the synthesis of the modified tetrapyrrole known asd1haem requires several dedicated proteins which are coded for by a set of genes that are often found adjacent to the structural gene
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
Ngày tải lên :
25/10/2012, 10:51
... of a monolayer of inner
circular muscle, which makes its wall weak, as com-
pared to the small intestine that is formed of the inner
circular and outer longitudinal muscle layers. The
vasa ... recta, which supply the mucosa and submucosa
of the colon, penetrate the circular muscle. The
weakness of the vascular portals in the circular muscle
possibly causes mucosal herniation into the ... owing to incomplete bowel preparation. The
bleeding was controlled by #3-0 Vycryl intracorporeal
suture, and the invagination of the diverticulum was
performed laparoscopically. The recovery was...
- 3
- 531
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
Ngày tải lên :
21/02/2014, 01:21
... orientation
(Figs2and 3A) .Ofthese,five(ataP3, ataP5, ataP4, ataP10
and ataP7) are highly similar to known or putative genes
that are known or proposed to be implicated in the
biosynthesis of the aminonucleoside ... pur
cluster of S. alboniger [6]. They were accordingly named
ataP3, ataP5, ataP4, ataP10 and ataP7. The two additional
ones were named ata12 and ataPKS1 (Figs 2 and 3). All
shared a codon usage and a G+C ... recombinant DNA techniques that are
employed to prepare specific mutants. Therefore, we used
the latter approach to identify the function of several ataP
genes by analyzing the complementation of S. alboniger
strain...
- 9
- 728
- 0
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt
Ngày tải lên :
15/03/2014, 19:20
... Chart 3
illustrates the magnitude of DAC bilateral donor
commitments to the ICT infrastructure in total values and as a share of DAC countries’ total
bilateral sector allocable ODA. Over the ... period 1990 to 2002, the share of aid for the ICT
infrastructure dropped from a high of 4.5% of total bilateral sector allocable ODA to a low of
only 0.6% in 2002.
The rationale for the decline ...
recognition of the crucial role of basic and advanced communication and information
capabilities as a tool for development. This recognition includes awareness of the gaps that
continue to exist in access...
- 125
- 1.3K
- 0
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot
Ngày tải lên :
16/03/2014, 22:20
... end
The contact area of the Nt amidinium end (NAE) was
investigated by evaluating the interaction energies and
hydrogen positions of the end fragment and the bases
of base pair T8 -A2 5 and base ... more
efficiently than do alternating ATAT tracts [6,7],
resulting in a preference for binding to the DNA
in the order AATT > TAAT ¼ TTAA ¼ ATAT >
TATA [8].
For AATT tracts, binding of the drug can be ... bifurcated hydrogen
bonds are formed between the amide nitrogen atoms of the drug and the
N3 and O2 atoms of A and T base pairs, respectively, clearly cataloging
the structure to class I. As the...
- 11
- 483
- 0
Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt
Ngày tải lên :
20/02/2014, 09:20
... Recorder also allows users to add
utterances of their choice to the corpus of speech
for the synthetic voice. These utterances are those
the user wants to be synthesized clearly and will
automatically ...
has become intricately associated with their identi-
ty is not only traumatic to the individual but to
family and friends as well.
A form of synthesis that incorporates the quali-
ties of ... are automatical-
ly stored with broad phonetic labels. The automatic
saving function will reduce the time of recordings
and the potential risk for miscataloging the files.
Currently, the automatic...
- 4
- 419
- 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
Ngày tải lên :
07/03/2014, 05:20
... eIF 2a- kinases could be explained by the
innate adaptor function of Nck. For example, Nck is
known to translocate specific effectors to a subset of
activated receptor tyrosine kinases at the plasma
membrane ... mediating
the activation of eIF 2a- kinases.
Nck fails to alter GCN2-mediated eIF2aSer51
phosphorylation
To ascertain that the effect of Nck-1 on eIF2aSer51
phosphorylation by eIF 2a- kinases is a general ... activation of these proteins.
In addition to its regulation by eIF 2a- kinases, the lev-
els of eIF2aSer51 phosphorylation are also controlled
by eIF 2a- phosphatase activities that specifically
dephosphorylate...
- 11
- 376
- 0
Support to woman by a companion of her choice during childbirth: a randomized controlled trial potx
Ngày tải lên :
14/03/2014, 16:20
... Institutional Review Board
and by the director of the hospital. At the time of the study
for women to have a companion during labor was not a
policy at that institution, as it is still not for the majority
of ... one hand there is a general
belief that a labor companion has always positive effects,
there are, , on the other hand still a lot of health facilities
where companions are not allowed, especially ... or fetal distress.
