using the boundary information in the l t r and b fields of a startdrag action will constrain a draggable movie clip to the edges of the square movie clip
Báo cáo hóa học: " Research Article Analysis of Adaptive Interference Cancellation Using Common-Mode Information in Wireline Communications" potx
... the < /b> least-mean square (LMS) and < /b> the < /b> recursive least squares (RLS) algorithm In < /b> a stationary environment, these algorithms can be parametrised in < /b> such a way that they converge towards the < /b> Wiener ... correlation of the < /b> resulting interference components originating from different sources The < /b> more similar the < /b> coupling paths are, the < /b> smaller the < /b> overall residual interference achieved by the < /b> canceller ... While power backoff, applied at the < /b> transmitter of customer B, reduces the < /b> interference for customer A, it also limits the < /b> achievable rate of customer B Figure depicts the < /b> resulting SNRs for the...
- 11
- 542
- 0
Báo cáo lâm nghiệp: "Sexual reproduction in Populus I. Some physiological and biochemical events of the progamic phase" pdf
... pollination, only in < /b> compatible pollinated stigmas The < /b> concanavalin A- peroxidase reaction allowed the < /b> visualization of 15 stigmatic and < /b> pollinic glycoproteins according Differences to the < /b> glycoprotein ... enzymes involved in < /b> pollen tube metabolism, such as ¡3-galactosidase Its activity could be the < /b> final result of a series of interactions started by initial pollen-stigma communications This dialogue ... nutrition callose Biochemical studies focused on pollinic and < /b> stigmatic proteins, known to be involved in < /b> male-female interactions (Gaude and < /b> Dumas, 1987) After silver nitrate staining, qualitative and...
- 3
- 235
- 0
Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx
... child and < /b> adolescent psychiatrist or by highly trained research assistants All research assistants were trained to reach an overall kappa equal to or greater than 0.85 at the < /b> item severity level In < /b> ... drug With the < /b> exception of the < /b> thyroid stimulating hormone level, all of these laboratories and < /b> the < /b> electrocardiogram were repeated at the < /b> end of study participation All females had a urine pregnancy ... amelioration of depressive symptomatology in < /b> this patient population Another hypothesis was that treatment with fluoxetine would be associated with a favorable safety and < /b> tolerability profile As the < /b> improvement...
- 13
- 380
- 0
effects of magnesiumphosphoruspotassium containing in water on molting, growth and survival rate of the white shrimp (litopenaeus vannamei) juveniles, reared in low salinity water
... on their yolk reserves The < /b> next larval stages (protozoea, mysis and < /b> early postlarvae respectively) remain planktonic for some time, eat phytoplankton and < /b> zooplankton, and < /b> are carried towards the < /b> ... shore by tidal currents The < /b> postlarvae change their planktonic habit about days after molting into postlarvae, move inshore and < /b> begin feeding on benthic detritus, worms, bivalves and < /b> crustaceans ... tolerance of L.< /b> vannamei to low salinity and < /b> the < /b> year-round availability of healthy postlarvae make this species an excellent candidate for inland farming Therefore, recently, farmers have been focusing...
- 70
- 427
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... metal thiolate core forming the < /b> scaffold of the < /b> two domains All metal ions are tetrahedrally surrounded by four thiolate sulphur atoms In < /b> the < /b> N-terminal b- domain, the < /b> three metal ions and < /b> the < /b> three ... rearranging its N- and < /b> C-terminal parts, minimizing the < /b> structural perturbation of its central part The < /b> arrangement of the < /b> cysteine sulphur donor atoms within the < /b> two Cu(I)-containing domains ... A for the < /b> backbone and < /b> heavy atoms, respectively Thus, the < /b> addition of metal–sulphur connectivities to the < /b> structure calculation of Zn4aMT-1 resulted in < /b> a betterresolved structural family but...
- 14
- 485
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... enlarge, but their growth totally lacked organization (rhodamine– phalloidin staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After ... PP30[hHsp9 0b] Ten micrograms of total soluble protein was gel fractionated, and < /b> then western blotted; the < /b> blot was then probed with anti-(Achlya Hsp90) monoclonal serum The < /b> bands indicated by an asterisk ... activity of Rlm1p, a transcription factor activated by cell integrity MAP kinase Loss of cell integrity MAP kinase generates a number of characteristic phenotypes in < /b> yeast, including temperature...
