w loper c r jr amp rosenthal p c principles of metal casting tata mcgraw hill
chang w.s.c. principles of lasers and optics (cup, 2005)
... 2, New York, John Wiley and Sons, 1970 M Born and E Wolf, Principles of Optics, Chapters & 4, New York, Pergamon Press, 1959 M Born and E Wolf, Principles of Optics, Chapter 8, New York, Pergamon ... in Optical Fiber Links (Cambridge University Press, 2002) PRINCIPLES OF LASERS AND OPTICS WILLIAM S C CHANG Professor Emeritus Department of Electrical Engineering and Computer Science University ... This page intentionally left blank PRINCIPLES OF LASERS AND OPTICS Principles of Lasers and Optics describes both the fundamental principles of lasers and the propagation and application of laser...
- 262
- 367
- 0
bai tap su phu thuoc cua R vao l, S, p
... 12: BÀI T P VỀ ĐIỆN TRỞ C A DÂY DẪN C u hỏi: Điện trở dây dẫn phụ thu c vào yếu tố nào? Phụ thu c nào? Viết c ng th c biểu diễn phụ thu c Trả lời: Điện trở dây dẫn tỷ lệ thuận với chiều dài l ... tốt Chiều dài l ρ= R. S/l l/S = R/ ρ Tiết diện S l = R. S/ ρ S = ρ.l /R ρ.l /S THÔNG ĐI P CU C SỐNG Luật chơi HƯỚNG DẪN VỀ NHÀ -Xem lại nội dung h c, t p chữa -Bài t p nhà: 9.5;9.10(SBT/Tr25) - Đ c ... trư c 10: Biến trở - Điện trở dùng kỹ thuật Luật chơi Mỗi dãy đội C nhỏ, đằng sau c u hỏi tương ứng Nếu trả lời c u hỏi đội 10 điểm ảnh sau mở Nếu trả lời sai đội bạn c quyền trả lời (điểm cho...
- 17
- 378
- 0
Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright
... of customer contact, representing the extent of interaction with service person- service encounters a period of time during which customers interact directly with a service levels of customer ... service transactions This chapter builds on our earlier discussion of processes in Chapter and introduces the concept of a spectrum of customer contact with the service organization that ranges from ... are two approaches that capture the essence of the word *- A service is an act or performance offered by one party to another Although the process may be tied to a physical product, the performance...
- 387
- 1,194
- 6
Tài liệu Advanced Linux Programming: C Table of Signals ppt
... sends a process this signal when a child process exits See Section 3.4.4, “Cleaning Up Children Asynchronously,” in Chapter 3, “Processes.” SIGXCPU Linux sends a process this signal when it exceeds ... be forbidden by the target memory’s permissions Dereferencing a “wild pointer” can cause a SIGSEGV SIGPIPE The program has attempted to access a broken data stream, such as a socket connection ... signal is reserved for application use SIGSEGV The program attempted an invalid memory access.The access may be to an address that is invalid in the process’s virtual memory space, or the access may...
- 2
- 453
- 0
Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt
... 470 APPENDIX C: INTRODUCTION OF C PROGRAMMING FOR DSP APPLICATIONS C program (Source) Preprocessor Compiler Assembly code Assembler Object code Linker (loader) Libraries Execution Data Output ... produces output files for the C compiler The tasks of preprocessor are to remove comments, expand macro definition, interpret include files, and check conditional compilation Preprocessor directives ... maintaining complicated DSP software for new readers, even for the original programmers after time has passed The preprocessor is the first pass of the C compiler It reads in C source files as input...
- 18
- 505
- 0
Tài liệu Principles of Engineering Mechanics Second EditionH. R. Harrison B S ~PhD, MRAeS ,Formerly doc
... mechanically, including photocopying, recording or any information storage or retrieval system, without either prior permission in writing from the publisher or a licence permitting restricted copying ... Work and kinetic energy Power Discussion examples Problems Force systems and equilibrium, 37 Addition of forces Moment of a force Vector product of two vectors Moments of components of a force ... book is on the principles of mechanics and examples are drawn from a wide range of engineering applications The order of presentation has been chosen to correspond with that which we have found...
