>4 ≤0.25–>8 ≤.03–>4 ≤0.25–>1 ≤.06–>4 ≤0.12–1 ≤0.015–0.5 ≤0.5–>4 56% 33% 66% 100% 49% 100% 100% 96% µg/ml Oxacillin Azithromycin Clindamycin Vancomycin Ciprofloxacin Daptomycin ... hospitals In contrast, the USA300 strains accounted for 3.1% (range 0–5.0%) of the S aureus isolated from the remaining nine hospitals To determine if our selection criteria (clindamycin-susceptible ... prior skin infections, diabetes mellitus, asthma, and HIV infection) and were of lower socioeconomic status; isolates in this report were not fingerprinted [14] In a nationwide survey examining rates...
- 6
- 364
- 0
Báo cáo y học: "Incidence of hospital referred head injuries in Norway: A population based survey from the Stavanger region" ppsx
... severity of injury, from 55% in minimal injuries to 99% in severe injuries In those examined with CT, a skull fracture or intracranial lesion was revealed in 1% of minimal, 4% of mild, 56% of moderate ... of head injuries in Sweden from 1987 to 2000 Inj Control Saf Promot 2003, 10:173-80 Andelic N, Sigurdardottir S, Brunborg C, Roe C: Incidence of Hospital-Treated Traumatic Brain Injury in the ... 2008, 30:120-128 Ingebrigtsen T, Romner B, Kock-Jensen C: Scandinavian guidelines for initial management of minimal, mild, and moderate head injuries The Scandinavian Neurotrauma Committee J Trauma...
- 5
- 321
- 0
A taxonomy based perspective of the design trade offs for bittorrent like protocols
... experience working with various BT clients: (i) keeping promises and (ii) keeping information up-to-date viii Chapter Introduction BitTorrent (BT) [5] has in recent years become the predominant means ... brief In our work, we focus mainly on performance and matching among peers, which allows us to focus on fewer issues but in the process, investigate each issue in greater depth 11 Chapter Investigating ... peer maintains in the official BT protocol documentation Maintaining connections with remote peers serves two purposes The first is to exchange useful information regarding current pieces in possession...
- 57
- 261
- 0
báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx
... (%) users Pain relievers (includes all NSAIDs and narcotics) -NSAIDs (aspirin included) -NSAIDs (aspirin excluded) -Acetaminophen-containing -Narcotic pain relievers -Aspirin containing 74 (65.5) ... demographic information during the detailed telephone interview and confirmed it at clinic Clinic participants completed a battery of questionnaires prior to their clinic appointment, including questions ... to be taking non-steroid antiinflammatory drugs, NSAIDs, (when aspirin was excluded) and anti-allergy drugs and cold/sinus (mostly anti-histamines), and less likely to be taking aspirin In addition,...
- 11
- 512
- 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf
... exist in Argentina, as in other Latin American countries, it is unlikely that any significant underreporting of this variable would occur in the clinical setting of this cohort Individuals receiving ... that tuberculosis is a leading AIDS-defining illness in Argentina) and many treating physicians may elect to delay initiation of HAART in HIV/ tuberculosis co-infected individuals who have CD4 ... majority of individuals in PUMA presenting with an AIDS-defining illness were also given HAART According to the established guidelines, it is recommended that those presenting with symptomatic HIV...
- 7
- 398
- 0
báo cáo hóa học:" Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" doc
... (%) users Pain relievers (includes all NSAIDs and narcotics) -NSAIDs (aspirin included) -NSAIDs (aspirin excluded) -Acetaminophen-containing -Narcotic pain relievers -Aspirin containing 74 (65.5) ... demographic information during the detailed telephone interview and confirmed it at clinic Clinic participants completed a battery of questionnaires prior to their clinic appointment, including questions ... to be taking non-steroid antiinflammatory drugs, NSAIDs, (when aspirin was excluded) and anti-allergy drugs and cold/sinus (mostly anti-histamines), and less likely to be taking aspirin In addition,...
- 11
- 498
- 0
Báo cáo y học: " Population-based epidemiology of intensive care: critical importance of ascertainment of residency status" potx
... severe sepsis occurring in the first 24 hrs in intensive care units in England, Wales, and Northern Ireland Crit Care Med 2003, 31:2332-2338 11 Vincent JL, Bihari DJ, Suter PM, Bruining HA, White J, ... J, NicolasChanoin MH, Wolff M, Spencer RC, Hemmer M: The prevalence of nosocomial infection in intensive care units in Europe Results of the European Prevalence of Infection in Intensive R436 ... Canadaintensive care unit admission in Calgary Health Region, Alberta, Canada variable elimination was then performed to develop the final model The final model discrimination was assessed using...
- 6
- 286
- 0
A population based study of copy number variations and regions of homozygosity in singapore and swedish populations using genome wide SNP genotyping arrays
... sequencing NHGRI - National Human Genome Research Institute NUS-IRB - National University of Singapore-Institutional Review Board PARK2 - parkinson protein 2, E3 ubiquitin protein ligase (parkin) ... variation Size Single nucleotide changes RFLP, SNP, single nucleotide Single nucleotide indel Tandem repeats >8bp Small indel – 100bp Intermediate indel Structural variations – 8bp VNTR Indels STR ... to 1kb are grouped as ‘InDels’ Table summarizes the number of indels, CNVs and inversions cataloged in the DGV As such, the remaining several hundred thousands of indels in the range of several...
