what is a process model reflections on the epistemology of design process models
a return to love reflections on the principles of a course in miracles
... hope and faith and a sense of wonder It’s easily retrieved, because perception is a choice The mists part when we believe that Avalon is behind them And that’s what a miracle is: a parting of the ... tales of King Arthur Avalon is a magical island that is hidden behind huge impenetrable mists Unless the mists part, there is no way to navigate your way to the island But unless you believe the island ... is passive It doesn’t anything The spiritualization process in men as well as women is a feminization process, a quieting of the mind It is the cultivation of personal magnetism If you have a...
- 169
- 1,107
- 0
The Emergence of the “I” Reflections on the Use of Qualitative Research Methods in a Master´s Program in Educational Management and Leadership at the VNU University of Education
... importance of self-analysis and reflection and the insistence on participation and interaction Here I am reminded of Goffman´s discussion of front- and backstage interaction which I mentioned above ... drawing attention to the importance of their persons Somewhat similar was the approach of Ms, L whose concern was the lack of the professional competence of the staff in a poor rural school district ... includes the very lively discussions among the young managers after the presentation of each story We readers can thereby witness their reactions; we hear what they are saying and that they feel that...
- 14
- 336
- 0
LAKE EUTROPHICATION MODEL BASED ON THE IMPACT OF THE ZOOPLANKTON COMMUNITY ON PHYTOPLANKTON SUCCESSION
... of biomanipulation's stability However, the rate process parameters of these models, especially for the dynamics of zooplankton and fish, were estimated on the basis of a limited amount of data ... other hand, each state variable (box) described in Fig consists many species and growth stages of organisms Therefore, the kinetic parameters of them have a certain ranges of statistical variations ... effect of El:Elution S:Sedimentation M:Mineralization U:Uptake biomanipulation is the application for the P Keszthely Basin, Lake Balaton (Hungary) ZooAlgae Bream Figures and shows the model structure...
- 8
- 524
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
... pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC ... compilation ª 2009 FEBS B Jiang et al McClean, VA, USA) The attenuance of formazan formed in control cells was considered as 100% viability Statistical analysis Data are expressed as the mean ± ... activation [18] and mitochondrial depolarization [19], blocks apoptosome formation and activation of caspase-9 [20], and inhibits the release of apoptosisinducing factor (AIF) from mitochondria...
- 10
- 726
- 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... first amino acid of strand A (Y9) and the last amino acid of strand G (K87) The elongation of the x(Y9)Àx(87) distance up to the transition state is defined as the distance DxA’ÀG The crossing of ... disulfide bond by DxR = 0.37 Æ 0.04 , at the transition state of the SN2 chemical reaction Remarkably, the measured distance to the transition state of this SN2 type chemical reaction was in close agreement ... nucleophilic substitution mechanism[75] in which transport of a proton along a water wire is responsible for the simultaneous deprotonation of the arriving sulfur and protonation of the departing sulphur.[43]...
- 12
- 553
- 0
The Weapons Mix Problem - A Math Model to Quantify the Effects of Internetting of Fires to the Future Force pptx
... in calculation, it was assumed that munitions are used at a fraction of their maximum range, and we used the expected fractional damage of a volley shot at that range in the calculation 10 The ... time of the decision, a reasonable analysis may be to understand the affects of poor data on the solution For instance, after the IOF Allocator has solved for the expected kills based on the assumed ... selection of possible targets sensitive to available weapons? • What is the effect of weapon accuracy on the choice of targets? • What is the role in future forces for area munitions, and what is the...
- 48
- 369
- 0
báo cáo sinh học:" Reflections on the ethics of recruiting foreigntrained human resources for health" pptx
... University of Ottawa, Canada Authors’ contributions VR participated in the design of the study, collected data, analyzed data, and drafted and revised the manuscript RL and CP conceived the study, participated ... for Health Information: International Medical Graduates in Canada: 1972 to 2007 Ottawa 2009 Health Canada: Pan-Canadian Health Human Resource Strategy 2007-2008 Annual Report Ottawa 2008 Labonté ... University of Ottawa Excellence Scholarship Ronald Labonté is supported by the Canada Research Chair Program of the Government of Canada Author details Globalization and Health Equity Research Unit,...
- 11
- 703
- 0
báo cáo hóa học:" Multi-modal-analgesia for pain management after Hallux Valgus surgery: a prospective randomised study on the effect of ankle block" doc
... side-stream gas analysis Peak endtidal and mean end-tidal sevoflurane concentrations were recorded and used for evaluation of need for anaesthesia Immediately after surgery anaesthesia was discontinued ... qualitative systematic review Acta Anaesthesiol Scand 1998, 42:71?9 Holmer Pettersson P, Owall A, Jakobsson J: Early bioavailability of paracetamol after oral or intravenous administration Acta ... hypothesis of the present study was that adding an ankle block with a long lasting local anaesthetic to the routine of local anaesthesia with lidocaine would enhance postoperative analgesia and reducing...
- 5
- 601
- 0
Báo cáo khoa học: "Effects of Combination Dietary Conjugated Linoleic Acid with Vitamin A (Retinol) and Selenium on the Response of the Immunoglobulin Productivity in Mice" pdf
... of secretory IgA concentration was done by the sandwich ELISA [8,32] S tatis tica l an a ly sis Data were analysed by one-way analysis of variance followed by Duncan's multiple-range test to identify ... hours, the samples were allocated into 50㎕ at -80℃ until IgA analysis P re p ara tion o f th e gu t lu m e n la va ge After blood collection, the end of the duodenum and the cranial part of the ... 4) All of the treated groups had a significant increase compared to the control group (p
- 6
- 344
- 0
Báo cáo toán hoc:"A New Lower Bound on the Density of Vertex Identifying Codes for the Infinit" doc
... we see that 12/29 is a lower bound on the density of D The organization of the rest of the paper is as follows In Section we prove the main result This proof consist of stating six discharging ... prove a weaker lower bound, given in Proposition The proof of Proposition is instructive, because the proof is easy, yet the proofs of Theorem and Proposition use the same core idea We call the ... Chakrabarty, and Levitin [6] considered the 6-regular, 4-regular, and 3-regular infinite grids that come from the tilings of the plane by equilateral triangles, squares, and regular hexagons They...
