stem cells from human adipose tissue a new tool for pharmacological studies and for clinical applications
Báo cáo khoa học: "In vitro neuronal and osteogenic differentiation of mesenchymal stem cells from human umbilical cord blood" ppt
... elbatnalpsnart fo ecruos a sa doolb droc lacilibmu namuH H akoareT ,T uzimusaY ,K esakaT ,C otaS ,S iirA ,K otomareT ,Y araH ,K otiaS-uzimihS ,M ebanataW ,R ieznihC ,Y akanaT ,S amunikaK 31 213-592 ,46 ... llew sa ,sesylana eht ,sesac lla nI )SAP( ffihcS-dica cidoirep dna )PA( esatahpsohp dica :srekram lacimehcotyc gniwollof eht rof dezylana erew slleC utis ni sCSM fo noitaziretcarahc dna sCSM ... ,0991 ASU icS dacA ltaN corP sllec lamorts devired-worram enob yb deraperp tnemnorivneorcim elbatius a rednu stsalcoetso otni gnitaitnereffid fo elbapac era segahporcam dna setyconom erutam :stsalcoetso...
- 6
- 410
- 0
Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx
... phenotypic analysis by FACS, we therefore isolated CD9+/CD90+/ CD166+ OC cells from five patients and analyzed the kinetics of cultivation and the potential for differentiation The data analysis after ... and adipogenic activity of mesenchymal stem cells from patients with advanced osteoarthritis Arthritis Rheum 2002, 46:704-713 Sandell LJ, Aigner T: Articular cartilage and changes in arthritis An ... nodules that stained positive for alkaline phosphatase R428 Arthritis Research & Therapy Vol No Fickert et al Figure Reanalysis of triple positive sorted cells (a) Forward and side scatter characteristics...
- 11
- 346
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and...
- 11
- 715
- 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc
... risks, as well as financial and social returns, are properly articulated and managed They will require tools, such as a credit scorecard, that reflect an intermediary’s methodical and careful ... instance, youth aging out of foster care can affect the criminal justice, health, housing, and welfare systems A data system that tabulates costs and savings across these agencies would facilitate ... vulnerable individuals, families, and communities A New Tool for Scaling Impact 11 Launching a Social Impact Bond requires a significant effort up front to identify and vet potential programs and...
- 36
- 262
- 0
Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt
... therefore assigned to time by default This process is repeated and nodes b and c are placed in times and Table shows the table at this point Now, d and f are candidates for time In general, the algorithm ... the graphical user interface but can be set in the command-line version of Jane Values of these parameters were systematically evaluated and the best values found are used as defaults Jane can import ... 13 Availability and Requirements Jane is implemented in Java with the Swing toolkit and runs on any machine with Java 1.5 or higher The source code and documentation are freely available from...
- 10
- 551
- 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
... (Ikaros System, Axiophot 2, Carl Zeiss) SH3 and SH4) The isolated cells from hFTs were also positive for HLA-class I (HLA-ABC) but negative for HLA-class II (HLA-DR), and negative as well for ... mesenchymal nature of human fallopian tube stem cells These important features imply that htMSCs represent a cell population that can be rapidly expanded for potential clinical applications The ... Célia Koiffmann and Cláudia I E de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Page of 10 (page number not for citation purposes) Journal of Translational...
- 10
- 456
- 0
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... gene GAPDH Sense: GGACTCATGACCACAGTCCATGCC Antisense: TCAGGGATGACCTTGCCCACA Bone-specific genes ALP Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC OC Sense: ATGAGAGCCCTCACACTCCTC ... ATGAGAGCCCTCACACTCCTC Antisense: GCCGTAGAAGCGCCGATAGGC Adipose- specific genes LPL Sense: GAGATTTCTCTGTATGGCACC Antisense: CTGCAAATGAGACACTTTCTC PPARγ Sense: TGAATGTGAAGCCCATTGAA Antisense: CTGCAGTAGCTGCACGTGTT Cartilage-specific ... Cartilage-specific genes AGN Sense: TGCGGGTCAACAGTGCCTATC Antisense: CACGATGCCTTTCACCACGAC COL 2A1 Sense: GGAAACTTTGCTGCCCAGATG Antisense: TCACCAGGTTCACCAGGATTGC AGN, aggrecan; ALP, alkaline phosphatase;...