- 11
- 427
- 0
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt
... Macromolecules The < /b> authors are grateful to F Nano (University of Victoria, BC, Canada) for samples of antisera 3012 to Francisella sp and < /b> to J Burian and < /b> J Barlow (Microtek Intl Ltd, Saanichton, BC, Canada) ... confirmed by the < /b> observation of the < /b> weak C-5: H-2 HMBC correlation There was no data for the < /b> determination of the < /b> configuration of chiral atoms Taken together, these experimental data agreed with the < /b> ... Tween-20 The < /b> membranes were then washed and < /b> further reacted with a : 4000 dilution of second antibody, goat antirabbit IgG conjugated to alkaline phosphatase (Caltag Laboratories, Burlingame, CA, USA)...
- 12
- 397
- 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... implies that the < /b> TPa and < /b> TPb are under the < /b> transcriptional control of distinct promoters EXPERIMENTAL PROCEDURES Materials UltraspecTM total RNA isolation system was obtained from Biotecx Laboratories, ... and < /b> in < /b> trophoblast TM-1 cells and,< /b> thereafter, to establish the < /b> molecular basis of the < /b> differential expression of TPa and < /b> TPb We initially sought to characterize the < /b> major TP transcripts, with respect ... sites and < /b> regulatory elements using < /b> the < /b> Matinspector ProfessionalTM program [23] available at http://genomatix.gsf.de/cgi-bin/matinspector/ matinspector.pl All programs were used at the < /b> default...
- 16
- 321
- 0
Báo cáo toán học: "On the Entropy and Letter Frequencies of Ternary Square-Free Words" docx
... ), and < /b> the < /b> 29 841 841 29 87 growth rates for these examples are at least 21/29 Our next examples use the < /b> generating words w1 = abcacbacabcbabcabacbcabcbacbcacba w2 = abcacbcabacabcacbabcbacabacbcacba ... It is easy to see that there are only a few square- free words in < /b> two letters, these are the < /b> empty word λ, the < /b> two letters a and < /b> b, the < /b> two-letter words ab and < /b> ba, and,< /b> finally, the < /b> three-letter ... words aba and < /b> bab Appending any letter to those two words inevitably results in < /b> a square, either of a single letter, or of one of the < /b> square- free two-letter words However, there exist in< /b> nite ternary...
- 19
- 272
- 0
Báo cáo khoa hoc:" Potential benefit from using identified major gene in BLUP evaluation with truncation and optimal selection" ppt
... animals of the < /b> base population was obtained from a normal distribution with mean zero and < /b> variance a U The < /b> alleles at the < /b> major locus were chosen at random with p probability of an allele being ... information < /b> was retained at fixation with both selection methods In < /b> both mass and < /b> BLUP selection there was a clear advantage of using < /b> the < /b> major gene after fixation of the < /b> favourable allele although ... chance of losing the < /b> favourable allele and < /b> this will be potentiated with small gene effect and < /b> low initial frequency of the < /b> favourable allele In < /b> these circumstances the < /b> benefit of using < /b> information...
- 19
- 214
- 0
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx
... internal reference to normalize the < /b> data The < /b> expression levels of Foxp3 relative to that ofb-actin were calculated by using < /b> the < /b> 2-ddCt method Western blot analysis Total cellular extracts for Western ... Construction of a recombinant plasmid containing human IDO cDNA Total RNA was isolated from breast cancer MDA-MB435s cells using < /b> Trizol (Invitrogen, Carlsbad, CA) according to the < /b> manufacturer’s instructions ... Dalian, China) with the < /b> following primer pair: sense 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and < /b> antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The < /b> PCR products were inserted into the < /b> pMD19-T...
- 10
- 299
- 0
Báo cáo y học: "Bedside quantification of dead-space fraction using routine clinical data in patients with acute lung injury: secondary analysis of two prospective trials" ppt
... not routinely measured in < /b> clinical practice • In < /b> mechanically ventilated patients with ALI and < /b> ARDS, Vd/Vt can be estimated from routinely available clinical data (arterial blood gas analysis and < /b> ... distributed between survivors and < /b> non-survivors Perhaps the < /b> most noticeable contributor to error would be the < /b> absence of point -to- point temporal correlation between arterial blood gas sampling and < /b> ... and < /b> respiratory instability, variations of the < /b> CO2 pool, thermogenesis from nutrients and < /b> carbohydrate load, airleaks in < /b> the < /b> respiratory system, accumulation of intermediate metabolites and < /b> FiO2...
- 8
- 268
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25