theoretical manufacturing and clinical application aspects of a prostate brachytherapy i 125 source in brazil
Báo cáo y học: " Effects of computerized clinical decision support systems on practitioner performance and patient outcomes: Methods of a decision-makerresearcher partnership systematic review" pot
... position of decisions makers for each of the six clinical application areas Clinical Application Area Decision-maker Primary preventive care Rolf Sebaldt Position Director, Clinical Data Systems and ... update and separation into types of application were auspicious considering the maturation of the field of computerized decision support, the increasing availability and sophistication of information ... clinical staff and our regional health authority We are in the process of updating this review and, in view of the large number of trials and clinical applications, split it into six reviews: primary...
- 8
- 358
- 0
báo cáo khoa học: " Effects of computerized clinical decision support systems on practitioner performance and patient outcomes: Methods of a decision-makerresearcher partnership systematic review" pdf
... position of decisions makers for each of the six clinical application areas Clinical Application Area Decision-maker Primary preventive care Rolf Sebaldt Position Director, Clinical Data Systems and ... update and separation into types of application were auspicious considering the maturation of the field of computerized decision support, the increasing availability and sophistication of information ... clinical staff and our regional health authority We are in the process of updating this review and, in view of the large number of trials and clinical applications, split it into six reviews: primary...
- 8
- 414
- 0
Báo cáo y học: "Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in a Caucasian cohort with systemic lupus erythematosus" pot
... heterocomplex; aRibPR0: antibodies against recombinant ribosomal P0 protein; aRibPR1: antibodies against recombinant ribosomal P1 protein; aRibPR2: antibodies against recombinant ribosomal P2 protein; aRibPs: ... this article as: Barkhudarova et al.: Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in ... [16,17,22,32] A comparative investigation of the clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins (aRibPR0, aRibPR1 and aRibPR2) has never been...
- 11
- 415
- 0
Báo cáo y học: "Circulating angiopoietin-1 and angiopoietin-2 in critically ill patients: development and clinical application of two new immunoassays" pot
... concentrations Predialyzer and postdialyzer angiopoietin-1 and angiopoietin-2 concentrations Aligned dots indicate individual predialyzer and postdialyzer angiopoietin-1 (Ang-1) and angiopoietin-2 (Ang-2) ... for Ang-1 and Ang-2 assays, respectively (Figure 3) Association of circulating Ang-1 and Ang-2 concentrations with clinical and laboratory characteristics in healthy control individuals In healthy ... concentrations in serum and plasma Comparison between detection of angiopoietin-1 and angiopoietin-2 concentrations in serum and plasma (a) Angiopoietin-1 (Ang-1) and (b) angiopoietin-2 (Ang-2)...
- 11
- 311
- 0
Báo cáo y học: "Clinical aspects of a nationwide epidemic of severe haemolytic uremic syndrome (HUS) in children" ppt
... level of consciousness, hemiparesis, visual disturbances and brain stem symptoms Basal ganglia involvement is a typical MRIfinding in HUS-patients with neurological complications [15], and was present ... One boy died three days after admission of cerebral herniation Cerebral magnetic resonance imaging (MRI) showed generalised oedema and bilateral infarcts in the basal gangliae Four patients presented ... symptoms of days (range 2-10) Eight patients required dialysis (Table 2) Haemodialysis was chosen in four children, in three cases based on the severity of abdominal pain and activity of enterocolitis...
- 6
- 288
- 0
Tài liệu Propellants and Explosives: Thermochemical Aspects of Combustion docx
... (1.42)−(1.44), is obtained when a stationary shock wave is created in a moving coordinate system, the same relationship is obtained for a moving shock wave in a stationary coordinate system In a stationary ... lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data are available in the Internet at http://dnb.d-nb.de © 2007 WILEY-VCH Verlag GmbH & Co KGaA, Weinheim All ... Determination of Lenoir−Robilard Parameters 378 Combustion Instability 380 T* Combustion Instability 380 L* Combustion Instability 383 Acoustic Combustion Instability 386 Nature of Oscillatory...
