0

role of quality control and quality assurance departments in a pharmaceutical industry

Báo cáo khoa học:

Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

Báo cáo khoa học

... interpretation. In effect, the hand-coded rulesact as a kind of backing-off mechanism, alleviat-ing the problem of data sparseness.Looking ahead, we are currently investigatingseveral interesting ... versionconsequently assigned an incorrect interpretation. In the combined version, a hand-coded pattern for305Transparent combination of rule-based and data-driven approaches in a speech understanding architectureManny ... 25.6%22.2%Table 1: Percentage semantic interpretation errorson in- domain test data for different amounts of training data and different versions of the system.Training and test data both in speech...
  • 8
  • 461
  • 0
Chapter 24 Congestion Control and Quality of Service pdf

Chapter 24 Congestion Control and Quality of Service pdf

Quản trị mạng

... is an internetworking issue that has been discussed more than defined. We can that has been discussed more than defined. We can informally define quality of service as something a informally ... Weighted fair queuing24.15Figure 24.9 Congestion avoidance, additive increase24.2324-5 QUALITY OF SERVICE24-5 QUALITY OF SERVICE Quality of service (QoS) is an internetworking issue Quality of ... environment for the traffic. So, before talking about congestion control and quality of before talking about congestion control and quality of service, we discuss the data traffic itself.service,...
  • 48
  • 590
  • 0
báo cáo hóa học:

báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx

Hóa học - Dầu khí

... impact of urinary incontinence on self-efficacy and quality of life. Health and Quality of Life Outcomes 2003, 1:35.22. Parkkinen A, Karjalainen E, Vartiainen M, Penttinen J: Physiotherapyfor ... scales and the FACT-Gscales are concordant since decreased social withdrawal and avoidance, reduced psychosocial impact and lessembarrassment are accompanied by better emotional and functional ... were, that they had to plan every detail in advancebecause of their UI and that they were afraid of physicalactivities, because of the association between involuntaryloss of urine and physical...
  • 11
  • 456
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc

Hóa học - Dầu khí

... digits, and a bluetooth interface to allow real-time streaming of data to a PC for data logging. It has scored highly in terms of p atient satisfaction [ 23] and is an open-loophand, making it an ... discriminated well in all feedback conditions, including in the absence of any feedback.Saunders and Vijayakumar Journal of NeuroEngineering and Rehabilitation 2011, 8:60http://www.jneuroengrehab.com/content/8/1/60Page ... intospatial uncertainty. If we can minimise uncertainty in task-specific domains we may increase control reliability and considerably improve hand functionality.This study raises a number of interesting...
  • 12
  • 503
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Báo cáo khoa học

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ⁄ W168F ⁄ Y74W TCACCGGTCCATGATCCATT ... mutationsMousumi Banerjee1, Hemalatha Balaram2 and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram...
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

Báo cáo khoa học

... ideal bond angles (°) 1.8% of cases in the most favoredregions of Ramachandran plot92.4% of cases in disallowed regions of Ramachandran plot0average B for main chain atoms (A ˚2) 30.1average ... he fl aps than C a of SE and RE inhibitors(about 0.5 A ˚ in both cases). Although phenyl rings of OE and RE have very similar positions and orientation and have similar contact patterns (26 and ... orresponding ato ms o f chain A and chain B (averaged f or each re sidue) after the least-squaresTable 3. S ummary of all contacts and hydrogen b onds for inhibitor OEcomplexedinthenativeHIV-1protease.Three...
  • 11
  • 615
  • 0
Tài liệu Thermal Processing of Foods : Control and Automation ppt

Tài liệu Thermal Processing of Foods : Control and Automation ppt

Điện - Điện tử

... Huang, and Witoon Prinyawiwatkul)rAdvances in Dairy Ingredients (Geoffrey W. Smithers and Mary Ann Augustin)rBioactive Proteins and Peptides as Functional Foods and Nutraceuticals (Yoshinori ... replace electrical relay panels performing ma-chine sequencing. Capabilities have increased substantially to in- clude analog control as well as other features.Proportional and integral (PI) controller: ... utilizing smalldiameter temperature probes.Maintaining high flow rates of heat transfer media in systems, asshown in the cooling loop in Figure 2.3, is important in order tomaintain the heat transfer...
  • 220
  • 416
  • 1
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

Báo cáo khoa học

... lg of DNA per 100 mm dish and 2 lg of DNA per 30 mm dish. The ratio of DNA codingdonor to DNA coding acceptor was 1 : 1 or 1 : 2.Membrane preparation and radioligandbinding assayFor binding ... [51,52].ResultsRadioligand binding assayAs shown in Table 1, the binding parameters obtainedfor dopamine D1receptor and its mutant indicate thatthe Kdvalues for these two receptors were similar;however, ... density of the D1MUT (404AA405) wasTable 1. Binding parameters for the dopamine receptors. For dopa-mine D2receptor binding, the statistical significance was evaluatedusing a one-way ANOVA,...
  • 16
  • 567
  • 0
Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx

Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx

Báo cáo khoa học

... site and plays a critical role in substrate binding [41]. Substrate or sub-strate analogues may anchor this loop upon binding,making a substantial conformational change comparedto the apo structure.Table ... B, Sawka-Dobrowolska W, GancarzR, Kucharska-Zon˜M, Latajka R, Amrhein N, MiziakP & Szczepanik W (2004) Experimental and ab initiocalculated structures of 2-aminoindane-2-phosphonicacid, ... torulo-ides) or far from the active site (for Petroselinum crispum). In bacterialHAL (500 amino acids) and plant and fungal PALs (710 amino acids), a core PAL ⁄ HAL domain (480 amino acids) with...
  • 16
  • 502
  • 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học

... 275,1930–1936.30 Sano T, Ohyama K, Yamano Y, Nakagomi Y,Nakazawa S, Kikyo M, Shirai H, Blank JS, Exton JH& Inagami T. (1997) A domain for G protein coupling in carboxyl-terminal tail of rat angiotensin ... determined with the Micro BCA Protein assayreagent from Pierce (Rockford, IL, USA) using bovineserum albumin as standard.Data analysisAll data analysis was performed using graphpad prism forMacintosh, ... become activated by the kinins, small pro- in ammatory peptides with great vasoactive potentialimplicated as mediators of in ammation, pain and hyperalgesia [12,13]. The nonapeptide BK and Lys-BK(kallidin)...
  • 12
  • 595
  • 0

Xem thêm