... alive the primary values ofthecorporate Storytelling is a powerful tool in organizational learning as well in that they communicate implicitly organizational values It also plays an important ... that control the management ofthecompany They also represent the institutional philosophy and the support to thecultureof an organization The main objective of core values is to have a framework ... analyzed, compared the data with basic theory and gave out the evaluation and advice 3.3 Limitations of thesis This thesis has some limitations The first limitation is that the research is conducted...
... exert considerable effort on behalf ofthe organization; and a strong desire to maintain membership in the organization a strong belief in and acceptance ofthe organization‘s goals and values a willingness ... refers to an employee‘s belief in the organization‘s goals and values, desire to remain a member ofthe organization and loyalty to the organization Mowday, et al. , 1982; and Hackett, et al, 2001) ... 2003) In astudyof Hong Kong and Australian managers, Lok and Crawford (2004) found a positive effect ofcorporatecultureon organizational commitment Zain etal (2009) examined the effect of four...
... companies place a great deal of emphasis on their values Hofstede (1980)‘s study indicates that cultural values reliably distinguish national subsidiaries ofa multinational corporation Values ... thecompany trademark also contributes a part of their own brands Trademark always reminds employees about theorganisational vision, common goals as well as their missions to achieve those goals ... something about the organization These symbols can be as concrete as a name and as abstract as cleanliness, high tech, modernity, or quality They take all strong measures ofthecompany These are values...
... Destan K & Tomas G M H, A conceptualization of an organizational learning culture in international joint ventures, Industrial marketing management, 34, 430439, (2005) [6] Hauke, A. , Impact of ... He considered bureaucracy as the ideal type of such formal organizations which are efficient, rational and honest Moreover, according to Jarvis (2003), bureaucratic culture has the great capacity ... collaboration, cooperation and participative decision making More than that; by building onthe knowledge of various team members, teams facilitate the exchange and internalization of knowledge and...
... TBS) A monoclonal mouse IgG1anti human anti-HLA-DR [CR3/43] was added at a concentration of 1ug/ml (Dako, Denmark), the membranes were then washed, and incubated with the secondary detection antibody, ... increased the shedding of HLA-DR from the cell surface and also increased HLA-DR gene transcription may have implications for the therapy of septic patients with GM-CSF as these trials have already ... Select software (DNA Star) Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates...
... traps heat in the atmosphere and causes the temperature ofthe earth to rise • This leads to disruption ofthe weather patterns eg drought, floods • Some weeds may thrive onthe extra carbon ... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the world’s ... manure as a fertiliser and set aside land for growth of wild plants Biological Control of Pests • This means using natural predators to eat pests instead of pesticides • It does not have harmful...
... traps heat in the atmosphere and causes the temperature ofthe earth to rise • This leads to disruption ofthe weather patterns eg drought, floods • Some weeds may thrive onthe extra carbon ... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the world’s ... manure as a fertiliser and set aside land for growth of wild plants Biological Control of Pests • This means using natural predators to eat pests instead of pesticides • It does not have harmful...
... weights are based not only onthe distance between the measured points and the prediction location but also onthe overall spatial arrangement ofthe measured points To use the spatial arrangement ... type of topography This can be done automatically by analyzing the variation of elevation by using statistical indicators, such as variance or standard deviation Conclusions Interpolation technique ... in the weights, the spatial autocorrelation must be quantified through empirical semivariograms The semivariogram can have one ofthe following models: circular, spherical, exponential, gaussian,...
... user’s autonomous exploration ofthe set of alternatives and the selection ofthe preferred alternatives Let’s examine now how an argument generator can be evaluated in the context ofthe selection ... data exploration and analysis (IDEA) (Roth, Chuah etal 1997) The IDEA environment provides the user with a set of powerful visualization and direct manipulation techniques that facilitate the ... performs aggregation, pronominalization and makes decisions about cue phrases and scalar adjectives, along with a sentence realizer, which extends previous work on realizing evaluative statements...
... social media use on youth sexual health is also a top priority Studies ofthe effects of social media are the top priority for research in the area of new media and adolescent sexual health Panelists ... effects of media exposure and media-based sexual health intervention on youth sexual health outcomes Although many of these aspects of new media and their potential effects on behavior can be derived ... field as “social mediation.” It is has been found to alter the effects of exposure to media content Social mediation of media effects happens with traditional media as well but typically among a...
... permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced ... permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced ... permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced...