- 12
- 359
- 0
Báo cáo y học: "Adipose-derived mesenchymal stem cells from the sand rat: transforming growth factor beta and 3D co-culture with human disc cells stimulate proteoglycan and collagen type I rich extracellular matrix" ppsx
... Arthritis Research & Therapy Vol 10 No Tapp et al Adipose- derived mesenchymal stem cells (AD-MSC) offer some advantages as an attractive, readily available adult stem cell because of the ease ... culture with human annulus fibrosis cells Materials and methods Source of fat tissue Animal studies were performed following approval by the Carolinas Medical Center Institutional Animal Care and Use ... of haematopoietic markers CD45, CD34 [23] These sand rat-derived AD-MSC are positive for the markers CD29 and CD105 and negative for the haematopoietic markers CD45 and CD34 The readily available...
- 10
- 446
- 0
Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration
... may assist in future strategies to treat cartilage-related diseases such as osteoarthritis CHAPTER 2 LITERATURE REVIEW 2.1 Articular cartilage and its associated clinical problems Articular cartilage ... to cartilaginous tissue formation, with good tissue growth and an absence of teratoma formation, after subcutaneous implantation for up to 24 weeks (Hwang et al., 200 8a) Thus far, several strategies ... cartilaginous tissue, with good tissue growth and an absence of teratoma formation The cartilaginous tissue formed also displayed high levels of collagen type I and II, as well as some collagen...
- 190
- 471
- 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... static flasks as before using ITIP maturation The floating cells were harvested and stained for DC maturation markers without fixation Immediately before FACS analysis µg/ml 7-ADD was added as ... GM-CSF and 1,000 U/ml IL-4 was added The cells were incubated for 4–5 days and matured for 20–24 h and analyzed for mature DC content and function as above Determination of mDC yield and phenotype ... the ITIP maturation cocktail and stained for CD11c, CD13, CD14, CD83 and CD86 and analyzed by flow cytometry In each case all the isolated floating cells were analyzed without gating and phenotype...
- 11
- 469
- 0
Characterization of human adipose tissue derived adult multipotent precursor cells
... for applications in regenerative medicine applications A sub-population of cells termed by Zuk et al (2002) as adipose derived stem cells (ADSC) adhered to tissue culture plastics and was able ... Medical grade polycaprolactone-tricalcium phosphate (mPCL-CaP) scaffold fabrication and characterization mPCL (Birmingham polymers) was mixed with CaP nanopowder (Rebone, Shanghai, China) at a ratio ... myocardial infarctions Therapeutic angiogenesis, potentially from ADSC, would have an extremely broad range of clinical applications, such as diabetic retinopathy peripheral vascular disease,...
- 195
- 653
- 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc
... control and irradiated samples were signicant for MCF-7 cells at all time intervals examined On the other hand, statistical signicance for HeLa samples was observed at days and after irradiation ... choline-related metabolites from PCA extracts of HeLa and MCF-7 cells for control and irradiated samples The standard deviation was 10% GPC HeLacells Controlsample Irradiated sample MCF-7 cells Control ... white; irradiated: black) and A (Lys + Ala) (controls: dotted white; irradiated: dotted black) as obtained from 1D and 2D COSY spectra of HeLa and MCF-7 cell samples Data are the mean SD values...
- 14
- 765
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for ... QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from murine ... lipofection and maintained for at least days after transfection as assessed by GFP expression (Fig 4E) These Fig Isolation and characterization of uterine BECs and LECs expressing tsA58T Ag (A) Scheme for...
- 11
- 873
- 0
Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx
... glutamate decarboxylase isoenzymes GAD (65kDa) and GAD (67kDa) from human brain with ginkgotoxin and its 5¢-phosphate J Med Chem 44, 3166–3174 Bu DF, Erlander MG, Hitz BC, Tillakaratne NJK, Kaufman ... PKH leads inter alia to a decreased availability of PLP for GAD, which catalyses the formation of c-aminobutyric acid, the most potent inhibitory neurotransmitter in the mammalian brain Decreased ... NJK, Kaufman DL, WagnerMcPherson CB, Evans GA & Tobin AJ (1992) Two human glutamate decarboxylases, 65- kDa and 67- kDa GAD, are each encoded by a single gene Proc Natl Acad Sci USA 89, 2115–2119...