- 275
- 438
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... of the folding species were analyzed by ESI-MS (B) Representative trace for BPTI refolding in the presence of PDI (C) Representative trace for BPTI refolding in the presence of PDI and mM bacitracin ... NRCSQGSCWN in a glutathione-based buffer at pH 7.0 The upper trace shows the PDI-catalyzed reaction, and the lower trace the PDI-catalyzed reaction in the presence of mM bacitracin The lines of ... Hence, the use of bacitracin as a speci c inhibitor for studying the role and function of PDI in cellular systems requires urgent re-evaluation Experimental procedures Bacitracin The bacitracin...
- 9
- 620
- 0
Tài liệu First Principles of Project Management By R. Max Wideman pdf
... for better or worse Criteria for Establishing a First Principle To identify a set of ‘First Principles of Project Management’ we must set criteria for their acceptance or exclusion The following ... purpose, such a project is viewed from the perspective of the ‘owner’ or ‘sponsor’ and begins when resources are dedicated to its specific goal, commencing with activities such as ‘Concept Exploration’, ... use of the words principles and practices”, Moreover, in the marketplace, the term ‘principle’ appears to be used indiscriminately to mean either Webster defines a ‘Principle’ as “a general truth,...
- 10
- 693
- 0
Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx
... movement in PhyAsr and its comparison to several PTP structures provides an understanding of the factors that influence P- loop movements within the PTP superfamily A comparison of the structural consequences ... Structure of PhyAsr under low and high ionic strength conditions To examine the structural effect of ionic strength on the P- loop, X-ray crystal structures of PhyAsr were determined at several ... and were necessary to produce optimal diffraction quality crystals The resulting space group, unit cell and crystal contacts were identical to those previously observed [7,8] The structure of wild-type...
- 10
- 596
- 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... horse cytochrome c The expression plasmid of horse cytochrome c was introduced into Escherichia coli JM 109 strain; bacterial expression and purification of the recombinant protein were then conducted ... guanidine-HCl was obtained ICN (Costa Mesa, CA, USA) All the reagents used of analytical grade from purifrom were Construction of horse cytochrome c expression system A version of the horse cytochrome c ... (spectrum c) Absorption spectra in the visible range are a 10-fold magnification of original spectra Spectrum b, which is between spectrum a and spectrum c, has not been marked, for the sake of...
- 11
- 487
- 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
... 0.1 M perchloric acid; path length, cm) were recorded on a Jasco J-810 automatic recording spectropolarimeter, continuously purged with N2 before and during the experiment (Japan Spectroscopic, ... Solid-state CP-MAS 1 3C- NMR spectroscopy 1 3C- NMR spectra were obtained with a Bruker dsx300 spectrometer at 75 MHz The cross polarization pulse sequence was utilized for all samples, which were spun at ... were observed under SEM (LEO 435 VP, LEO Electron Microscopy Ltd, Cambridge, UK) at 20 kV and variable pressure Infrared (IR) spectroscopy IR spectral studies were performed on a Perkin Elmer...
- 11
- 673
- 0
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx
... generated by replacement of the KpnI/SacI fragment of pMM6 with the corresponding fragment of pMM9 E coli strains used were DH5a for plasmid preparation and DK8, which contains a D(uncB-uncC) ... for expression of E coli F1 Expression and purification of E coli F1 Preparation of F1 was performed essentially as described previously [18] except for the following modifications Cells were now ... measurements in the presence of mM AMP- PNP or a mixture of mM AMP- PNP and mM ADP showed complete inhibition Figure shows the corresponding SDS/PAGE analysis of the samples after each reaction step and Table...
- 9
- 546
- 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf
... and EcoR1-digested p1 3R4 The same strategy was used for constructing p1 3R4 -P, except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGATCCTAGCA ... remaining cells were subjected to PCR analysis after genomic DNA extraction (right panel) The picture shows a typical agarose gel of the PCR products after duplex amplification of b-gal (upper arrow) ... observations were confirmed with scFv constructs that not harbor the EGFP coding sequence The presence or absence of the corresponding polypeptides within the transfected COS-1 cells was probed by western...
