richards model a simple procedure for real time prediction of outbreak severity
Báo cáo hóa học: " Research Article A Novel Face Segmentation Algorithm from a Video Sequence for Real-Time Face Recognition" potx
... Gaussian [2] A large data base of labelled skin pixels of several people both male and female has been used to build the Gaussian model The mean and the covariance of the database characterize ... person and the ratio HF /WE vary in the range 1.1–1.3 Several face images, about 450, were manually cropped from images captured in our lab and an average of all these face images forms an average ... in Figure 11 For real- time requirement, the mean and the variance of the average face template are computed ahead of time and used as constants for the computation of the correlation coefficient...
- 6
- 280
- 0
Báo cáo hóa học: " A Visual Environment for Real-Time Image Processing in Hardware (VERTIPH)" pdf
... These languages all follow a form of the dataflow paraldigm where streams of data flow through a network of nodes, each of which performs a computation on the tokens within the stream before passing ... in the Electrical and Computer Engineering Department, University of California, Santa Barbara In 1989, he returned to New Zealand as a Director of the Image Analysis Unit at Massey University ... VERTIPH’s features including data types and operators as several blocks that operate sequentially on the image data Khoros and OpShop are other systems that act at a similar level The use of component...
- 8
- 427
- 0
Near infrared confocal raman spectroscopy for real time diagnosis of cervical precancer
... NEAR-INFRARED CONFOCAL RAMAN SPECTROSCOPY FOR REAL- TIME DIAGNOSIS OF CERVICAL PRECANCER SHIYAMALA DURAIPANDIAN 2014 NEAR-INFRARED CONFOCAL RAMAN SPECTROSCOPY FOR REAL- TIME DIAGNOSIS OF CERVICAL ... transformed to malignant.9 In cervix, about 80% of cervical cancers are of squamous cell carcinoma and adenocarcinoma accounts for majority of the remainders.10 Precancerous changes in the squamous ... discriminant analysis.24 Lyng et al also obtained Raman spectra from formalinfixed paraffin preserved histological samples of normal, CIN and invasive cervical carcinoma tissue from 40 patients as well as...
- 193
- 267
- 0
Báo cáo hóa học: " Research Article A Simple Method for Guaranteeing ECG Quality in Real-Time Wavelet Lossy Coding" potx
... the database was originally created as standard test material for evaluation of arrhythmia detectors, this database is by far the most used database to test and compare ECG compression algorithms ... repeated for every record in the database The mean value provided in the tables is the average of the mean value of each signal and the SD value is the average value of the sd for each signal (average ... obtained for all the databases guaranteeing both WWPRDh and WWPRDw are very accurate in mean value with respect to the target and present a very low standard deviation This fact demonstrates that...
- 9
- 252
- 0
Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx
... informational structure of the dictionary Similarly, choice of font can be varied for reasons of appearance and occasionally information normally associated with one field of an entry is shifted into another ... a n g u a g e application such as a database query system Given a hand-coded hierarchical organization of the r e l e v a n t (central) senses of the definition vocabulary together with a classification ... information for natural language processing systems In particular, we intend to investigate the automatic generation of phrasal analysis rules from the information on idiomatic word usage (launch) (a large...
- 8
- 393
- 0
Báo cáo khoa học: "A System for Real-time Twitter Sentiment Analysis of 2012 U.S" pdf
... automated real- time sentiment analysis of this user-generated data can provide fast indications of changes in opinion, showing for example how an audience reacts to particular candidate’s statements ... crowdsourcing approach to sentiment annotation on in-domain political data To create a baseline sentiment model, we used Amazon Mechanical Turk (AMT) to get as varied a population of annotators as possible ... watching a campaign event and can be displayed on a tablet or smart phone The feedback from users allows annotation of recent data as well as the ability to correct misclassifications As a future...
- 6
- 534
- 0
Báo cáo hóa học: " Research Article A Speed-Adaptive Media Encryption Scheme for Real-Time Recording and Playback System" pot
... record/play data Media channel Ctrl data Media data Database Figure 2: Architecture and control process of AdmireRPS EF For extension Time stamp Header Block length Payload Data: encrypted RTP packet ... Speed-Adaptive Media-Data Encryption (SAME) Statistical characteristics of compressed audio/video data are dramatically different from the ones of text data, because the variable-length codes and ... level Based on this statistical characteristic of media data, we extend the idea of VEA algorithm to a new method that uses traditional block cipher to encrypt a part of data (part I), and uses...
