the human nervous system — a clavichord on the use of metaphors in the history of modern neurology frank stahnisch
báo cáo hóa học: " Impact of gastroesophageal reflux disease on work absenteeism, presenteeism and productivity in daily life: a European observational study" doc
... has received speaker fees from AstraZeneca; JN is an employee of AstraZeneca Authors' contributions All authors were involved in data interpretation and manuscript preparation Data analysis was ... Spanish, placing a potential limitation on the accuracy of the data gathered from respondents from these countries One should also consider the limitations of retrospective and observational ... design and patients RANGE (AstraZeneca study code: D9612L00114) was a multinational, observational programme that was conducted as a series of parallel, locally managed studies at 134 primary care...
- 7
- 410
- 0
báo cáo hóa học:" Organization and exploration of heterogeneous personal data collected in daily life" pptx
... frequency of tags that are assigned to each item of personal data A tag that has been in heavy use during a period of time is a candidate for a landmark A tag that has rarely been used during a long ... one item of landmark information GPS histories gradually appeared while zooming in on an area on a map, and personal data related to the area were displayed A calendar view provides a familiar ... information This paper also describes methods of organizing and interacting with personal data Personal data are heterogeneous In other words, they contain a variety of media, formats, and granularities...
- 29
- 323
- 0
Báo cáo hóa học: "Organization and exploration of heterogeneous personal data collected in daily life" ppt
... frequency of tags that are assigned to each item of personal data A tag that has been in heavy use during a period of time is a candidate for a landmark A tag that has rarely been used during a long ... one item of landmark information GPS histories gradually appeared while zooming in on an area on a map, and personal data related to the area were displayed A calendar view provides a familiar ... information This paper also describes methods of organizing and interacting with personal data Personal data are heterogeneous In other words, they contain a variety of media, formats, and granularities...
- 29
- 373
- 0
How to Free Yourself of ANY Disease, Stop Fatigue, And Create Unstoppable Energy in Your Life.
... when the ACID and ALKALINE levels in your body are at a balance Notice how all the blood cells are far apart from each other, they are all round, plump and have regular circular shapes In a moment ... how almost everyone approaches their health these days! We’re all looking for the Germs, the VIRUSES, the “rats” which are the cause of disease and sickness The reality of it is, the only reason ... hordes What you may realize is that your acid / alkaline balance is really a reflection of your life and your inner world The life giving balance of acid and alkalinity in your body is determined...
- 20
- 541
- 1
![physics in daily life [coll. of newspaper columns from europhysics news] - j. hermans (edp, 2012) ww](https://media.store123doc.com/images/document/14/y/or/small_orn1399113492.jpg)
physics in daily life [coll. of newspaper columns from europhysics news] - j. hermans (edp, 2012) ww
... radiation, conduction and evaporation Under normal conditions, sitting behind our desk in our usual clothing in an of ce at 20 °C, radiation and conduction are the leading terms, while evaporation ... have to take the above factor 1000 in the ratio of the densities into account Conclusion: when estimating heat capacities, a litre of liquid or solid and a m3 of a gas at ambient temperature and ... skin somewhat larger, the radiation and conduction terms cannot change much They are determined by the difference between the temperature of our skin and clothing on the one hand, and the ambient...
- 113
- 240
- 0
teaching and learning communication skills in social work education
... use of observation in the process of shadowing social workers Within the module there is an active approach to observational learning using a range of teaching and learning strategies These include ... during a detailed consultation that took place as part of the development of The national occupational standards These statements can be found in the Statement of expectations from individual, families, ... involve users/carers in evaluating the communication skills of applicants as part of the admissions process Other key stakeholder participation in planning, delivery and evaluation See Integration...
- 84
- 638
- 0
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... http://genomebiology.com/2010/11/8/R86 are examples of metadata) - to repeat an analysis exactly When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step Galaxy’s metadata includes ... advancing computational research One theme concerns the reuse of computational outputs, and the other theme concerns meaningful connections between analyses and sharing Galaxy enables reuse of datasets, ... automatically tracked metadata and user metadata Page of 13 (Figure 1) within the analysis workspace, and hence users can see all reproducibility metadata for a history in a single location Users...