- 14
- 483
- 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx
... EIIGlc concentrations present during the incubation, can accept a phosphoryl group and thereby deprotect Cys421 Fig Irreversible inhibition of EIIGlc A membrane preparation containing EIIGlc was preincubated ... and 1 3C- NMR spectroscopy and by electrospray MS Scheme The epoxide 1d was prepared in seven steps from methyl a-D-glucopyranoside (aMGlc, Scheme 2) Conventional procedures were followed for the ... system: molecular cloning of ptsG and purification of the receptor from an overproducing strain of Escherichia coli Proc Natl Acad Sci USA 84, 930–934 Erni, B., Zanolari, B & Kocher, H .P (1987) The...
- 12
- 720
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... genomic DNA using primers 5¢-ATAAGCTTGCTTT AAAATCCACCCCACG-3¢ and 5¢-TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢ HindIII–BamHI digested PCR product was cloned into the pBlueScript SKvector and then recloned ... tissue-speci c isoform of the CK2 regulatory subunit in Drosophila male germline EXPERIMENTAL PROCEDURES Plasmid constructions PCRs were performed according to the recommendations of the manufacturer using ... the whole CK2a ORF region was amplified from Drosophila genomic DNA using the following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢...
- 10
- 464
- 0
R"eCseoarcuh garthicl eofficer screening" improves detection of pulmonary tuberculosis in hospital in-patients pptx
... in special care wards, such as the respiratory care center and hospice care Cough officer screening protocol Our COS protocol was devised to allow early detection of pulmonary TB and to prevent ... Soc Trop Med Hyg 1998, 92:161-163 16 Ottomani S, Scherpbier R, Chaulet P: Practical approach to lung health: respiratory care in primary care services: a survey in countries World Health Organization, ... window on the computer screen would remind doctors to schedule chest radiography, sputum smears, or cultures for suspected pulmonary TB each day until such tests were performed A doctor could...
- 7
- 451
- 0
Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot
... the sample immediately after cooling from the previous scan The thermal denaturation of all actin samples was fully irreversible Calorimetric traces were corrected for instrumental background ... with different actin species were performed at least twice with very good reproducibility, and the representative curves are shown Acknowledgements We are grateful to Dr Alevtina Morozova for ... hexokinase was kindly provided by Dr N Yu Goncharova (Department of Biochemistry, School of Biology, Moscow State University, Russia) Protein preparations Rabbit skeletal muscle actin was prepared from...
- 11
- 482
- 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx
... For NKA8: forward, 5¢-GTCTCCAGACGTCTCGAAC-3¢; reverse, 5¢-CATCCAAGTCTTGGGAGCTC-3¢ For NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG TC-3¢ For NKA49: forward, ... Experimental procedures Culture conditions for the growth of plasmodia Microplasmodia of P polycephalum strain M3CVII ATCC 204388 (American type Culture Collection, LGC Promochem, Wesel, Germany) ... by comparing the number of PCR cycles necessary to produce equal amounts of actin 1052 cDNA in probes containing equal amounts of either substracted or unsubstracted DNA Subtracted PCR products...
- 10
- 639
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGGGCTACTTCACTCAAAG ... sequence-speci c primers (forward primer, 5¢-ATTCAAGACTCCTTCAA GAGCGTGGCGTGGC-3¢; reverse primer, 5¢-GCTCA AACACCATCCCTCCTCGAACCTGGG-3¢) with cycling conditions comprising 30 at 55 C followed by 25 cycles of ... pairs (5¢ fi 3¢) 1–750 AAAGGTACCAAAGATGTGGAATCTCCTTCACG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT...
- 9
- 414
- 0
Báo cáo khoa học: Stimulation of p-nitrophenylphosphatase activity of Na+ ⁄ K+-ATPase by NaCl with oligomycin or ATP docx
... and O represent KCl at low and high concentrations, occluded Na+ and oligomycin, respectively P( ATP) and P( pNPP) represent the phosphate transferred from ATP and pNPP, respectively M represents ... Na+ transport Experimental procedures Materials ATP(Na)2 and AMPPCP were purchased from RocheDiagnostics (Penzberg, Germany) A portion of the ATP(Na)2 was converted into the sodium-free ATP form ... PerkinElmer Life Sciences Japan (Tokyo, Japan) Other reagents were purchased from Wako Pure Chemicals Industries, Ltd (Osaka, Japan) Preparation of Na+ ⁄ K+-ATPase Microsomes were prepared from...
- 12
- 327
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008