Exclusion criteria were: unavailability of a companion;
fetal malformation; maternal disease and/or indication
for elective Caesarean section.
The study was approved by the Institutional...
- 7
- 337
- 0
The Role of Genetically Modified Organisms (GMOs) in Beverage Production
Ngày tải lên :
25/10/2013, 21:20
... in place of saturated fatty
acids. It is possible to increase the content of vitamin E, a natural antioxidant,
and to insert the capability of producing plant-based omega-3 fatty acids
into oil ... therefore, the Þnal assess-
ment of safety is always comparative.
The scientiÞc basis of the evaluation process is the concept of “substantial
equivalence.” Regulatory agencies compare GM crops to their ... mutagenesis, create signiÞcant changes in
the genetic makeup of plants and animals due to the random recombination
and sorting of thousands of genes. As a result of intervention by people, the
hybrid...
- 6
- 498
- 0
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf
Ngày tải lên :
14/02/2014, 22:20
... following the uptake of satu-
rated and unsaturated FFAs into the cells. After their
internalization, FFAs are converted to fatty acyl-CoA,
a reaction catalyzed by ACS. Fatty acyl-CoAs are acti-
vated ... manifestation of toxicity. It has to be noted
that TrC was not able to inhibit thapsigargin-induced
Ctrl
3 h
12 h
24 h 36 h
6 h
OA
OA
SA/OA
SA/OA
SA/OA
SA/OA
SA/OA
SA
OA
FL1-Log
Counts
OA
OA
SA
SA
SA
SA
Ctrl
Ctrl
Ctrl
Ctrl
Ctrl
SA ... reticulum
stress-mediated and mitochondrial-mediated apoptosis; (c) the activation of
stearate in the form of stearoyl-CoA was a necessary step for the lipotoxic
effect; (d) the capacity of cells to produce and accumulate...
- 12
- 721
- 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx
Ngày tải lên :
19/02/2014, 12:20
... 5¢-ATA
CCATGGACAAAACCCACAGTACAATG
P1OH 5¢-
CATATGCACAAAACCCACAGTAC
P2O 5¢-TAT
GGATCCTTAATTAGAAACAAACTGTCTGA
TAAAC
P2OH 5¢-
CTCGAGATTAGAAACAAACTGTCTGATAAACC
P1Z 5¢-ATA
CCATGGCTGGAGAAGACTTTAAGATC
P1ZH ... 5¢-
CATATGACTGGAGACTTTAAGATC
P2Z 5¢-TAT
GGATCCTCACCACCCAATTTCGGAAAG
P2ZH 5¢-
CTCGAGCCACCCAATTTCGGAAAGT
Table 2. Over-expression plasmids for Sno1p and Snz1p prepared in this
study. Symbols O, Z and ... dehydrogenase at 37 °C for 90 min.
After centrifugation (14 000 g) for 1 min, the absorbance of
the supernatant was read at 363 nm. The absorbance of
the reduced form of APAD (APADH) was linear over the
2–100...
- 8
- 649
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
Ngày tải lên :
20/02/2014, 01:20
... (–)IRES.
RNA synthesis obtained with the (–)IRES 104 RNA
was only 24% of that of the wild-type (–)IRES RNA,
a value similar to that of the (–)IRES 219 RNA. The
fact that the (–)IRES 104 can be used as a ... minus-strand
RNA that serves as a template for the synthesis of
new plus-strand RNA molecules. Initiation of RNA
synthesis at the 3¢-end of the plus- and minus-strand
RNA most probably involves interactions ... template by
the recombinant HCV NS5B differed from the data
obtained by Oh et al. [18]. These authors showed that
the 122 nt of the 3¢-end of the HCV minus-strand
RNA was unable to sustain RNA synthesis. ...
- 15
- 597
- 0
- we identified and characterized cytosine dna mtase genes that are activated with the onset of reproductive development in rice
- a diary of the dying
- a tour of the dart libraries
- chulalongkorn university in thailand this smalllab kit was created as a result of the research project entitled chemistry laboratory based on chemical safety and pollution minimization sponsored by thai research fund rdg 3072543 one of the outcomes of t
- periurban and urban consumers on the reasons for not consuming organic products the two main reasons advanced is that organic products are expensive according to 60 of the consumers in the transkei
- 625 of periurban consumers and 818 of urban consumers see table 1 the second reason advanced is that organic products are not readily available according to 60 of the consumers in the transkei
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2