neg1 and pgnd and the resistance between neg2 and pgnd if the resistance is less than 20 ohm it indicates there is a short circuit find out the causes and install the cables again
Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx
... conceived of the study, and participated in its design and coordination and writing of the manuscript All authors read and approved the final manuscript 10 11 12 13 Additional material 14 Additional File ... T20 and P5 exhibit antiviral activities by different mechanism, and that P5 specific activity is calcium dependent P5 inhibits replication of T20-resistant HIV-1 strains Since there were significant ... antiviral activity, and raise the possibility that calcium plays a role in peptide conformation and its direct interaction with the membrane, either of the virus or the target cell In contrast,...
- 12
- 304
- 0
Báo cáo y học: "The evolution of HIV-1 reverse transcriptase in route to acquisition of Q151M multi-drug resistance is complex and involves mutations in multiple domains" ppt
... primers GagApaF (5’-GCAGGGCCCCTAGGAAAAAGGGC-3’) and CRhINClaIR1 (5’-CCTTATCGATTCCATCTAGAAATAGC-3’) Similarly, HpaI (flanking RT amino acids 288/289) and SpeI (flanking RT amino acids 423/424) sites ... SGS, and their genetic linkage to Q151M MDR mutations was determined A pre-treatment sample was not available for analysis from patient P66; therefore a codon change was scored as a mutation if it ... Clinical HIV samples and database analysis The plasma samples characterized in this study were from a patient enrolled in the CHAP2 prospective cohort study at the University Teaching Hospital in...
- 11
- 350
- 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Austrian ... were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated from seedlings according to manufacturer’s ... cloned in the pCambia 3300 The HA tag was cloned at the SalI site found at the ATG site of OXI1 Plant material and growth conditions The A thaliana (L.) Heynh ecotype Columbia was used in all the experiments...
- 11
- 700
- 0
Tài liệu A Short View of the Frauds and Abuses Committed by Apothecaries, by Christopher Merrett pptx
... declaimed against, prayed only a supply of this defect, and also better and more necessary ways and means, without which, such and all other offenders against the lives and healths of his Majesties ... by their first Charter to act as much in this kind against themselves, and all other persons, as they desired of this present Parliament; And yet neither Apothecary, or any other who practised ... College, and troubled them i n Parliaments, at the Council-Board, &c to their great charge and molestation And for such their great demerits against the College, the King and his Council, Anno 1639...
- 206
- 405
- 0
Tài liệu Misconceptions About Environmental Pollution, Pesticides and the Causes of Cancer doc
... Reviewers for the National Toxicology Program, the Boards of the Harvard Center for Risk Analysis and the Annapolis Center, and was a member of the Harvard Risk Management Group Lois@potency.Berkeley.edu ... of California, Berkeley He is a member of the National Academy of Sciences and was on their Commission on Life Sciences He was a member of the National Cancer Advisory Board of the National Cancer ... sources are other than fruits and vegetables, also are likely to play a significant role in the prevention and repair of DNA damage, and thus are important to the maintenance of long term health...
- 26
- 388
- 0
THE FINANCIAL CRISIS INQUIRY REPORT - Final Report of the National Commission on the Causes of the Financial and Economic Crisis in the United States docx
... of its examination and its conclusions as to the causes of the crisis More than two years after the worst of the financial crisis, our economy, as well as communities and families across the ... regulatory capital standards were hinged on them This crisis could not have happened without the rating agencies Their ratings helped the market soar and their downgrades through 200 7 and 200 8 ... financial stability • We conclude dramatic failures of corporate governance and risk management at many systemically important financial institutions were a key cause of this crisis There was a...
- 663
- 609
- 1
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the ... sequence at the end of the C-terminal helix is essential for ATPase activity and assembly in vitro, this requirement can be bypassed by the addition of Vta1p and a Vps4p protein containing an intact...
- 23
- 490
- 0
HOW THE EURO BECAME OUR MONEY - A SHORT HISTORY OF THE EURO BANKNOTES AND COINS doc
... greater physical and mechanical resistance than normal paper-based products, an essential characteristic considering that banknotes pass from hand to hand many times and are not always treated “kindly” ... incorporate, as a background, a map of Europe without borders, a feature which would harmonise the appearance of the series. This theme was broader than the “Ages and styles” theme as it allowed ... lead times for printing banknotes and minting coins The date of January 200 2 had both advantages and disadvantages The peak period for banknote use is at the end of the year: circulation is around...
