theater but it could also be performed successfully on one or two bed mats spread in the middle of a communal house with a cast of only three a hero a heroine and a clown
... CAUAUAGUGUACUGUGUUUUAACAAACGAUUUACACUGACU GUUGCUGUACAAGUGAAUUUGGAAAUAAAGUUAUUACUCUG AUUAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA This cis-acting signal of tau was compared base by base withthe other afore mentioned ... GUCCGCACCCUGCUGCGCUGUAGUCGGAUUCGUCUGUUUGU CUGGGUUCACCAGAGUGACUAUGAUAGUGAAAAGAAAAAGA AAAAGAAAAAAGAAAAAAGAAAAAAAAAAAAGGACGCAUGU UAUCUUGAAAUAUUUGUCAAAAGGUUGUAGCCCACCGCAGG GAUUGGAGGGCCUGAUAUUCCUUGUCUUCUUCGUGACUUAG ... GACCAGCUUGUCACCUAACCUGCUUUUGUGGCUCGGGUUUG GCUCGGGACUUCAAAAUCAGUGAUGGGAAAAAGUAAAUUUC AUCUUUCCAAAUUGAUUUGUGGGCUAGUAAUAAAAUAUUUU UAAGGAAGGAAAAAAAAAACACGUAAAACCAUGGCCAAACA AAACCCAACAUUUCCUUGGCAAUUGUUAUUGACCCCGCCCC...
... that adults cannot learn quickly Adults have many skills that compensate for the decline inthe ability ofthe brain to grasp and remember new material They can organize their learning by setting ... is the best option for their children They are unhappy withthe quality or depth of education offered inthe schools, or have other reasons why they feel that traditional schools are not suitable ... people in other countries who are suffering from famine, drought, war, or disease However, many rich countries also donate money for political or diplomatic reasons They want to maintain a relationship...
... regulator in adipogenesis, PPARc also plays a key role in maintaining the characteristics of mature adipocytes, and recent reports revealed that PPARc was required for the transcriptional activity ... and lipoma, but lower or negative in liposarcoma GAPDH was used as the loading control (D) The relative quantity of CIDEC protein was analyzed using QUANTITY ONE software (The relative protein ... subsequently incubated withthe second antibody (Dako, Copenhagen, Denmark) at 37 °C for 40 min, and stained with 3,3¢-Diaminobenzidine-H2O2 for 5–10 and counterstained with hematoxylin Quantitative...
... picture, information, data or knowledge through any mode or medium; or (xii) obtaining, compiling, recording, maintaining, transmitting, holding or using the information or data or knowledge; or (xiii) ... from same raw materials and by using similar or same production process, having similar physical or chemical characteristics and common unit of measurement, and having same or similar usage or application; ... is engaged inthe production, processing, manufacturing, or mining activities and wherein, the aggregate value of net worth as onthe last date ofthe immediately preceding financial year exceeds...
... the variant witha single break point located between nt332 and nt368 The proportion ofthe dominant variant is larger inthe passaged recTULV (13 of 14 cDNA clones analyzed, or 93%) than inthe ... products of random recombination due to their lower fitness (the situation reported for polio- and coronaviruses [22,23]), or both, remains unclear We favor the first explanation as the modeling ofthe ... http://www.virologyj.com/content/2/1/12 Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages ofthe mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the...
... the variant witha single break point located between nt332 and nt368 The proportion ofthe dominant variant is larger inthe passaged recTULV (13 of 14 cDNA clones analyzed, or 93%) than inthe ... products of random recombination due to their lower fitness (the situation reported for polio- and coronaviruses [22,23]), or both, remains unclear We favor the first explanation as the modeling ofthe ... http://www.virologyj.com/content/2/1/12 Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages ofthe mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the...
... cells could have a role inthe perpetuation and exacerbation of already established disease rather than having any direct influence onthe initiation phase of arthritis Competing interests It is ... the panel of monoclonal antibodies generated, a combination of an IgG2b antibody ofthe clone M2139 binding to the J1 epitope (amino acids 551–564) and an IgG 2a antibody ofthe clone CIIC1 binding ... was scored with an extended scoring protocol ranging from to 15 for each paw, witha maximum score of 60 per mouse, based onthe number of inflamed joints in each paw, inflammation being defined...
... HA could compete with heparin for the heparin-binding region of antithrombin Remarkably, HA affected the inhibition by antithrombin only within the range 250–1000 µg/ml At concentrations above ... citrullination of antithrombin play important roles in initiating the RA pathogenic process, whereas inhibition of antithrombin by HA contributes to the development of RA rather than its initiation, ... nature of other diseases the activity of antithrombin (AT) Effects of various metal ions on ability of hyaluronic acid (HA) to inhibit the activity of antithrombin (AT) HA (1000 µg/ml) and antithrombin...
... into their patellar cartilage After 2-3 days, this has reached a low point, and thereafter the incorporation rapidly increases above normal incorporation levels By day 4, the incorporation of 35SO42- ... Immunohistochemical analysis of transforming growth factor beta isoforms and their receptors in human cartilage from normal and osteoarthritic femoral heads Rheumatol Int 2003, 25:118-124 van Beuningen HM, van ... cartilage damage in OA is thought to bea consequence ofa misbalance between anabolic and catabolic factors, favor- Available online http://arthritis-research.com/content/8/3/R65 ing the catabolic...
