0

oct a new imaging tool during carotid artery stenting

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học

... Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAATGCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site ... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAATGCGGCCGCTCAGTCCTGCTCCTCGGCCAC-3¢, ... 165-bp fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGCTACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢...
  • 11
  • 668
  • 0
Báo cáo y học:

Báo cáo y học: "Simplified Acute Physiology Score III: a project for a new multidimensional tool for evaluating intensive care unit performance" ppsx

Báo cáo khoa học

... the SAPS III study One of the advantages of its management as an outcome is that treatments can be selected that offer a substantial improvement in the quality of life of patients for the same ... hospitals should allow the data for many of these instruments to be collected automatically as part of routine care This implies a competitive advantage that SAPS III will incorporate in its design ... Scores (SAPS II) based on a European/North American Multicenter Study JAMA 1993, 170:2957-2963 Randolph A, Guyatt G, Carlet J: Understanding articles comparing outcomes among intensive care units...
  • 2
  • 217
  • 0
Báo cáo y học:

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Y học thưởng thức

... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the...
  • 11
  • 715
  • 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

Ngân hàng - Tín dụng

... Collaboration with relevant government agencies will also be necessary to gain access to administrative data, such as Medicaid records Administrative data will allow evaluators to assess program ... risks, as well as financial and social returns, are properly articulated and managed They will require tools, such as a credit scorecard, that reflect an intermediary’s methodical and careful ... (such as smoking cessation) are achieved Foundations could act as payor via performance-based grants on projects that have large societal value, but that produce outcomes that are hard to measure...
  • 36
  • 262
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx

Báo cáo khoa học

... evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator for the syntactic task ... because a statistical paraphrase table, an analogical solver and a paraphrase memory for instance; there is no constraint on the scoring function because it only scores final states Note that ... state-of-the-art to generate paraphrases Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Annual Meeting of ACL, pages 597–604, Morristown, NJ, USA Association...
  • 4
  • 338
  • 0
báo cáo hóa học:

báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx

Hóa học - Dầu khí

... Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002 Stanney KM: Handbook of Virtual Environments: Design, Implementation, and Applications New Jersey: ... Erlbaum Assoc; 2002 Arthur K, Booth KS, Ware C: Evaluating human performance for Fishtank Virtual Reality ACM Transactions on Information Systems 1993, 11:239-265 Cruz-Neira C, Sandin DJ, DeFanti ... Rizzo AA, Kim G: A SWOT analysis of the field of virtual rehabilitation and therapy Presence: Teleoperators and Virtual Environments in press Rizzo AA, Schultheis MT, Kerns K, Mateer C: Analysis...
  • 2
  • 360
  • 0
Báo cáo toán học:

Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt

Toán học

... glutathione-S-transferase and catalase activity, lipid peroxidation), gene expression analyses (quantitative real-time RT-PCR), determination of cytochrome P450 1A1 (CYP 1A1 ) protein content, chemical analysis ... kg−1) A total amount of about 700 kg artificial sediment was prepared for the experiments in the annular flume and half of the sediment was spiked with the abovedescribed PAHs This approach was ... White S, Whitehead P, Winn P, den Besten P, Della Sala S, Eisma M, Hauge A, Keller M, Slob A: Sediment management: an essential element of river basin management plans Journal of Soils and Sediments...
  • 5
  • 435
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps

Báo cáo khoa học

... characterised by a subatlantic climate with an annual precipitation of 700 mm and a mean annual temperature of 14.5 °C The soil is a poor sandy pleistocene podsolic cambisol (FAO) The plots have ... same stands are surveyed These kind of disadvantages caused by using categorical variables can be avoided by the use of features on interval scales These interval scale variables must be created ... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison...
  • 8
  • 315
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

Báo cáo khoa học

... for AAA can be found in Fogliata et al [6] In summary, the AAA configuration phase consisted in the optimisation of parameters and calculation kernels against the measured beam data The optimisation ... contribution AF and LC coordinated the study Data acquisition and data analysis were done by AC, EV, GN, AF The manuscript was prepared by LC and GN All authors read and approved the final manuscript ... Data are expressed as Gamma Agreement Clinical pre-treatment RapidArc QA GAI [%] constancy on a pre-treatment QA case (1 year data with a periodicity of weeks) Unique TABLE2 Summary of the stability...
  • 29
  • 344
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx

Báo cáo khoa học

... the tested cancers Participation was voluntary Demographic data was collected for students and residents Anonymity was guaranteed for certified board specialists The project was approved by the ... on each question are added to obtain a total score for the test With SCTs, a theoretical score of 100 would mean that the person had answered each item in the same way that the majority of panel ... non-parametric alternatives were used To evaluate the capacity to significantly discriminate the scores of the three groups, the non-parametric KruskallWallis test was applied The non-parametric...
  • 6
  • 392
  • 0
Báo cáo y học:

Báo cáo y học: " Comparison of brachial and carotid artery ultrasound for assessing extent of subclinical atherosclerosis in HIV: a prospective cohort study" pot

Báo cáo khoa học

... Hirai JI, Aoyama T, Inazu A and Mabuchi H: Carotid artery intima-media thickness and brachial artery flow-mediated vasodilation in asymptomatic japanese male subjects amongst apolipoprotein E phenotypes ... mean(standard deviation) Table 1: Baseline characteristics for extent data (n = 257) Table 4: Baseline characteristics of excluded cases (n = 89) Variable Variable Estimate Male* Age (years)# Carotid ... Average diameter of brachial artery (before and after dilation) was obtained from nine sequential images taken at rest and 12 taken during peak artery dilation Percent flow mediated dilation was expressed...
  • 10
  • 542
  • 0
Báo cáo y học:

Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt

Báo cáo khoa học

... calcaneus and first metatarsal head The distance between the floor and the line in standing position between the markers on calcaneus and first metatarsal were added afterwards ND was calculated ... Scatterplot showing the variation of navicular drop among female participants Scatterplot showing the variation of navicular drop among female participants Acknowledgements Foot and Ankle Research ... took part in data acquisition, made the statistical analysis and interpretation of data, and helped drafting the manuscript OS and HL took part in revising the manuscript critically for important...
  • 7
  • 461
  • 0
Báo cáo y học:

Báo cáo y học: "A 64-year old man presenting with carotid artery occlusion and corticobasal syndrome: a case report" pps

Báo cáo khoa học

... our case is remarkable for the fact that it is associated with marked frontoparietal atrophy on brain imaging, therefore also mimicking the characteristic MRI appearance It is likely that multiple ... this article as: Engelen et al.: A 64-year old man presenting with carotid artery occlusion and corticobasal syndrome: a case report Journal of Medical Case Reports 2011 5:357 • No space constraints ... vascular lesions in the left hemisphere and notable atrophy of mainly the left parietal and frontal cortex (Figure 1) We started prophylactic treatment with aspirin, dipyridamole and simvastatin...
  • 3
  • 277
  • 0
báo cáo khoa học:

báo cáo khoa học: "A new predisposing factor for trigemino-cardiac reflex during subdural empyema drainage: a case report" pot

Báo cáo khoa học

... to the associated inflammation intubated, the lungs were mechanically ventilated (S/5 Aespire Config; Datex-Ohmeda Ins., Madison, WI, USA) with a mixture of air and O2 Anesthesia was maintained ... Blanc VF, Hardy JF, Milot J, Jacob JL: The oculocardiac reflex: a graphic and statistical analysis in infants and children Can Anaesthet Soc J 1983, 30:360-369 Schaller B, Cornelius JF, Prabhakar ... this article as: Spiriev et al.: A new predisposing factor for trigemino-cardiac reflex during subdural empyema drainage: a case report Journal of Medical Case Reports 2010 4:391 Author details...
  • 4
  • 198
  • 0
báo cáo khoa học:

báo cáo khoa học: "Successful interdisciplinary management of the misdeployment of two self-expanding stents into the internal carotid artery: a case report" pps

Báo cáo khoa học

... centers, CEA and CAS are considered equally safe and efficient methods for the treatment of proximal carotid artery stenoses However, carotid artery angiography and stenting requires proper training ... the potential collateral supply during subsequent stentectomy and CEA Dual platelet antiaggregation with acetylsalicylic acid and clopidogrel was initiated Under general anesthesia the stenoses ... no additional neurological deficit Histological examination revealed a thickened layer of arterial neointima Duplex scanning was within normal limits after five days and three months, and was...
  • 4
  • 346
  • 0
báo cáo khoa học:

báo cáo khoa học: " Carotid artery injury from an airgun pellet: a case report and review of the literature" ppsx

Báo cáo khoa học

... case with damage to the left carotid arteries and the cervical sympathetic chain as a possible causative mechanism Unfortunately the patient has not attended for long-term follow up Plain radiographs ... exploration of wound tracts and thus limit complications such as swelling and haematoma formation by facilitating a smaller surgical wound [8] Van As et al [9] advocated the use of selective angiography ... low-calibre injuries in the maxillofacial region are rarely fatal due to haemorrhage or airway obstruction Most vascular injuries can be treated by observation, but angiography is a necessity if a...
  • 5
  • 463
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

Báo cáo khoa học

... systematically evaluated and the best values found are used as defaults Jane can import its files in either Tarzan or a Nexusbased format A file must specify the host and parasite trees and the ... 12 13 Availability and Requirements Jane is implemented in Java with the Swing toolkit and runs on any machine with Java 1.5 or higher The source code and documentation are freely available from ... contrast to TreeMap, Jane can solve much larger problem instances In contrast to Tarzan, Jane always finds correct solutions Jane also offers some features that are not found in existing software...
  • 10
  • 551
  • 0
Báo cáo y học:

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Báo cáo khoa học

... Animals, as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... pre- and post-raltegravir viral load measurements was done Viral load values at Day 0, Day and Day 10 were compared with viral loads at 27 and 166 days prior to treatment start Significant differences...
  • 19
  • 317
  • 0
Báo cáo y học:

Báo cáo y học: "End-tidal carbon dioxide monitoring during bag valve ventilation: the use of a new portable device" pptx

Báo cáo khoa học

... as an auxiliary tool for evaluating the accuracy of bag-valve mask ventilation The main conclusion is that when patients are well under anaesthesia, are hemodynamically stable and adequately ... invasive blood pressure (AISYS, Datex Ohmeda, WI, USA) and capnography built with mainstream technology (EMMA™ Emergency Capnometer, PHASEIN AB, Danderyd, Sweden) attached to a bag-valve apparatus ... without evacuation of the axilla as well as other breast reconstruction work The patient median age was 56 years (range 40-77) and they were all classified as ASA I or II according to the American Society...
  • 5
  • 265
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25