- 532
- 422
- 1
Tài liệu FRONTIERS IN UNDERSTANDING CLIMATE CHANGE AND POLAR ECOSYSTEMS REPORT OF A WORKSHOP docx
... National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding engineers It is autonomous in its administration ... emerging interdisciplinary questions and topics with the goal of understanding polar systems in a changing world and identifying new capabilities to study marine and terrestrial ecosystems that might ... (e.g., fires, logging, insect infestation), migrations of flora and fauna, coastal erosion, and hydrological and carbon-related impacts of warming and permafrost degradation Major ice-albedo and...
- 87
- 467
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... stability via specific charged amino acids (Results shown in the preceding paper), other nonelectrostatic interactions at even more specific positions play a significant role in maintaining SNase tertiary ... Protein purification Escherichia coli JM105 carrying recombinant plasmids were grown in Luria–Bertani broth containing 100 lgÆmL)1 ampicillin at 37 °C Protein expression was induced by adding isopropyl ... mutagenesis Fig Global segment interactions and the folding profiles in wildtype SNase (A) W140, in loop interacts with loop and loop which forms a ‘lower neck’ network area in maintaining protein...
- 7
- 551
- 0
Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx
... politicians and bankers It was also the means to finance the interventionist foreign policy so recently adopted, by creating money and credit out of thin air Political pain and economic disruption ... standard, the CPI increased 10 percent In his 1848 Communist Manifesto, Karl Marx urged: “Centralization of credit in the hands of the state, by means of a national bank with state capital and ... restraints on the politicians and their power to run the printing presses indiscriminately After the Second World War, we remained a wealthy nation, especially in comparison to the nations ravaged...
- 111
- 1,231
- 0
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf
... equilibrium According to the kinetic turbidity curve, a different intrinsic rate of nucleation of aggregation is suggested Filibration of R4 is considerably easier than that of pR4 In addition, ... form of R4 in vitro Discussion Knowing what regions of the protein tau are involved in its aggregation into aberrant filaments and what molecular structure is induced by aggregation are critical ... towards understanding the mechanisms involved in the pathological aggregation of tau Tau protein purified from brain extracts or recombinant tau is able to aggregate in vitro at high protein concentrations...
- 9
- 428
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... substantially to the ligand binding kinetics of the PAS domain of Ec DOS, as it does in myoglobin and hemoglobin Examination of the effects of these hydrophobic amino acids on the kinetics of O2 and ... T, Yoshimura T, Yamauchi S, Sagami I & Shimizu T (2004) Activation of hemeregulated eukaryotic initiation factor 2a kinase by nitric oxide is induced by the formation of a five-coordinate NO-Heme ... Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and Met95 mutants of the isolated heme domain of a direct...
- 14
- 390
- 0
Biochemical and physiological aspects of human nutrition units i & II
... Chemistry and Physical Properties of Vitamin A and Carotenoids 600 Physiological Functions of Vitamin A 602 Absorption, Transport, Storage, and Metabolism of Vitamin A and Carotenoids 607 Retinoid-Binding ... of Vitamin B6 511 Bioavailability and Absorption of Vitamin B6 511 Transport, Metabolism, and Tissue Accumulation of Vitamin B6 511 Metabolic Functions of Vitamin B6 513 Vitamin B6 Deficiency: ... Vitamin B12 501 Sources of Vitamin B12 501 Bioavailability and Absorption of Vitamin B, 502 Contents • • • xxiii Transport of Vitamin B12 503 Intracellular Metabolism of Vitamin B12 504 Metabolic...
- 232
- 610
- 0
Measuring and modelling the performance of a parallel ODMG compliant object database server potx
... which allows users to be insulated from details on the machine architecture and physical characteristics of data In those systems, query optimization and parallelization are automatic, having as a ... shared-nothing machine and implements partitioned, pipelined and independent intra-query forms of parallelism, as well as inter-query parallelism By its inter-query parallelism, Teradata allows several ... expressions, forwarding each OQL expression to a query compiler and waiting for results A navigational client executes an application written in a programming language, which makes an arbitrary traversal...