- 10
- 530
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... by from Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative ... from human embryonic stem cells in vitro Lancet 364, 163–171 18 Anderson JS, Bandi S, Kaufman DS & Akkina R (2006) Derivation of normal macrophages from human embryonic stem (hES) cells for applications ... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway...
- 12
- 550
- 0
Stem Cells in Human Reproduction Basic Science and Therapeutic Potential Second Edition pot
... Embryonic Stem Cells and Wharton’s Jelly Stem Cells 136 Chui-Yee Fong, Kalamegam Gauthaman, and Ariff Bongso 14 Amniotic Fluid and Placenta Stem Cells 150 Anthony Atala 15 Adult Stem Cells in the Human ... Westphalian WilhelmsUniversity, Munster, Germany Ana Krtolica StemLifeLine, San Carlos, California, U.S .A Orly Lacham-Kaplan Victoria, Australia Monash Immunology and Stem Cell Laboratories, Monash ... U.K Advanced Cell Technology Inc., Santa Monica, California, U.S .A Nina J Kossack Institute for Stem Cell Biology and Regenerative Medicine, Stanford University, Palo Alto, California, U.S .A and...
- 273
- 510
- 0
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... substantial open reading frame The longest transcript (7 kb) harbors five polyadenylation sites (two AATAAA, and three AATTAAA), nine ATTTA sequences [23], two Alu-repeats and three CAGAC motifs ... (Clontech, Palo Alto, CA, USA) and hspry4 cDNA, was constructed with primers: 5¢-TTAGGATCCATGCT CAGCCCCCTCCCC-3¢ forward and 5¢-GGAATTC TCCGAAAGGCTTGTCGG-3¢reverse, creating BamHI and EcoRI restriction ... frame with a GAL4 DNA binding domain (BD), and used as bait in a yeast two-hybrid screen with a pAct2 human, fetal liver cDNA library Sequencing of DNA from transformed Saccharomyces cerevisiae...
- 11
- 542
- 0
báo cáo hóa học:" Stem cells from umbilical cord blood do have myogenic potential, with and without differentiation induction in vitro" pdf
... http://www.translational-medicine.com/content/7/1/6 Materials and methods Isolation and characterization of human CD34+ cells from the umbilical cord blood CD34+ stem cells from human umbilical cord ... Einstein, São Paulo, Brazil, especially Dr Andresa Ribeiro and Dr Eurípides Ferreira Marta Cánovas and Antonia Cerqueira, for technical assistance; L.V.B Anderson, who kindly provided specific antibodies ... Arahata K, Ishiura S, Ishiguro T, Tsukahara T, Suhara Y, Eguchi C, Ishihara T, Nonaka I, Ozawa E, Sugita H: Immunostaining of skeletal and cardiac muscle surface membrane with antibody against Duchenne...
- 9
- 551
- 0
Báo cáo hóa học: " Nutraceutical augmentation of circulating endothelial progenitor cells and hematopoietic stem cells in human subjects" potx
... cellular ATP was quantified by bio-luminescence The ratio of average values of ATP in growth factor stimulated and not stimulated cells was calculated and compared for different periods before and ... RH, JAK, JK, KWA, CAS, BM, ANP, MPM, LS, FR, and TEI provided detailed ideas and discussions, and/ or writing of the manuscript NAM and JAJ performed the experiments All authors read and approved ... Published: April 2010 21 References Kawamoto A, Katayama M, Handa N, et al: Intramuscular transplantation of G-CSF-mobilized CD34(+) cells in patients with critical limb ischemia: a phase I/IIa, multicenter,...
- 10
- 665
- 0
Báo cáo sinh học: " Phosphoproteomic analysis of apoptotic hematopoietic stem cells from hemoglobin E/b-thalassemia" pot
... Hepatocyte nuclear factor 3-alpha 4.021 LMNA _HUMAN MAP2 _HUMAN Lamin -A/ C Microtubule-associated protein 1.120 1.07 PRKDC _HUMAN DNA-dependent protein kinase catalytic subunit 3.423 RN 5A _HUMAN 2- 5A- dependent ... BIOTEC, NSTDA for MS data interpretation and Decyder program tutorial Dr Samart Pakakasama, Department of Pediatrics, Faculty of Medicine Ramathibodi Hospital Department of Pathobiology for other ... reduced compared to normal cells (Figure 1) Giemsa staining revealed that CD34+ cells from patients and donors had similar morphological characteristics to blast cells with a large nucleus and 2-3...
- 10
- 425
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008