- 16
- 309
- 0
Báo cáo y học: "Combination therapy versus monotherapy: a randomised pilot study on the evolution of inflammatory parameters after ventilator associated pneumonia [ISRCTN31976779]" pot
... Critical Care Vol 10 No Damas et al a priori hypothesis is that synergistic action of combination therapy will accelerate the resolution of inflammation Table Modified clinical pulmonary infection ... for abdominal sepsis and all immunocompromised patients receiving antibiotics, among others If this study failed to demonstrate any advantage of combination therapy over monotherapy, the use of ... does not allow us to draw definitive conclusions regarding this issue Conclusion We failed to demonstrate any advantage of combination therapy over monotherapy None of the recorded parameters,...
- 7
- 387
- 0
Báo cáo sinh học: " Impacts of both reference population size and inclusion of a residual polygenic effect on the accuracy of genomic prediction" potx
... proportion of additive Results and discussion Genomic validation using German national data Table shows the results of genomic validation based on the national genomic and phenotypic data of German ... DRP and DGV or GEBV, we can conclude that the impact of the assumed percentage of residual polygenic variance on accuracy is limited Regression of conventional deregressed EBV of the validation ... polygenic variance Conclusions The tremendous advances in conventional genetic evaluations during the last decades have formed a solid basis for genomic evaluation and selection in dairy cattle Genomic...
- 9
- 524
- 0
reflections on the application of noun phrases in english vietnamese translation
... and analytical processing of the SL.” In addition, “Translation is an activity comprising the interpretation of the meaning of a text in one language – the ST – and the production, in another language, ... rules of back transformation in the SL, of contextual consistency in the transfer, and of transformation in the RL, the message is preserved and the translation is faithful.” (Nida and Taber, ... nominal or adjectival phrase and the onomatopoeia of animal sounds With regard to equivalent expressions between language pairs, Vinay and Darbelnet claim that they are acceptable as long as they...
- 58
- 747
- 4
Reflections On the Work of Paul Auster
... fascinated by the breaking down of the boundaries between what is lived and what is read; and the blurring of the distinction between what is experienced and what is written Paul Auster, ... parallels The stories deal with the search for personal meaning, and the metaphysical crisis that ensues if one accepts that the self is fractured and divided, rather than fixed and immutable City of ... narrative voice is comfortable and sublimely assured, and, given his abstract and existential preoccupations, oddly conversational He achieves something rare in fiction: the combination of the...
- 5
- 352
- 0
Báo cáo sinh học: "On the relevance of three genetic models for the description of genetic variance in small populations undergoing selection" docx
... individuals are randomly mated and produce a new generation This is performed through the simulation of meiosis and pairing of gametes Generations are assumed to be discrete The simulation algorithm, ... the basic situation was then evaluated The comparison criterion was the ratio between genetic variances at generation t and generation (RVI’l) 3.1 Population size Different sizes of candidate ... size, and the higher the decrease in genetic variance This comparison of the predictions given by analytical and stochastic models for well-known phenomena allowed validation of the genetic model...
- 12
- 279
- 0
Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx
... schools in the Australian state of Victoria to establish to what extent the characteristics of the school are important to the parents and how they are valued In order to this we estimate an hedonic ... composition, academic merit and measures of socio-economic status of students enrolled The hedonic approach allows the estimation of the marginal values that are implied for these types of characteristics ... Ballarat Associated Schools (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican...
- 24
- 511
- 0
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... conformation of this loop Changes in the conformation of the backbone at this point and changes in the orientation of other side chains, as a result of the introduction of the large charged aspartate ... concentrations and the Kd value for this variant was calculated; Kd was increased by a factor of 103 (Table 1) Thermal denaturation Temperature stability was studied by monitoring the loss of ... to the wild-type (Table 1) Based on the AUC data, the mutation at position 376 had a major effect on the quaternary structure (Table 1) The s20,w value for the G376E variant was measured at four...
- 10
- 520
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... 3) (B) Analysis of a standard mixture containing Glc, Gal, Man, Fuc, GlcNAc, GalNAc, ManNAc (C) Analysis of peak (Fig 3A) (D) Analysis of peak (Fig 3A) different chromatographic mobility on highly ... carbohydrate analysis Chromatographic analysis of the PVX CP N-terminal peptide carbohydrates Fig RP-HPLC separation of PVX CP preparations after mild trypsin hydrolysis of intact virions (A) ... carbohydrate content of the Ru strain CP N-terminal peptide Monosaccharides were analyzed as AMC derivatives (A) Analysis of a blank sample (eluate fraction between peaks in chromatographic profile...
- 10
- 398
- 0
What Changes Are Being Made to Social Assistance Benefits: A Community Perspective on the Impact of these Changes. pdf
... Peterborough are considering doing in response to the changes, and about the process for municipal decisionmaking; discover what provincial and local actions are taking place in response to the changes; ... people on assistance than other municipality in the region, with 8.5% of local residents relying on social assistance compared to a provincial average of 6.9% One of every 11 residents relies on ... (PSPC), among others These partners have investigated the implications of the 2012 budget cuts to provincial funding of social assistance on Peterborough City and County One indisputable implication...
- 18
- 390
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25