zebu the sacked bull of india in spite of its domestication has an agile body and a quick alert mind

Tài liệu Báo cáo khoa học: The molecular surface of proteolytic enzymes has an important role in stability of the enzymatic activity in extraordinary environments pptx

Ngày tải lên : 21/02/2014, 03:20

... 5¢-GCCATTTCCATAtTgaGTaCTGTTACCAAG-3¢ 5¢-CATACTCAGCgTtaAC TAAGCCATTTC-3¢ 5¢-TTGAGCCGCAgcCTCAGCgTCgAC TAAGCCATTTC-3¢ 5¢-CTTAGGGATTAacGAGCCGCATACTCAGCgTCgAC TAAGCCATTTC-3¢ 5¢-ATTGAGCCGCAgcCTCAGCgTtaACTAAGCCATTTC-3¢ ... 5¢-ATTGAGCCGCAgcCTCAGCgTtaACTAAGCCATTTC-3¢ 5¢-CTTAGGGATTAacGcGtCGCATACTCAG-3¢ 5¢-CTTAGGGATTAacGcGtCGCAgcCTCAGCATCC-3¢ 5¢-CTTAGGGATTAacGcGtCGCAgcCTCAGCATtCACTAAGCCA-3¢ 5¢-TGCAGCTTCTGCgTcgACAAGTCCACTGCC-3¢ 5¢-AATATAAGCTTAaCgcGTTGCAtaTTCTGCgTcgAcAAGTCCACTGCC-3¢ ... enzyme, the side chain of Asp266 interacted with the amino group of the main chain at Glu268 The oxygen of the main chain at Asp266 was bound to amino groups of main chain of Tyr269 and Ala270 by...

9
489
0

Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-afﬁnity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt

Ngày tải lên : 19/02/2014, 12:20

... We also thank Andy Ng and Evelyne Copeland for critical reading of the manuscript This work was supported by a Genomics and Health Research Initiative of the National Research Council of Canada ... functional aggregates and compartments Acknowledgements We thank Drs Dmitri Tolkachev and Surajit Bhattacharjya for their valuable discussion and Patrice Bouchard and Betty Zhu for technical assistance ... interactions between the peptides and the Grb4 SH2 domain The afﬁnity of the binding interactions was evaluated by measuring the changes of ﬂuorescence polarization of the peptides at each step of...

12
551
0

The Economic Impact of Cloud Computing on Business Creation, Employment and Output in Europe pdf

Ngày tải lên : 06/03/2014, 21:20

... Bulgaria Czech Republic Denmark Germany Estonia Ireland Greece Spain France Italy Latvia Lithuania Hungary Netherlands Austria Poland Portugal Romania Slovenia Slovakia Finland Sweden United Kingdom ... Republic Denmark Germany Estonia Ireland Greece Spain France Italy Latvia Lithuania Hungary Netherlands Austria Poland Portugal Romania Slovenia Slovakia Finland Sweden United Kingdom Norway EU 25 ... sectors we took in consideration: manufacturing, wholesale and retail trade, hotels and restaurants, transport storage and communication and finally, real estate renting and business activities Figures...

30
708
0

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Ngày tải lên : 07/03/2014, 16:20

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... MC4100DtigDdnaKdnaJ and MC4100DtatC at 30 °C (A) Cells were grown in medium containing glucose (0.2%) to an D660 of 0.6 and analyzed by SDS/PAGE and immunoblotting using anti-SufI (top) and anti-OmpA ... 1C, lane 8) but with a different ratio of the 70 and 80 kDa adducts (Fig 1C, compare lanes and 8) The observation that crosslinking of nascent chains to TF results in a double banded pattern has...

9
393
0

Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc

Ngày tải lên : 16/03/2014, 22:20

... by administration of metalloporphyrin catalytic antioxidants [27] However, investigations of the therapeutic efﬁcacy of antioxidant compounds both in animal models and humans [28–31] generated ... Trimmer PA, Kwan AL & Helms GA (2002) Ultrastructural changes of neuronal mitochondria after transient and permanent cerebral ischemia Stroke 33, 816–824 10 Namura S, Nagata I, Takami S, Masayasu ... contradictory results Consequently, the initial enthusiasm for the use of antioxidants to treat acute brain injury subsided As a reason for the failure, the bioavailability of antioxidants was...

9
433
0

Báo cáo " Fishing ground forecast in the offshore waters of CentralVietnam (experimental results for purse-seine and drift-gillnet fisheries) " docx

Ngày tải lên : 22/03/2014, 12:20

... temperature and its anomaly, thickness of mixed layer, thickness and gradien of thermocline, depth of isothermal levels of 24OC, 20OC and 15OC, biomass of phytoplankton and zooplankton, primary and secondary ... Length-based Cohort Analysis (LCA) and Thompson and Bell models have been used Analyzing data of fishery survey and observation from 2000 to 2009 and data from the General Statistics Office of Vietnam ... that acceptable forecasts are about 60% Meanwhile, the quantity of good forecasts are about 50% and the quantity of excellent forecasts ranks from 25 to 41% 2- The results of LCA and Thompson and...

