s tonck a georges jm georges e loubet jl improvements in the indentation method with a surface force apparatus phil mag a 1996 74 5 1061 72

Bio nanoparticles and bio microfibers for improved gene transfer into glioma cells

Ngày tải lên : 12/09/2015, 09:10

... have emerged as this technology advances: gene identification, gene expression, and gene delivery The therapeutic gene is selected according to the target disease Originally, the therapeutic gene ... comprising plasmid DNA and a set of specially designed amphiphilic peptides of alternating Leucine, Alanine, and Arginine residues The positively charged Arginine peptide units can interface with ... to a large extent Highly active promoters are necessary to ensure the transgene expressions of recombinant BV vectors engineered to deliver genes of interest to mammalian cells and tissues Strong...

145
346
0

Báo cáo y học: "In vitro bactericidal activities of Japanese rice-fluid against Helicobacter pylori strains"

Ngày tải lên : 31/10/2012, 17:03

... counted after days of incubation at 37°C in a microaerophilic atmosphere The remaining bacterial species were also determined in almost the same manner as in the case of H pylori strains described ... atmosphere The most interesting findings are that the bactericidal spectrum of the ‘Japanese rice-fluid’ is rather narrow In fact, the bactericidal activities were expressed against only the restricted ... complex including α-amylase, β-amylase, and glucoamylase In the last phase 5, the enzymes added were inactivated by heating the mixture up to 95 C These Rice-fluids, however, have recently been adopted...

5
430
0

Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx

Ngày tải lên : 23/03/2014, 07:20

... decreased at monolayer collapse in response to elevated temperature Differences between the monolayer collapse parameters of the cationic lipids were not as apparent at 37 C; the derivatives possessed ... than unity) The TNS assay was used to ascertain the pKa values of the cationic lipids in assemblies where they were Table Acid dissociation constants of cationic lipids as determined by nonlinear ... anchors of the derivatives with respect to the number of carbon atoms and double bonds in the aliphatic chains These pKa values deviate from those obtained using vesicles where the derivatives...

15
318
0

Báo cáo Y học: In vitro gene therapy of mucopolysaccharidosis type I by lentiviral vectors pdf

Ngày tải lên : 24/03/2014, 04:21

... grown in the lower chambers After a 72- h incubation, cells were harvested and the enzyme activity was measured in the cell lysates The experiments were performed in the absence or in the presence ... were exposed to the indicated viral dose as described in Materials and methods and cells were collected at diﬀerent time points from infection; lysates were assayed for protein content and enzyme ... viral protein, in the absence or in the presence of lgÆmL)1 of polybrene (Table 1), as described in Materials and methods Transduced ﬁbroblasts, in triplicate plates, showed an increased enzymatic...

8
526
0

Báo cáo khoa học: The in vitro nuclear aggregates of polyamines pot

Ngày tải lên : 29/03/2014, 23:20

... buffer) As the freezing process progresses, a salt concentration gradient, as well as a temperature gradient (due to latent heat release), establishes across the freezing front This leads to the ... aggregates At room temperature, the process is time-dependent: a sample left for several hours on the bench becomes opalescent Low temperatures or freeze–thaw processes speed up the superaggregation ... supramolecular polymerization based on the assembly of polyamines and phosphates (the extractive NAPs) The initial step is the self-arrangement of polyamines in disk-like unimers by means of their terminal...

12
247
0

báo cáo hóa học:" The effect of abductor muscle and anterior-posterior hip contact load simulation on the in-vitro primary stability of a cementless hip stem" ppt

Ngày tải lên : 20/06/2014, 04:20

... have been raised that these forces may exceed the stem 's torsional fixation strength [32] However, these concerns were based on comparisons with in- vitro torsional strength assessments obtained ... contact force influence the translational and rotational stability of the implant The present study examined the effect of these two parameters in the in- vitro assessment of cementless hip implant ... there are seemingly conflicting results in the literature; another study reported that including muscle forces (abductor, tensor fascia latae, vastus lateralis, and vastus medialis) resulted in...

14
400
0

Báo cáo vật lý: "Evaluation of In Vitro Antioxidant Activity of 5H-dibenz[b,f]azepine and Its Analogues" ppt

Ngày tải lên : 07/08/2014, 14:20

... (e) and (f) All the other aromatic protons were observed at the expected regions in all the synthesised compounds The mass spectra of compounds showed the M+ peak, in agreement with their molecular ... radical process, therefore this study has been taken to explore better the chemistry and antioxidant properties of 5H-dibenz[b,f]azepine and its derivatives Six molecules (a f) were synthesised, and ... was possible to establish some structure-activity relationships based on the different substitutes and the positions.19 As their structures may justify a possible intervention in the free radical...