... relative to the potential risk to the poultry industry and human health, it would seem that prematurely dismissing a potential carrier for dispersal has the potential to allow this virus to expand ... null that is false) Uninformative conclusions drawn from valid results Finally, throughout the debate onthe respective roles of migratory and domestic birds in the dispersal of H5N1, there are ... these examples, while the original statements may be strictly true, the conclusions drawn from them are not necessarily valid or informative Conclusion As the debate regarding the role of wild...
... Balakrishnan S, Wang X, Mao H, Hadjipanayis GC: Metallic Iron Nanoparticles for MRI Contrast Enhancement and Local Hyperthermia Small 2008, 4:1925 Andra W, Nowak H: Magnetism in Medicine A Handbook ... in the SAR dependence ofthe particle concentration between the bare and PAA coated particles can be attributed to the active role played by the PAA shell The PAA coating not only stabilizes the ... discussion and drafted the manuscript IP-B participated in the synthesis and chemical characterization ofthe samples GG was involved in the design and fabrication ofthe hyperthermia equipment, participated...
... displays the individual values ofthe percentage of variance explained (57.20% of total variance) Table 4: Total Variance Explained Extraction Sums of Squared Component Total % of Cumulative Variance ... Extraction Method: Principal Component Analysis 36 Table shows the rotated component matrix (also known as factor rotation matrix in factor analysis) is a matrix of load factors for each variable ... quality, ustomers’ satisfaction, and the relationship ofthe these factors Based on these studies, the impact materials have on service quality on customer satisfaction in the food & beverage...
... values of both these materials are presented in Table and in Figs 5–8 It follows from the statistical evaluation by multifactor analysis of variance that theinfluenceof all observed factors on ... actual value of voltage U and onthe basis ofthe recorded phase shift (3rd phase) the equipment is able to evaluate the input of an electric motor; the recorded values were in an interval of ... in any of these cases in the given combination of studied parameters; a higher J FOR SCI., 56, 2010 (5): 243–250 value of cutting input was always reached in materials with false heart The main...
... as Maianthemum bifolium, Veronica officinalis and already mentioned Oxalis acetosella and Soldanella montana are present Calamagrostis arundinacea, Chrysosplenium alternifolium, Stellaria nemorum ... Relation between the proportion of Picea abies and other variables including EIV (CCA with the proportion of Picea abies as the only environmental variable and altitude and slope as covariables); ... MATERIALS AND METHODS Study area The Veporské vrchy Mts are situated in the central part of Slovakia and belong to the central West Carpathians The studied area covers approximately 800 km2 The...
... statistically treated using Multivariant Variance Analysis In order to increase normality, the germination percentage data was transformed using an Arc-sine Transformation, and the average germination ... species of pines and eucalyptus In both P pinaster and P radiata most ofthe treatments place the peaks of maximum germination between days and 25 These peaks are sharper in P radiata than in P pinaster ... totally linear, there are no important variations in the germination rate over a period of time, or within the different treatments applied The evolution ofthe germination rate of P radiata at...
... is a diagonal matrix where the covariances are forced to zero The contribution of each tested factor was then evaluated by splitting the total variability of density components into a variation ... σ The ) sub-model (2b) is equal to Δα + where Δα = + ’Region’ effect, &k; ’Radius’ ,ahpla&;atleD &gahpla&;atleDeffect &kahpla&;atleDand; Δα&gkahpla&;atleD ... variation for density components was analysed in 82 oak trees at breast height and the second analysis concentrated onthe effect of ring location onthe basis of 52 trees in which two radii at...
... mean twist being plotted against levels of each factor and against pairs of factors A regression analysis was then performed, and its associated analysis of variance used to test the statistical ... predictions would be unbiased Model predictions were validated against the validation data (table II) All analyses were performed using the SAS statistical package tial in model RESULTS AND DISCUSSION ... the data available indicated that log diameter alone is the single most important variable in radiata pine Spiral grain was the next most important variable Juvenile wood was closely associated...
... Hiraoka M, Fujino M, Gomi K, Niibe Y, Karasawa K, Hayakawa K, Takai Y, Kimura T, Takeda A, Ouchi A, Hareyama M, Kokubo M, Hara R, Itami J, Yamada K, Araki T: Hypofractionated stereotactic radiotherapy ... of CC calculation Dose to5 thethe PTV as a function ofthe PTV as deterDose to 95% ofthe PTV as a function ofthe PTV as determined using the CC calculation Figure patient ofthe UD (top) and ... Again, large variations 20 CC plan UD plan EPL plan 15 10 PTV Dose to target and critical organs after recalculation Theinfluenceof recalculating the UD and EPL plans with the CC algorithm on...