- 270
- 387
- 0
Health and lifestyle risk factors for falls in a large population-based sample of older people in Australia
... has resulted in an increase in the incidence of fall-related injury requiring hospitalisation in a number of countries (Bradley & Pointer, 2009; Scott et al., 2010) Fall-related injury morbidity ... varying sampling fraction in each AHS Results Around one-quarter (25.6%) of older individuals in 2009 indicated that they had fallen in the preceding 12 months and of these, 38.1% reported falling ... found in other studies in the United States, where 32% of individuals aged 75 years and over reported falling at least once in the last year (Tinetti et al., 1988) and in Montreal where 29% of individuals...
- 7
- 323
- 0
Báo cáo khoa học: ":Clinically important deep vein thrombosis in the intensive care unit: a survey of intensivists" pot
... without a reminder e-mail; five (7%) required a reminder Clinical discipline backgrounds were internal medicine in 52 (75%), anesthesia in eight (12%), surgery in six (9%), and other in three (4%) ... discussion among the investigators We reduced items for this instrument by interviews with five intensivists who did not participate in the survey Instrument formatting In the survey we provided ... determine whether a DVT should be treated; in addition, a definition of R146 clinically important DVT could be used in future clinical research Therefore, as a first step toward defining a 'clinically...
- 8
- 269
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Deep vein thrombosis: pdf
... potential value in monitoring symptoms related to PTS It was designed for use in research and clinical settings to evaluate the natural history of leg-associated symptoms over time following an acute ... suggests it would be of value in or for following symptoms over time in patients after DVT Use of this tool in identifying emerging leg symptoms and perhaps indicating new DVT events will require ... measurable symptoms in the affected leg long after surgery Establishing a symptomatic link between PTS and "asymptomatic" thrombi could shed a new light on thrombosis prophylaxis in surgical patients...
- 6
- 231
- 0
Báo cáo hóa học: "Computed tomographic pulmonary angiography and pulmonary embolism: predictive value of a d-dimer assay" docx
... CT in pulmonary embolism with emphasis on incidental findings Clin Imaging 2008, 32(5):335–341 25 Lee AY, Ginsberg JS: The role of D-dimer in the diagnosis of venous thromboembolism Curr Opin ... had more than one main finding reported The number and percentage is the proportion of the 405 CTPAs with that specific finding Discussion Main findings The study’s main aim was to assess the ... largest thrombosed vessel reported Table The main findings of 405 CTPAs performed between 01/06/2008 and 31/07/2009 that met inclusion criteria Main CTPA finding No (%)* No (%)* No pathology 103 (25.4)...
- 13
- 342
- 0
Báo cáo y học: "The relationship between FV Leiden and pulmonary embolism" ppt
... observations remain uncertain and the findings not discount the prevailing belief that DVT and PE are a consequence of a single disease entity They suggest, however, that a better understanding of the ... Reitsma PH, Bertina RM: A common genetic variation in the 3’-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis ... As in the earlier studies, this study found FV Leiden to be less common in the PE only cases than in the other two groups [18] They did, however, find that the prevalence of the prothrombin G20210A...
- 3
- 294
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... 7, zero indicating no disease or injury, while seven indicates the patient being dead NACA score was in the analyses categorised as NACA 0-1, indicating a patient either with no symptoms/injuries ... the Index [1] The Index is based on ideas from the Criteria Based Dispatch system in the US [15], and was first published in 1994 Clinical symptoms, findings and situations are categorised into ... the research team with experience in emergency medicine Main symptom was used for ICPC coding Based on all available information according to The National Committee on Aeronautics (NACA) Score...
- 9
- 784
- 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx
... administered directly to the sampled individuals by trained interviewers The questionnaire was organized into 19 subject areas including the scales of the SF-36® The variables analyzed pertained ... mean score) The same finding was reported by Goldney et al in a population-based study in Australia that found a difference of –15.8 points in the bodily pain scale among individuals who reported ... Texas, United States), incorporating weightings and taking the clusters and stratification used in the sample design into account The present study was approved by the ethics committees of the School...
- 8
- 701
- 0
Health related quality of life among the elderly: a population-based study using SF-36 survey pdf
... scores were obtained in the following scales: role-emotional (86.1), social functioning (85.9) and rolephysical (81.2) (Table 2) Women obtained lower scores than men in all domains except for role-physical ... income and schooling using multiple linear regression model strata were non-significant in the role-emotional, mental health and bodily pain scales (Table 5) Comparing years of education, better ... age, per capita income and schooling using multiple linear regression model these three domains Leplège et al 19, in research developed in France, found the worst mean scores in the general health,...
- 9
- 574
- 0
Health-related behavior and quality of life among the elderly: a population-based study pot
... in the four areas, 1,600 individuals (200 of each gender in each area) The present study included two domains: men and women aged 60 and more, totaling 1,958 individuals Data were collected in ... quality of life in the elderly or, considering a reverse causality, the elderly with good health and well-being are able to adopt and maintain healthy behaviors There is a need for further investigation ... screening test in a Brazilian psychiatric inpatient hospital setting Braz J Med Biol Res 1983;16(3):215-8 15 Mitra M, Chung M, Wilber N, Walker DK Smoking status and quality of life A longitudinal...
- 9
- 507
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... ammodytin I1; AmI2, ammodytin I2; VaspA, vaspin chain A; VaspB, vaspin chain B; AtxA, ammodytoxin A; AtxB, ammodytoxin B; AtxC, ammodytoxin C; AmL: ammodytin L; b Only amino acids differing between ... GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers used for amplification of the Bov-B LINE retroposon; ... Viperinae and Crotalinae Moreover, mutations leading to amino-acid changes are common in the protein-coding regions (but not in the signal peptide exon), but are limited to the third exon in V...
- 10
- 451
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25