14
438
0

Báo cáo khoa học: "Effect of Reproductive Status on In Vitro Developmental Competence of Bovine Oocytes" docx

Ngày tải lên : 07/08/2014, 17:22

... Oocytes from the metestrus phase of the estrous cycle resulted in the highest (p

6
295
0

Báo cáo lâm nghiệp: "In vitro clonal propagation of Acacia mangium Willd. and its evaluation of genetic stability through RAPD marker" ppsx

Ngày tải lên : 08/08/2014, 01:21

... were taken and the experiment was repeated thrice The cultures were examined every weeks and the morphological changes were recorded on the basis of visual observations The effects of different ... ladder (M B I Fermentas Inc.) All the reactions were repeated at least thrice 2.6 Amplified DNA marker scoring Amplified DNA markers were scored as present or absent both in the regenerated and the ... treatment had 20 culture tubes and the experiment was repeated thrice The effects of different treatments were quantified as the mean number of multiple shoots/culture The data were statistically...

6
340
0

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Ngày tải lên : 09/08/2014, 14:22

... to the presence of β-glycerophosphate, similar increases in hypertrophy associated genes were seen in the present study where β-glycerophosphate was absent Our results are consistent with those ... to the expression levels of the housekeeping gene EF1α and relative expression levels compared with values from undifferentiated monolayer MSCs are shown using the relative expression software ... TTTCCCAGGTCAAGATGGTC Antisense: CTTCAGCACCTGTC CACCA 58 374 35 AGC Sense: TGAGGAGGGCTGGAACAAGTACC Antisense: GGAGGTGGTAATTGCAGGGAACA 54 392 30 COMP Sense: CAGGACGACTTTGATGCAGA Antisense: AAGCTGGAGCTGTCTGGTA...

15
830
0

Báo cáo y học: " In-vitro antiviral activity of Solanum nigrum against Hepatitis C Virus" pdf

Ngày tải lên : 11/08/2014, 21:21

... against HCV NS3 protease, Huh-7 cells were transfected with NS3 protease plasmid in the presence and absence of herbal extracts After 48 hrs incubation, cells were harvested, RNA was extracted ... Anti-inflammatory Leaves 14.1 Colocasia esculenta Araceae Kachalu, Arvi Anti-diarrhea, anorexia, antipyretic Leaves 21 .5 Momordica charantia Cucurbitaceae Karela, Antiviral dyspepsia, constipation, Leaves 5. 9 ... washed with 1× PBS Cells were transiently transfected with expression plasmids containing HCV NS3 protease in the presence and absence of SN 100 μg extract and interferon by using Lipofectamine™...

7
419
0

Báo cáo y học: "The triple combination of tenofovir, emtricitabine and efavirenz shows synergistic anti-HIV-1 activity in vitro: a mechanism of action study" pdf

Ngày tải lên : 12/08/2014, 23:21

... combination indices analysis where the open circles are data from five experiments and the solid line represents the CI line The red bar at the CI50 indicates the 95% confidence intervals The bar ... discrepancy between the results from the median-effect analysis and the MacSynergy II analysis led us to analyze the combination using three other methods: the isobologram analysis, the Berebaum ... the HIV-1 RT assay b The averages and standard deviations were calculated from the results of at least three independent measurements c Definition for degree of synergy is described in Methods...

16
377
0

Báo cáo y học: "In vitro nuclear interactome of the HIV-1 Tat protein" pps

Ngày tải lên : 12/08/2014, 23:21

... intense ions to determine charge state prior to MS/MS analysis Data analysis All MS/MS spectra were sequence database searched using TurboSEQUEST The MS/MS spectra were searched against the redundant ... from the resin by incubating the beads in 2× Leamni sample buffer at 95 C for Gel electrophoresis and Coomassie staining The eluate was resolved on a 10% SDS-PAGE and the resulting interaction ... annotation % Dataset: percentage of proteins in Tat interactome dataset possessing motif annotation % Nucleus: percentage of proteins in Nuclear Protein Database (NPD) possessing motif annotation...

18
543
0

Applying macromolecular crowding to promote the expansion and adipogenic differentiation of human mesenchymal stem cells in vitro; an effect of matrix reciprocity

Ngày tải lên : 11/09/2015, 09:16

... AL, Li SW 1998;Procollagen Nproteinase and procollagen C-proteinase Two unusual metalloproteinases that are essential for procollagen processing probably have important roles in development and ... Klees RF, Williams WA, et al 2007;Focal adhesion kinase signaling pathways regulate the osteogenic differentiation of human mesenchymal stem cells Exp Cell Res (1):22-37 101 Salasznyk RM, Klees ... Askari JA, Aota SI, et al 1997;Defining the topology of integrin alpha5beta1-fibronectin interactions using inhibitory anti-alpha5 and anti-beta1 monoclonal antibodies Evidence that the synergy...