... been a valid indication of total MMP activity and thereby the catabolic potential ofthe culture [6] Gelatinase activity at 7, 11, and 17 days after catabolic treatment was compared with gelatinase ... by the 342FFGVG-G2 and CTX biochemical markers) andthe inability of cytokine-treated chondrocytes to initiate and /or maintain anabolic activity Switching to anabolic stimulation after short-term ... using guanidine extraction and papain digestion, Page of 12 (page number not for citation purposes) Arthritis Research & Therapy Vol 10 No Karsdal et al Figure Quantification of aggrecan within...
... In an era of combination therapy andthe selection of MDR mutations, it is important to assess the interaction among mutations in relation to viral replication fitness andthe possible impact on ... assays were performed for each RT and statistical values that include mean, median, standard deviation and maximum and minimum were obtained A paired analysis with ttest was performed to compare ... isoleucine’s branches are one methyl andone ethyl group Therefore, isoleucine (Ile or I) has an additional methyl group as a side chain in comparison to valine (Val or V) As a consequence Ile has a longer...
... complex consisting ofa specific, high-affinity α chain (IL-4Rα) anda second chain that can be either the common γ chain orthe α chain ofthe IL-13 receptor (IL-13Rα) [23] The common γ chain is ... Gao PS, Mao XQ, Roberts MH, Arinobu Y, Akaiwa M, Enomoto T, Dake Y, Kawai M, Sasaki S, Hamasaki N, Izubara K, Shirakawa T, Hopkin JM: Variants of STAT-6 (signal transducer and activator of transcription ... chains ofthe heterodimer are required to initiate intracellular signaling (b) The sIL-4R consists ofthe extracellular portion of IL-4Rα It retains the ability to bind IL-4 with high affinity...
... compatible withthe current theory ofthe pathogenesis of sepsis elaborating a connection between the production of proinflammatory cytokines by monocytes andthe intensity ofthe inflammatory ... requiring the administration of vasopressors [12] Sedation was achieved in all patients withthe intravenous administration of midazolame and propofol 1% Upon enrolment inthe study, quantitative ... ona daily basis for a total of 28 days; evaluation comprised lung X-rays, estimation ofthe pO2/FiO2 ratio andofthe Acute Physiology and Chronic Health Evaluation II and Sequential Organ Failure...
... of greater than 11 predicted a mortality of 95% When the initial score was to 11, an unchanged or increasing score was associated witha mortality rate of 60% (initial score of to and mortality ... patients admitted to a UK teaching hospital We compared this withthe initial SOFA score as the organ dysfunction measure within a triage prioritization tool To our Adeniji and Cusack Critical ... time delay to triage) SOFA incorporation ofthe latter would result ina delay in decision making and consumption of stretched laboratory resources Additionally, whereas the variability inthe subjective...
... and confiscate; and, most important, the willingness to share the proceeds The initiation of an action by a foreign authority may take place inoneoftwo ways: Authorities inthe jurisdiction ... success onthe merits and an imminent risk in delaying a decision The principal disadvantages of litigating ina foreign jurisdiction are the cost of tracing assets andthe legal fees entailed in ... Handbook has more control in pursuing civil proceedings and assets inthe hands of third parties and may have the advantage ofa lower standard of proof For example, civil cases in common law...
... pretty.”) The contents ofthe container are often more important than the container itself But if you are honest with yourself (and I hope you will be honest), both the container andthe contents matter ... dreams with them.) I won’t belabor the past, but for the record, my professional goal was to become a cosmetologist I then morphed my love for hair and my fascination ofthe dead into a dream of ... everyday he’s “hustling.” I’m not saying go out and get a pair of baggy pants, a chain of canary diamonds anda lavish pad in South Beach, but what I am saying is “Work Your Plan and Plan to Work.”...
... As most of them had asymptomatic brain and bone metastases, with around a third with more than one metastatic sites, the way of extrathoracic assessment ofthe disease can be put into question ... 18 patients with adenocarcinoma, onewith bronchioloalveolar carcinoma andtwowith adenosquamous carcinoma Postoperatively, 23(26.1%) patients underwent adjuvant therapy (21 irradiation and ... Chemotherapy alone was given to two patients, whilst one patient underwent chemotherapy combined with radiation therapy Univariate and multivariate analysis of prognostic factors Univariate analysis...
... chemotherapy and TAM The remaining 40 patients were treated onlywiththe AI (Additional File 1) The serum levels of E2, LH and FSH were assayed prior to administration ofthe AI and then at 3, 6, and ... increased again at months in spite of having been decreased through months after starting AI administration (Fig 1) In addition, the assay results also showed that, due to the administration ofthe AI, ... Tokushima Breast Care Clinic, the criterion for indication of AI administration is hormone receptor-positive, postmenopausal breast cancer Menopause was defined as the state of having undergone bilateral...
... sau: Jack was an excellent tennis player He could (= he had the ability to beat anybody) Jack đấu thủ quần vợt tuyệt vời Anh ta thắng - But once be had a difficult game against Alf Alf played very ... very well butinthe end Jack was able to beat him (= he managed to beat him in this particular game) Nhưng có lần có đấu căng thẳng với Alf Alf chơi hay cuối Jack đánh bại (= Anh ta tìm cách ... - The fire spread through the building very quickly everyone was able to escape Ngọn l a lan khắp nhà nhanh người tìm cách thoát thân (không nói could escape”) - They didn’t want to come with...