7
409
0

Báo cáo khoa học: The N-glycans of yellow jacket venom hyaluronidases and the protein sequence of its major isoform in Vespula vulgaris pdf

Ngày tải lên : 23/03/2014, 15:20

... However, patients’ sera containing antiglycan immunoglobulin can bind to a variety of plant and insect glycoproteins and even to human proteins unrelated to any allergen in the peptide part when the ... once again, the importance of a discrimination between carbohydrate- and proteinbased IgE binding Incidentally, analysis of glycans from the wasp venom hyaluronidase led to the identiﬁcation and ... and a mixture of the reverse universal primers 5¢-CTAATA CGACTCACTATAGGGCAAGCAGTGGTATCAACGCA GAGT-3¢ and 5¢-CTAATACGAC-TCACTATAGGGC-3¢, at a ratio of : 40 w ⁄ w The obtained PCR fragments were...

9
524
0

báo cáo hóa học: " The effect of hip abduction on the EMG activity of vastus medialis obliquus, vastus lateralis longus and vastus lateralis obliquus in healthy subjects" pot

Ngày tải lên : 19/06/2014, 10:20

... tightness of the lateral retinaculum, perhaps as a result of increased tension in the iliotibial tract, could potentially alter the tracking of the patella in the trochlear groove, becoming an important ... dissected the thighs of 32 human cadavers and showed that the distal fibers of the Vastus Lateralis Obliquus (VLO) were interdigitated with the lateral retinaculum and the iliotibial tract in all specimens, ... complaints based on the premise of avoiding excessive tightness of the lateral structures or a VLL and VMO imbalance, since the anatomical origin of the iliotibial tract has a close relation with the...

8
427
0

Báo cáo khoa học " Lentinula edodes enhances the biocontrol activity of Cryptococcus laurentii against Penicillium expansum contamination and patulin production in apple fruits " ppt

Ngày tải lên : 28/06/2014, 11:20

... incubated at 25 °C for and days and then analysed 2.7 Assay of biocontrol activity of LS28 and LF23 In order to evaluate the antagonistic activity of LS28 and LF23 in vivo, the growth of P expansum ... polysaccharides such as β-glucans, present in the ﬁltrates These compounds demonstrated both an antioxidant activity per se and an ability to stimulate the activity of SOD, CAT and GPX of a atoxin ... promote a signiﬁcant delay in the conidia germination of the pathogen P expansum and an inhibition of patulin production Nevertheless, the performance of LF23 in the control of patulin in our...

7
392
0

Báo cáo lâm nghiệp: "Multivariate statistical approach to comparison of the nutrient status of Norway spruce (Picea abies [L.] Karst.) and top-soil properties in differently managed forest stands" potx

Ngày tải lên : 07/08/2014, 03:22

... forest stands changes occurred in element cycles and tree nutrition; (2) in managed stands heterogeneity of humus forms and their properties have been changing, and (3) in managed stands changes ... sodium, manganese and zinc Communication in Soil Science and Plant Analysis, 9: 477–492 MELOUN M., HILL M., MILITKÝ J., KUPKA K., 2001 Analysis of large and small samples of biochemical and clinical ... that could be considered for cluster analysis (CLU) and principal component analysis (PCA) (Johnson 1998) Alternatively to CLU multivariate analysis of variance (MANOVA) was applied CLU and MANOVA...

12
373
0

Báo cáo lâm nghiệp: "Nutrition of silver fir (Abies alba Mill) growing at the upper limit of its occurrence in the Šumava National Park and Protected Landscape Area" pot

Ngày tải lên : 07/08/2014, 10:21

... content was also analyzed in the papers by Bäumler et al (1995) and Maňkovská et al (2004) The mean value measured in the sampled locality in Germany was 63 mg·kg–1; for the localities in Poland and ... Samples of the current year needles were analyzed in a laboratory of the Forest and Game Management Research Institute, using the ICP Forests (UN-ECE 2005) methodology and the Standard Operation ... Poland and Slovakia it was 30 and 39 mg·kg–1, respectively The average value measured in the Bohemian Forest was comparable with the localities in Poland and Slovakia The sulphur values range from...

8
333
0

Báo cáo khoa học: "Estimating the foliage area of Maritime pine (Pinus pinaster Aït.) branches and crowns with application to modelling the foliage area distribution in the crown" pptx

Ngày tải lên : 08/08/2014, 14:21

... Stand level foliage area The stand LAI was calculated by dividing the stand foliage area by the stand area For the 21 and 26 year-old stands, stand foliage area was calculated as the sum of the ... foliage area to sapwood area at the base of the living crown (m2 cm–2) according to the needle and the stand ages Means are calculated on 14, 19 and 30 values for the Bray site in 1995, in 1990 and ... looking at each stand separately, it resulted in overestimating the needle area of the younger stand branches and underestimating the branch area of the older stand Different fittings for each...

