0

theater but it could also be performed successfully on one or two bed mats spread in the middle of a communal house with a cast of only three a hero a heroine and a clown

Báo cáo y học:

Báo cáo y học: " Possible Cis-acting signal that could be involved in the localization of different mRNAs in neuronal axons" potx

Báo cáo khoa học

... CAUAUAGUGUACUGUGUUUUAACAAACGAUUUACACUGACU GUUGCUGUACAAGUGAAUUUGGAAAUAAAGUUAUUACUCUG AUUAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA This cis-acting signal of tau was compared base by base with the other afore mentioned ... GUCCGCACCCUGCUGCGCUGUAGUCGGAUUCGUCUGUUUGU CUGGGUUCACCAGAGUGACUAUGAUAGUGAAAAGAAAAAGA AAAAGAAAAAAGAAAAAAGAAAAAAAAAAAAGGACGCAUGU UAUCUUGAAAUAUUUGUCAAAAGGUUGUAGCCCACCGCAGG GAUUGGAGGGCCUGAUAUUCCUUGUCUUCUUCGUGACUUAG ... GACCAGCUUGUCACCUAACCUGCUUUUGUGGCUCGGGUUUG GCUCGGGACUUCAAAAUCAGUGAUGGGAAAAAGUAAAUUUC AUCUUUCCAAAUUGAUUUGUGGGCUAGUAAUAAAAUAUUUU UAAGGAAGGAAAAAAAAAACACGUAAAACCAUGGCCAAACA AAACCCAACAUUUCCUUGGCAAUUGUUAUUGACCCCGCCCC...
  • 10
  • 301
  • 0
Tài liệu Telecommuting: will it change the world? Telecommuting will have major effects in the worlds of work pdf

Tài liệu Telecommuting: will it change the world? Telecommuting will have major effects in the worlds of work pdf

Hóa học - Dầu khí

... that adults cannot learn quickly Adults have many skills that compensate for the decline in the ability of the brain to grasp and remember new material They can organize their learning by setting ... is the best option for their children They are unhappy with the quality or depth of education offered in the schools, or have other reasons why they feel that traditional schools are not suitable ... people in other countries who are suffering from famine, drought, war, or disease However, many rich countries also donate money for political or diplomatic reasons They want to maintain a relationship...
  • 9
  • 660
  • 0
Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf

Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf

Báo cáo khoa học

... regulator in adipogenesis, PPARc also plays a key role in maintaining the characteristics of mature adipocytes, and recent reports revealed that PPARc was required for the transcriptional activity ... and lipoma, but lower or negative in liposarcoma GAPDH was used as the loading control (D) The relative quantity of CIDEC protein was analyzed using QUANTITY ONE software (The relative protein ... subsequently incubated with the second antibody (Dako, Copenhagen, Denmark) at 37 °C for 40 min, and stained with 3,3¢-Diaminobenzidine-H2O2 for 5–10 and counterstained with hematoxylin Quantitative...
  • 11
  • 513
  • 0
[TO BE PUBLISHED IN THE GAZETTE OF INDIA, EXTRAORDINARY PART-II, SECTION-3, SUB-SECTION (i)] - MINISTRY OF CORPORATE AFFAIRS potx

[TO BE PUBLISHED IN THE GAZETTE OF INDIA, EXTRAORDINARY PART-II, SECTION-3, SUB-SECTION (i)] - MINISTRY OF CORPORATE AFFAIRS potx

Kế toán - Kiểm toán

... picture, information, data or knowledge through any mode or medium; or (xii) obtaining, compiling, recording, maintaining, transmitting, holding or using the information or data or knowledge; or (xiii) ... from same raw materials and by using similar or same production process, having similar physical or chemical characteristics and common unit of measurement, and having same or similar usage or application; ... is engaged in the production, processing, manufacturing, or mining activities and wherein, the aggregate value of net worth as on the last date of the immediately preceding financial year exceeds...
  • 11
  • 460
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Điện - Điện tử

... the variant with a single break point located between nt332 and nt368 The proportion of the dominant variant is larger in the passaged recTULV (13 of 14 cDNA clones analyzed, or 93%) than in the ... products of random recombination due to their lower fitness (the situation reported for polio- and coronaviruses [22,23]), or both, remains unclear We favor the first explanation as the modeling of the ... http://www.virologyj.com/content/2/1/12 Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the...
  • 5
  • 483
  • 0
báo cáo hóa học:

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

Hóa học - Dầu khí

... the variant with a single break point located between nt332 and nt368 The proportion of the dominant variant is larger in the passaged recTULV (13 of 14 cDNA clones analyzed, or 93%) than in the ... products of random recombination due to their lower fitness (the situation reported for polio- and coronaviruses [22,23]), or both, remains unclear We favor the first explanation as the modeling of the ... http://www.virologyj.com/content/2/1/12 Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the...
  • 5
  • 430
  • 0
Báo cáo y học:

Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

Báo cáo khoa học

... cells could have a role in the perpetuation and exacerbation of already established disease rather than having any direct influence on the initiation phase of arthritis Competing interests It is ... the panel of monoclonal antibodies generated, a combination of an IgG2b antibody of the clone M2139 binding to the J1 epitope (amino acids 551–564) and an IgG 2a antibody of the clone CIIC1 binding ... was scored with an extended scoring protocol ranging from to 15 for each paw, with a maximum score of 60 per mouse, based on the number of inflamed joints in each paw, inflammation being defined...
  • 7
  • 434
  • 1
Báo cáo y học:

Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx

Báo cáo khoa học

... HA could compete with heparin for the heparin-binding region of antithrombin Remarkably, HA affected the inhibition by antithrombin only within the range 250–1000 µg/ml At concentrations above ... citrullination of antithrombin play important roles in initiating the RA pathogenic process, whereas inhibition of antithrombin by HA contributes to the development of RA rather than its initiation, ... nature of other diseases the activity of antithrombin (AT) Effects of various metal ions on ability of hyaluronic acid (HA) to inhibit the activity of antithrombin (AT) HA (1000 µg/ml) and antithrombin...
  • 6
  • 437
  • 0
Báo cáo y học:

Báo cáo y học: " TGF β-induced cartilage repair is maintained but fibrosis is blocked in the presence of Smad7" pps

Báo cáo khoa học

... into their patellar cartilage After 2-3 days, this has reached a low point, and thereafter the incorporation rapidly increases above normal incorporation levels By day 4, the incorporation of 35SO42- ... Immunohistochemical analysis of transforming growth factor beta isoforms and their receptors in human cartilage from normal and osteoarthritic femoral heads Rheumatol Int 2003, 25:118-124 van Beuningen HM, van ... cartilage damage in OA is thought to be a consequence of a misbalance between anabolic and catabolic factors, favor- Available online http://arthritis-research.com/content/8/3/R65 ing the catabolic...
  • 8
  • 382
  • 0
Báo cáo y học:

Báo cáo y học: "Cartilage degradation is fully reversible in the presence of aggrecanase but not matrix metalloproteinase activity" pdf

Báo cáo khoa học

... been a valid indication of total MMP activity and thereby the catabolic potential of the culture [6] Gelatinase activity at 7, 11, and 17 days after catabolic treatment was compared with gelatinase ... by the 342FFGVG-G2 and CTX biochemical markers) and the inability of cytokine-treated chondrocytes to initiate and /or maintain anabolic activity Switching to anabolic stimulation after short-term ... using guanidine extraction and papain digestion, Page of 12 (page number not for citation purposes) Arthritis Research & Therapy Vol 10 No Karsdal et al Figure Quantification of aggrecan within...
  • 12
  • 485
  • 0
Báo cáo y học:

Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx

Báo cáo khoa học

... In an era of combination therapy and the selection of MDR mutations, it is important to assess the interaction among mutations in relation to viral replication fitness and the possible impact on ... assays were performed for each RT and statistical values that include mean, median, standard deviation and maximum and minimum were obtained A paired analysis with ttest was performed to compare ... isoleucine’s branches are one methyl and one ethyl group Therefore, isoleucine (Ile or I) has an additional methyl group as a side chain in comparison to valine (Val or V) As a consequence Ile has a longer...
  • 12
  • 369
  • 0
Báo cáo y học:

Báo cáo y học: " Th2 cytokines and asthma Interleukin-4: its role in the pathogenesis of asthma, and targeting it for asthma treatment with interleukin-4 receptor antagonists" pot

Báo cáo khoa học

... complex consisting of a specific, high-affinity α chain (IL-4Rα) and a second chain that can be either the common γ chain or the α chain of the IL-13 receptor (IL-13Rα) [23] The common γ chain is ... Gao PS, Mao XQ, Roberts MH, Arinobu Y, Akaiwa M, Enomoto T, Dake Y, Kawai M, Sasaki S, Hamasaki N, Izubara K, Shirakawa T, Hopkin JM: Variants of STAT-6 (signal transducer and activator of transcription ... chains of the heterodimer are required to initiate intracellular signaling (b) The sIL-4R consists of the extracellular portion of IL-4Rα It retains the ability to bind IL-4 with high affinity...
  • 5
  • 365
  • 0
Bóa cáo y học:

Bóa cáo y học: " Early apoptosis of blood monocytes in the septic host: is it a mechanism of protection in the event of septic shock" ppt

Báo cáo khoa học

... compatible with the current theory of the pathogenesis of sepsis elaborating a connection between the production of proinflammatory cytokines by monocytes and the intensity of the inflammatory ... requiring the administration of vasopressors [12] Sedation was achieved in all patients with the intravenous administration of midazolame and propofol 1% Upon enrolment in the study, quantitative ... on a daily basis for a total of 28 days; evaluation comprised lung X-rays, estimation of the pO2/FiO2 ratio and of the Acute Physiology and Chronic Health Evaluation II and Sequential Organ Failure...
  • 8
  • 350
  • 0
Báo cáo y học:

Báo cáo y học: " The Simple Triage Scoring System (STSS) successfully predicts mortality and critical care resource utilization in H1N1 pandemic flu: a retrospective analysis" doc

Báo cáo khoa học

... of greater than 11 predicted a mortality of 95% When the initial score was to 11, an unchanged or increasing score was associated with a mortality rate of 60% (initial score of to and mortality ... patients admitted to a UK teaching hospital We compared this with the initial SOFA score as the organ dysfunction measure within a triage prioritization tool To our Adeniji and Cusack Critical ... time delay to triage) SOFA incorporation of the latter would result in a delay in decision making and consumption of stretched laboratory resources Additionally, whereas the variability in the subjective...
  • 9
  • 309
  • 0
This chapter studies the role of bank and nonbank fi nancial intermediaries in the provision of longterm fi nance. In particular, based on data from different fi nancial institutions, it reports on the extent to which fi nancial institutions hold longterm

This chapter studies the role of bank and nonbank fi nancial intermediaries in the provision of longterm fi nance. In particular, based on data from different fi nancial institutions, it reports on the extent to which fi nancial institutions hold longterm

Tổng hợp

... and confiscate; and, most important, the willingness to share the proceeds The initiation of an action by a foreign authority may take place in one of two ways: Authorities in the jurisdiction ... success on the merits and an imminent risk in delaying a decision The principal disadvantages of litigating in a foreign jurisdiction are the cost of tracing assets and the legal fees entailed in ... Handbook has more control in pursuing civil proceedings and assets in the hands of third parties and may have the advantage of a lower standard of proof For example, civil cases in common law...
  • 14
  • 447
  • 0
IT IS WHAT IT IS…BUT IT DOESN’T HAVE TO BE THAT WAY By Janyata Frazier pot

IT IS WHAT IT IS…BUT IT DOESN’T HAVE TO BE THAT WAY By Janyata Frazier pot

Tâm lý - Nghệ thuật sống

... pretty.”) The contents of the container are often more important than the container itself But if you are honest with yourself (and I hope you will be honest), both the container and the contents matter ... dreams with them.) I won’t belabor the past, but for the record, my professional goal was to become a cosmetologist I then morphed my love for hair and my fascination of the dead into a dream of ... everyday he’s “hustling.” I’m not saying go out and get a pair of baggy pants, a chain of canary diamonds and a lavish pad in South Beach, but what I am saying is “Work Your Plan and Plan to Work.”...
  • 93
  • 408
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Serum estradiol should be monitored not only during the peri-menopausal period but also the post-menopausal period at the time of aromatase inhibitor administration" pdf

Báo cáo khoa học

... As most of them had asymptomatic brain and bone metastases, with around a third with more than one metastatic sites, the way of extrathoracic assessment of the disease can be put into question ... 18 patients with adenocarcinoma, one with bronchioloalveolar carcinoma and two with adenosquamous carcinoma Postoperatively, 23(26.1%) patients underwent adjuvant therapy (21 irradiation and ... Chemotherapy alone was given to two patients, whilst one patient underwent chemotherapy combined with radiation therapy Univariate and multivariate analysis of prognostic factors Univariate analysis...
  • 11
  • 332
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Serum estradiol should be monitored not only during the peri-menopausal period but also the post-menopausal period at the time of aromatase inhibitor administration" pps

Báo cáo khoa học

... chemotherapy and TAM The remaining 40 patients were treated only with the AI (Additional File 1) The serum levels of E2, LH and FSH were assayed prior to administration of the AI and then at 3, 6, and ... increased again at months in spite of having been decreased through months after starting AI administration (Fig 1) In addition, the assay results also showed that, due to the administration of the AI, ... Tokushima Breast Care Clinic, the criterion for indication of AI administration is hormone receptor-positive, postmenopausal breast cancer Menopause was defined as the state of having undergone bilateral...
  • 5
  • 281
  • 0
Bài soạn Can,could and be able to

Bài soạn Can,could and be able to

Tiếng anh

... sau: Jack was an excellent tennis player He could (= he had the ability to beat anybody) Jack đấu thủ quần vợt tuyệt vời Anh ta thắng - But once be had a difficult game against Alf Alf played very ... very well but in the end Jack was able to beat him (= he managed to beat him in this particular game) Nhưng có lần có đấu căng thẳng với Alf Alf chơi hay cuối Jack đánh bại (= Anh ta tìm cách ... - The fire spread through the building very quickly everyone was able to escape Ngọn l a lan khắp nhà nhanh người tìm cách thoát thân (không nói could escape”) - They didn’t want to come with...
  • 2
  • 3,267
  • 65

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25