- 13
- 400
- 0
typical cultural features found in daily life of the community in the series little house on the prairie by laura ingalls wilder from the perspectives of language – culture
... Around their waists each of the Indians wore a leather thong, and the furry skin of a small animal down in front The fur was striped black and white, and now Laura knew what made that smell The ... quantitative methods were used in the form of listing linguistic features and the qualitative one was used in the form of analyzing the cultural features As an investigation into the cultural features ... self-reliant attitude and changes in attitudes towards the Native Americans Additionally, the author has further investigated into the language used to illustrate these features The conclusion that the...
- 52
- 357
- 0
Báo cáo khoa học: "The role of Bcl-xL and nuclear factor-kB in the effect of taxol on the viability of dendritic cells" ppsx
... K, Tasaki A, Yamanaka N, Nakashima H, Kuroki H, Nakamura K, Nakamura M, Katano M Paclitaxel probably enhances cytotoxicity of natural killer cells against breast carcinoma cells by increasing ... level of β-actin (internal control) The results suggest that taxol enhances DC viability via the increase of the anti-apoptotic protein Bcl-xL as a potential mechanism of action NF-κB signaling in ... Paclitaxel An update of its use in the treatment of metastatic breast cancer and ovarian and other gynaecological cancers Drugs Aging 1998, 12, 305334 23 Zhong H, Han B, Tourkova IL, Lokshin A, ...
- 5
- 335
- 0
The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock
... pathway IX List of Abbreviations List of Abbreviations 1400W N-(3-[Aminomethyl]benzyl)acetamidine AC Adenylyl cyclase AOA aminooxyacetic acid BCA β-cyano-L-alanine CaM Calmodulin cAMP Cyclic adenosine ... is the leading cause of death in non-coronary intensive care unit patients, and the 10th most common cause of death overall in the United States alone for 2003 Similarly, according to Singapore’s ... Summary diagram of the inflammatory mediators derived from phospholipids with an outline of their actions, and the site of action of NSAIDs (taken from BioCarta – Charting Pathways of Life Pathways...
- 222
- 297
- 0
Pompe disease in children and adults: natural course, disease severity and impact on daily life docx
... mutation in 12 Introduction exon among Caucasian patients,19,21 Asp645Glu in Chinese patients,22,23 and Arg854X among African and African American patients.24 Basically, the nature of the mutations ... and the national patient organizations affiliated with the International Pompe Association (IPA) In a subgroup of patients longitudinal data were obtained in a yearly follow-up Based on the results ... possibilities.125,126 Examples of such large clinical databases are the registries for rare disorders that are sponsored by pharmaceutical companies as a means to gather information on the disease and, in a later...
- 206
- 443
- 0
báo cáo hóa học:" Physicians'''' knowledge of health-related quality of life and perception of its importance in daily clinical practice" pot
... and quantitative information The majority said that QoL was interesting and important Users had seen more information and scales, and were more aware of their use; only 8% had ever used formal ... questionnaire on QoL are aware of its usefulness in clinical management More than 80% of participants would like to use QoL in their daily clinical practice but only one third of the physicians ... education in medicine and in management of health care services, and to combine technical health care services with a managerial approach Since 1997 a process of re-engineering is ongoing with the...
- 7
- 306
- 0
Báo cáo y học: " Efficacy, safety and pharmacokinetic of once-daily boosted saquinavir (1500/100 mg) together with 2 nucleos(t)ide reverse transcriptase inhibitors in real life: a multicentre prospective study" ppt
... Infecciosas, Hospital Universitario Infanta Cristina, Badajoz, Spain Authors’ contributions Conception, design, analysis, interpretation of the data, drafting of the article and obtaining of funding: LFLC ... Community of Andalusia, and conducted according to the principles contained in the Declaration of Helsinki All patients gave an informed consent The patients’ inclusion was censored in May 2007 to allow ... maintenance therapy [23,24] We are aware that the open-label characteristics of the study, the heterogeneity of the analyzed population and the lack of available genotypic resistance tests in...