- 47
- 1,604
- 0
synthesis, electrical measurement, and field emission properties of a-fe2o3 nanowires
... graph of the formation of a- Fe2O3 NWs is shown in Fig Samples I and II represent the thin and thick iron films, respectively After oxidation for a period of time (stage A) , the thin iron film (sample ... electronic characterization, and field emission application of a- Fe2O3 NWs were studied a- Fe2O3 NWs were grown vertically on the substrate via the thermal oxidation of an iron film in air at 350 ... 34 A a The popular density of the NWs per cm2 b Rtotal: the resistance of the total NWs in a unit cm2 Fig A schematic graph of the formation of the a- Fe2O3 NWs in thin and thick iron Fig (a) ...
- 8
- 403
- 0
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... internationalization of accounting standards are forcing companies to rethink a U.S.-centric approach to business and accounting And in the United States, the internationalization of accounting standards ... and more vulnerable and have increased financial market volatility Our research identified globalization1 as a significant and growing trend impacting internal audit today and in the future As ... English, GAAP accounting, the nuances of Chinese culture, and the primary language of China, Mandarin As the company expands internationally, its internal audit activities will continue to shift...
- 68
- 456
- 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG ... Coffman et al [16] reported the important role of the aspartic residue at position 99 of UGT2B7 in the binding of morphine When this charged amino acid was substituted with alanine, a dramatic ... Lorraine, as well as the Academy of Finland (Project 210933) We thank J, Mosorin for excellent technical assistance and PI Mackenzie (Flinders University, Adelaide, Australia) for kindly providing...
- 9
- 343
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... identification and structural analysis of a Sial-lNnT unit in H in uenzae LPS MATERIALS AND METHODS Bacterial strains and culture conditions The H in uenzae strain RM118 (Rd) is derived from the same ... treatment with neuraminidase, an enzyme that specifically cleaves sialic acid residues (Fig 1; lanes and 2) H in uenzae LPS typically migrates as a complex series of bands in SDS/PAGE, each band ... (2001) A rapid and sensitive procedure for the determination of 5-N-acetyl neuraminic acid in lipopolysaccharides of Haemophilus in uenzae: a survey of 24 non-typeable H in uenzae strains Carbohydr...
- 11
- 579
- 0
ELECTRONIC SCIENTIFIC, TECHNICAL, AND MEDICAL JOURNAL PUBLISHING AND ITS IMPLICATIONS REPORT OF A SYMPOSIUM docx
... National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding engineers It is autonomous in its administration ... to have a single standard mode (i. e., the journal) We can think about presenting information in lots of different ways and repackaging it and distributing it in different combinations What is ... issues raised included caution about an over-reliance on statistical indicators or metrics in judging the quality of information or of publishing activities; the relative merits of the traditional,...
- 122
- 405
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... the stabilization of the anion transition state In the latter case, if the substrate coordination to the metal ion is not bidentate, interaction of the single metal ion in the active site with ... DNA ligase and Pfx polymerase were from Invitrogen (Burlington, Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained ... Vmax =Kd where V is the initial velocity at various concentrations of metal ions [M], and Vmax is the maximal catalytic rate at saturating metal ion concentration [31] Determination of number of...
- 9
- 461
- 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... isoelectric point of 12.5, and contains nuclear localization signal motifs, a helix-turn-helix DNA-binding motif and an intermediate filament protein-like structure as shown in Fig 3A The amino acid ... Peptidyl-prolyl-cis-trans isomerase B precursor Fragment of lamin A or C Lamin A Lamin C or lamin A fragment Fragment of lamin A or C Fragment of lamin A or C Fragment of lamin A or C ATP binding cassette, ... is also located in intracellular vesicles [28] Actin-binding protein ACF7, neural isoform 2, is a member of the dystonin subfamily and the beta-spectrin superfamily Fig Preparation of an anti-ISP36...
- 12
- 400
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25