9
423
0

báo cáo hóa học: " Beyond platinum: synthesis, characterization, and in vitro toxicity of Cu(II)-releasing polymer nanoparticles for potential use as a drug delivery vector" ppt

Ngày tải lên : 21/06/2014, 02:20

... disease states including cancer, cardiovascular disease, arthritis, diabetes, Alzheimer s disease, and Parkinson s disease [27] Cancer cells use ROS to suppress apoptosis, accelerate proliferation, ... Here, the differences in rates can be attributed to differences in concentrations of the various species present in the buffer as the pH is lowered (see Discussion) Figure 3B shows that Cu release ... thickness to prevent interference from the glass slide during EDX analysis Samples were then coated with Au (2 -5 nm thickness) using a Cressington 108 Manual Sputter Coater (Ted Pella, Redding, CA,...

10
495
0

báo cáo hóa học:" The Photodynamic Effect of Different Size ZnO Nanoparticles on Cancer Cell Proliferation In Vitro" docx

Ngày tải lên : 21/06/2014, 18:20

... 10-7mol/L The correlative controls were also seeded in the same plate simultaneously Once the cells were added to the sensor wells, the sensor devices were placed into the incubator, and the real-time ... the changes in electrode impedance induced by the interaction between testing cells and electrodes, where the presence of the cells will lead to an increase in the electrode impedance The more ... formaldehyde for Finally, specimens were observed by inverted ﬂuorescence microscopy (Olympus IX71, Japan) Statistics Data were expressed as the mean ± SD (standard deviation) from at least three independent...

9
316
0

Báo cáo hóa học: " In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics" doc

Ngày tải lên : 22/06/2014, 06:20

... streptomycin and 50 lg/ml for kanamycin The data is the average of three experiments ± SD Percentage change in each case is calculated and mentioned above Table Represents minimal inhibitory concentrations ... successful antibiotic therapy, the dose should be reduced to avoid their side effects at the same time the stability should be increased to make them more economic With the advancement of nanotechnology, ... above the adsorption of the antibiotic molecules on the nanoparticle surfaces The average particles size after conjugation were shown to decrease (Fig 2a) This was possibly again due to the combined...

9
332
0

Báo cáo hóa học: " In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics" pdf

Ngày tải lên : 22/06/2014, 19:20

... streptomycin and 50 lg/ml for kanamycin The data is the average of three experiments ± SD Percentage change in each case is calculated and mentioned above Table Represents minimal inhibitory concentrations ... successful antibiotic therapy, the dose should be reduced to avoid their side effects at the same time the stability should be increased to make them more economic With the advancement of nanotechnology, ... above the adsorption of the antibiotic molecules on the nanoparticle surfaces The average particles size after conjugation were shown to decrease (Fig 2a) This was possibly again due to the combined...

9
285
0

báo cáo khoa học: "Cationic nanoparticles for delivery of amphotericin B: preparation, characterization and activity in vitro" potx

Ngày tải lên : 11/08/2014, 00:22

... albicans Cationic microbicides self-assemble in a single supramolecular structure The first attack against the fungus comes from an outer cationic polyelectrolyte layer Thereafter the inert carboxymethylcellulose ... represents a very effective cocktail against multidrug resistance Complete loss of fungus viability could not be achieved before at the same separate doses of each component Results and Discussion ... and then wrapped by the polyelectrolytes over the quoted range of concentrations Sizes and zeta-potentials were determined by means of a ZetaPlus Zeta-Potential Analyser (Brookhaven Instruments...

13
774
0

In vitro and in vivo evaluation of transferrin conjugated lipid shell and polymer core nanoparticles for targeted delivery of docetaxel

Ngày tải lên : 09/10/2015, 11:18

... by the linking of antibodies or fragments to therapeutic molecules C Targeted nanocarriers are nanocarriers presenting targeted ligands at the surface of the nanocarrier The ligands are either ... adjuvant in therapy for the early, high-risk breast cancer (Martin et al., 2003) 11 Adverse side effects Docetaxel is a chemotherapeutic agent and it can damage mechanisms that are essential to cell ... deliver the drug to the intended areas are the challenging factors of targeting Tumor targeting can be classified into ―passive targeting‖ and ―active targeting‖ Active targeting cannot be separated...

129
286
0