- 9
- 354
- 0
Báo cáo hóa học: "Speech Silicon: An FPGA Architecture for Real-Time Hidden Markov-Model-Based Speech Recognition" docx
... 6: Data-flow graph for Gaussian distance pipe and wait for the presence of a new data Internal to the pipe, each stage passes a valid bit to the successive stage that serves as a local stall, ... word task was 1.8 times slower than real time on a 1.7 GHz AMD Athalon processor [14] Additionally, the models for such a task are times larger than the models used for the 1000-word command and ... Word modeler To app Dead FIFO Valid FIFO Figure 3: Block diagram of the speech silicon hardware-based ASR system [Feedback filter] Feedback Word model data Gaussian model data HMM model data Phones...
- 19
- 306
- 0
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot
... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at ... 1st International Standard for HBV-DNA The calibration of the in-house assay was done against the WHO st International Standard for HBV-DNA (OptiQuant® HBV-DNA Quantification Panel, Accrometrix ... sensitivity of the assay was improved mainly because of a larger volume of HBV-DNA used in ultra sensitive RTQ-PCR, extracted also from a larger volume of serum/plasma Additionally, the new assay was carried...
- 6
- 536
- 1
báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx
... TTGCCCAGTCAGGACCAAAT 62/1.90 CAACATCCTTTACCCATTGACAGA/ GCATTTGATCCACTTGCAGATAAG GGATAACTTCCCTGCCTCAATGA/ TTCTTGTAGCAGCTGAGAGGATCA CATGCGAGTGTCCCTCAATCT/ TCTCTTGCGTTTCTGGCTTAGA CAGCCAGATCTTCACGAGCTT/ ... GTTCTCGCGCATTGACCATA TGAACCACTTGATCTCTGCGACTA/ CAGCTTGCGGAGGTCTGAGT GAGGGTCGTCAGGATTTGGA/ GCCCTGCACTTACCATCTTTAAG CATAACATTTGCGGCAGATCA/ TGGTGGTATTATTGAGCCATCCTT CGCCTGTCAATCTTGGTCAGTAT/ AATGGCTATGCCCCTGTTCTG ... CTTGCATCCCTCAGCACCTT/ TCCTGTGGACAATGGATGGA 82/2.00 GGTTCCCATGTTTACAGCATCTG/ GCACCCACTCAACGGTATTGTAC TCCGCCAAGGACTATCATGAC/ CGCAATCAGAGCCCTGTAGAA GGAGCCTGAGCCTACCTTCTC/ GTGTTCGGCCAGGTGGTAGA GAACTGGGTGCTTGATAGGC/...
- 11
- 376
- 0
A distributed, cooperative multi agent system for real time traffic signal control
... to teams or stay alone (such as agents I5 and I6), these teams are variable and agents can switch teams as in seen in situations A and B 38 After a certain amount of time, each agent evaluates ... states of the agent 76 Table III: Maximal and end values for the short typical scenario 88 Maximal and end values for the long typical scenario 92 Maximal and end values for the short typical ... it - Autonomy: agents must have a certain degree of autonomy in the execution of their task - Performance of a specific task: Although agents are autonomous, they are created to act and achieve...
- 123
- 251
- 0
A full custom digital signal processing unit for real time cortical blood flow monitoring
... the spatial information of the raw speckle images [17] A few other variants have also been identified and compared in [1] as sLASCA (spatially derived contrast using temporal frame averaging), ... existing algorithm for hardware realization is derived Existing CMOS sensors‟ architectures are then compared for suitability Advantages and disadvantages of possible design are also discussed and ... biggest advantage of a hardware implemented algorithm is the possibility of implementing parallel processing as compared to a sequentially process programming language An observation on LASCA algorithm...