14
242
0

Báo cáo khoa hoc:" No connection between the level of exposition to statins in the population and the incidence/ mortality of acute myocardial infarction: An ecological study based on Sweden’s municipalities" pptx

Ngày tải lên : 11/08/2014, 07:21

... Inhabitants and Day (TID) [7] The DDD for simvastatin was 15 mg, atorvastatin 10 mg and pravastatin 20 mg The DDD for antidiabetic drugs included both insulin and oral drugs The number of deaths ... regression analysis was used AMI-incidence was used as the dependent variable and utilisation of statins and antidiabetic drugs, deprivation index, and geographic x- and y-coordinates for each of the ... significance for changes in the incidence of AMI or mortality rates than statins [19,20] Smoking has gradually decreased in Sweden during the last 30 years both in women and particularly in men and the...

8
478
0

Báo cáo y học: "The inverse association of serum HBV DNA level with HDL and adiponectin in chronic hepatitis B infection" ppt

Ngày tải lên : 12/08/2014, 01:21

... Hilden, Germany) according to the manufacturer’s instructions The linear range of this assay was 102-109 copies/ml Statistical Analysis Results were expressed as mean ± standard deviation Relations ... smoothing line showed that there was a negative association between HBV DNA and adiponectin in a concentration less than 16 μg/ml These associations indicating that HDL can itself reduce viral infection ... models and when it was considered as a dichotomous variable (less than median and more than median) logistic regression models was used to check association between HBV DNA and other variables Mean...

6
320
0

The business strategy of Ba Ria - Vung Tau seafood processing and import export Joint Stock Company in the period 2011-2020

Ngày tải lên : 27/03/2015, 14:23

85
683
0

THE SIX DISCIPLINES OF BREAKTHROUGH LEARNING: How to Turn Training and Development Into Business Results

Ngày tải lên : 10/02/2014, 18:32

... know-how, human capital, and the ability to learn quickly at both the individual and organizational levels Companies invest heavily in training and development—more than $50 billion annually in the United ... the participant’s manager has on whether learning is applied or scrapped We discuss the need to balance accountability and support and the new demands this places on the learning organization and ... participants are asked to estimate the annual value created as a result of the program We tally these and we show the results of what they have done as a group and for the program as a whole They...

253
1.2K
1

Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Biﬁdobacterium longum and its complex with fructose pot

Ngày tải lên : 06/03/2014, 00:21

... wheat, garlic, onions, leeks, bananas, barley, tomatoes and honey, whereas rafﬁnose appears naturally in soya beans and other pulses [28,35,36] Inulin-type fructans and rafﬁnose are a common part ... strand of the next blade by an interblade loop This domain contains one additional structural element, an a- helix, sticking to the surface of the cylinder in the area of blades I and II Such an ... FEBS A Bujacz et al A Crystal structure of B longum b-fructofuranosidase domains involve contacts of IV and V blades and b-strands (1–6) from the internal b-sheet of the b-sandwich domain The last...

17
521
0

Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot

Ngày tải lên : 07/03/2014, 11:20

... GCCAACACGATTTTCCTCCCAGTTGGAACGGCC GCCAACACGATTTTCAGCCCAGTTGGAACGGCC GCCAACACGATTTTCCGCCCAGTTGGAACGGCCv CCCTTCGCGCCCAACGCACTTACCCAAGGACCG CCCTTCGCGCCCAACGCAAGTACCCAAGGACCG CCCTTCGCGCCCAACGCACGCACCCAAGGACCG ... constructions are shown) (Table 2) Expression and puriﬁcation of wild-type enzyme and AAO variants Protoplasts of E nidulans (argB– strain) were prepared, and transformed with the pALAAO plasmids containing ... Ferreira et al Table Steady-state kinetic constants of wild-type AAO and ﬁve AAO variants expressed in Emericella nidulans on different alcohols Means and standard deviations of Km (lM), kcat (s)1)...

11
471
0

Báo cáo khoa học: The changing patterns of covalent active site occupancy during catalysis on a modular polyketide synthase multienzyme revealed by ion-trap mass spectrometry pptx

Ngày tải lên : 16/03/2014, 03:20

... bacteria They include some of the most valuable natural products to have reached the clinic, such as the antibacterial erythromycin A, the antiparasitic avermectin and the immunosuppressant rapamycin ... min), the mixture was analysed using the standard protocol to determine the extent of loading on the domains of module and its attached TE domain MS analysis of the KS1 fraction showed that the active ... of the DKS, the AT and KR domains form a ‘collar’ surrounding the backwards and forwards path of travel of the two ACP domains, as they interact with their various catalytic partners The collar...

13
426
0

Báo cáo khoa học: Identiﬁcation of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Ngày tải lên : 17/03/2014, 10:20

... against various forms of stress [1] Here we showed that SA induced the activation of HSF, the transcription of hsp genes and the accumulation of Hsps in various mammalian cells and a concomitant increase ... polyglutamine and Parkinson’s disease are though to be caused by an accumulation of protein aggregates in the brain [24], and Hsps such as Hsp70 and Hsp40 are shown to suppress the toxicity of these ... activity by SA reﬂect the levels of transcription and translation of Hsp105, not due to an indirect effect of SA on the basal activity of Luc Enhancement of Luc activity was also detected at 45 and 60...

8
470
0