- 9
- 326
- 0
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
... that teaching language is teaching culture Therefore, teaching culture has been integrated into language teaching programs and teaching materials in one way or another Many educators have applied ... factors in the teaching and learning of speaking skills in classrooms 1.3.1 What cultural factors influence on the teaching and the learning of speaking skills in classrooms? Culture and language ... exist in the same relationship as that in which, within language, meaning and expression develop together Today educators have become aware of the importance of cultural factors in the teaching of...
- 38
- 1,225
- 0
HOW TO IMPROVE LISTENING SKILLS IN TOEIC THE CASE OF questions and responses short conversations
... English capabilities This exam evaluates your ability to function in international business and real-world settings rather than in an academic setting Some students take the TOEIC because they want ... be asked to identify an activity, an emotion, a relationship, or the location of the speakers In some instances you may have to some minor calculations based on measurements in the dialogs Part ... types of paragraphs such as: letter, narration, data description, etc Language focus: is formed from two subparts: pronunciation, grammar and vocabulary Pronunciation: is to review the way of pronouncing...
- 63
- 970
- 2
Tài liệu Digital Material - Tracing New Media in Everyday Life and Technology (Amsterdam University Press - Media Matters) ppt
... would rather argue that this interest is a reaction to the myth of the immaterial, rather than pointing to an actual immaterialization of culture The material gatherings (Latour 2005; 1993) of new ... serious gaming when he engages in a critical discussion about educational games that are meant to incite learning through playing By approaching them as a ludic apparatus within the conceptual framework ... incorporated in materiality rather than floating as a metaphysical substance in virtual space We consider digital cultures as material practices of appropriation, and new media objects as material assemblages...
- 305
- 415
- 0
Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf
... activity) at saturating concentrations (100 mM ) To investigate autolytic inactivation in the absence of Ca21, CaCl2 was omitted from, and EDTA (at a 1.0-mM final concentration) was added to, the assay ... processes the cleavage was faster in the autolysis loop (at Tyr146/Asn147) than in the interdomain loop (at Phe114) The lack of temporary accumulation of fragment III during the degradation of the ... hydrogen bonds A nonhydrogen bonding interaction was considered as a van der Waals ˚ contact if the atomic distance was less than 4.0 A in uence the cleavage at Tyr146-Asn147 and, similarly, the Tyr146...
- 9
- 613
- 0
Employment and Skills in South African Exports pot
... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...
- 35
- 297
- 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx
... [37] In the case of NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting ... PMLA synthesizing activity Degradation of PMLA during the onset of spherulation is catalysed by enzymatically active forms of polymalatase in the extraplasmodial fluid [5,10,11] During plasmodia ... functions have been proposed, namely a PMLA hydrolysing variant in the exterior and a chaperoning adapter variant in the interior of plasmodia Cell type expression of spherulin 3b and polymalatase...
- 10
- 639
- 0
- disorders of the nervous system a primer
- disorders and diseases of the nervous system a list
- central nervous system cns b cerebrospinal fluid spaces of the brain
- legal opinion on sanparks use of the precau
- a hundred years apos worth of modern american poetry
- the nervous system a general principles and sensory physiology
- 5decision support system for endoprosthetic human tracheal preoperative planning based on robust design of experiments
- central nervous system atypical teratoid rhabdoid tumors role of insulin like growth factor i receptor
- neuroanatomy primer structure and function of the human nervous system
- a window on social reality qualitative methods in poverty research
- shirking perquisites and bad investments a note on agency cost of equity
- effects on thiazide use of the december 2002 publication of allhat apos s main results
- work in pairs ask and answer questions about the use of modern inventions
- how will a tax on cars affect their prices in the long run
- ``your money or your life apos apos the influence of injury and fine expectations on helmet use among motorcyclists in delhi
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25