- 118
- 473
- 0
Báo cáo khoa học: Observation of a chaotic multioscillatory metabolic attractor by real-time monitoring of a yeast continuous culture doc
... forced to treat each variable as a separate time series due to the lack of suitable methods for analyzing the dynamical properties of multidimensional data sets We would encourage our mathematical ... contrast, it does disappear for a time after such disturbances, indicating that it is not a simple electrical or mechanical artifact Moreover, although we emphasize the data from the MIMS measurements ... Mutual information I as a function of the dephasing k A B Fig Relative m ⁄ z ¼ 34 signal (H2S) versus time Insets each show h of data starting, respectively, at (A) 712 h a period of high H2S and...
- 8
- 242
- 0
Báo cáo khoa học: Emerging tools for real-time label-free detection of interactions on functional protein microarrays ppt
... Ramachandran et al suggests a large false negative rate, and a potentially large false positive rate for these methods Thus, although these methods are well established, yield valuable data and ... to denature is significantly reduced, and the use of a mammalian transcription ⁄ translation system encourages natural protein folding for mammalian proteins Early applications of this approach ... [103] et al claim that nanowire sensors have advantages over conventional SPR in the areas of sensitivity, smaller quantity of protein needed for analysis, and the potential for very large arrays...
- 14
- 551
- 0
báo cáo hóa học: " Analysis of TDMA scheduling by means of Egyptian Fractions for real-time WSNs" doc
... is a lot higher than the maximum latency of the rest of the rates The reason for this characteristic, that we already noticed by means of the gradual arrival of the data, is rather trivial At ... gradual arrival of the data The number of fractions that form the approximation plays again a factor in the determination of the maximum latency, the less fractions, the lower the latency We can also ... efficient use of the available bandwidth, the fractional part is approximated by means of an Egyptian Fraction, where the unit fractions have a denominator equal to a power of two The last fraction...
- 20
- 355
- 0
Báo cáo hóa học: " Research Article Adaptive Linear Prediction Filtering in DWT Domain for Real-Time Musical Onset Detection" potx
... one and still acceptable performances for the second As final outcome of the scalable algorithm here developed, a performing implementation has been also carried out on real- time embedded target ... allowing for real- time performances For many applications, the real- time constraint may be the temporal masking phenomenon, which lasts approximately EURASIP Journal on Advances in Signal Processing ... performances The proposed algorithm is an improved version (and even more flexible in terms of real- time implementation) of an approach already appeared in the literature [8, 9], based on the evaluation...
- 10
- 414
- 0
Báo cáo hóa học: " Research Article Two-Dimensional Beam Tracing from Visibility Diagrams for Real-Time Acoustic Rendering" doc
... 1974 [16] A Canclini, A Galbiati, A Calatroni, F Antonacci, A Sarti, and S Tubaro, “Rendering of an acoustic beam through an array of loud-speakers,” in Proceedings of the 12th International Conference ... proves particularly useful every time there is a need for an accurate and fast simulation of acoustic propagation in environments of variable geometry and variable physical characteristics Acknowledgment ... validity of our solution, we performed a series of simulation experiments as well as a measurement campaign in a real environment An initial set of simulations was performed with the goal of assessing...
- 18
- 274
- 0
Báo cáo hóa học: " Research Article A Simple Scheme for Constructing Fault-Tolerant Passwords from Biometric Data" doc
... assume that At,1 and At,2 are independent random variables that contain information about the number of repeats of the tth motif in the maternal and the paternal allele We also assume that (At,1 ... looks as an artificial transformation, and a more natural password” would be specified as the arithmetic average of integers that form the block However, the arithmetic average is a float, and we also ... consisting of pairs of outcomes of the DNA measurements Our example also indicates the point that the mapping of the available data to a binary string with the further computation of the weight of the...
- 11
- 334
- 0
Báo cáo hóa học: "Research Article Dynamic Subcarrier Allocation for Real-Time Traffic over Multiuser OFDM Systems" ppt
... types of realtime traffics are supported, a variable length is acceptable in our algorithm In our simulations, we vary the user arrival rates λ from 0.01 to 0.1 and compare the delay and dropping rate ... BSs are in charge of subcarrier scheduling and resource allocation We assume a fixed modulation for all subcarriers The total transmission power is constrained at P and will be optimally allocated ... times The average delay is the mean of the delay of all packets not dropped For each successfully delivered packet, the delay is calculated as the difference between the departure and arrival times...
- 9
- 329
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25