- 94
- 527
- 0
The Causes and Behavioral Consequences of Disasters pot
... international reaction, response, and recovery from the disaster In addition to the disaster and its aftermath, we gathered information on the regional and local context Statistical data at the national ... both the nature of the disaster that may arise from a hazard and whether a pre-existing characteristic will indeed become a vulnerability or a capacity A vulnerability in a particular setting may ... Population characteristics interact with the hazard and other existing vulnerabilities and capacities to shape disasters Population size relative to the area of political boundaries and institutional...
- 171
- 1,768
- 0
Bacteria are often maligned as the causes of human and animal disease (like this one, Leptospira, which causes serious disease in livestock)
... coincided with the outbreaks in wild animals - The same distinct viral strains were isolated in animal carcasses and in the bodies of those who handled those carcasses - These outbreaks were preceded ... vomiting, anorexia abdominal pain - headaches - arthralgia (neuralgic pain in joints) - myalgia (muscular pain or tenderness), back pain - mucosal redness of the oral cavity, dysphagia (difficulty ... in swallowing) - conjunctivitis - rash all over body except in face ** If the patients don’t recover gradually at this point, there is a high probability that the disease will progress to the...
- 15
- 782
- 0
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx
... physicians Effective communication is particularly challenging among organizations that are a significant distance apart (e.g., the distance between cities such as Clairton and Oakland) • There are ... learning disability and chronic asthma has a son who was born premature and has several serious health complications, including asthma and withdrawal from asthma medications Her mother and stepfather, ... has home-visiting teams that comprise both a public health nurse and a trained paraprofessional While the paraprofessional focuses on outreach, educating the family about available services and...
- 79
- 343
- 0
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx
... 19 Pasta and Pea Salad with Marjoram-Scented 19 Vinaigrette 19 Pasta Salad 20 Shoepeg Corn Salad 20 Spanish Potato Salad 20 Spinach Apple Salad 20 Tangy Coleslaw 21 Warm Spinach Salad 21 Tabouli ... treat than an actual salad, as it s quite sweet I had this as a child growing up and realized it has no iodine in it, so tried making it for my husband and he loved it! 7th Edition, 201 0 • Tomato-Basil ... min) Add vegetables back to heat Eat plain or over salad to make a great fajita salad Or serve in corn tortillas made with only corn, lime, and water Another variation:serve with tomatoes, guacamole,...
- 123
- 392
- 0
Reserve Recruiting and the College Market - Is a New Educational Benefit Needed doc
... mail at the RAND Corporation, 1776 Main Street, Santa Monica, California 90407-2138 More information about RAND is available at www.rand.org - v - CONTENTS Preface .iii Figures and Tables ... benefits available to reservists and provide information on their usage and on how satisfied reservists are with those benefits We also compare the educational benefits available to reservists with ... generally compatible with college attendance and existing educational programs provide benefits that are comparable to those available to civilians and other military personnel The risk of activation...
- 97
- 270
- 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... p.p.m.) of the GalNAc residue supports it being glycosylated at position Taken together, these data identified the glycan as a- D-Gal-(1fi3 )a- D-GalNAc There are several NOEs between the glycan and the ... between the amino acids side chains of residues Thr10 and Ala12 and the carbohydrate moieties of GalNAc (GN) and Gal (G) The individual amino acids Thr10, Ala12 are represented by 10T and 1 2A, respectively, ... carbon Together these data suggested that the interglycosidic linkage between GalNAc and Gal was 1–3 in the alpha configuration These data were confirmed by the strong NOE between the 1H at position...
- 11
- 563
- 0
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
... adhesion and activation Three such molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isolated from Haementeria officinalis) and calin and saratin (approximately 65 kDa and 12 kDa proteins, ... Watson and Andras Gruber for stimulating discussions, and Dr Barry Coller for the generous gifts of 6F1 and 6D1 Tara C White and Michelle A Berny are ARCS scholars, and David K Robinson is the ... significant implications for the use of saratin as a tool to inhibit platelet–collagen interactions, and may provide the basis for the therapeutic use of saratin as a potent antithrombotic agent...
- 11
- 440
- 0
catastrophes and lesser calamities the causes of mass extinctions jul 2004
... through Europe and America in 1918, reaching the remote wastes of Alaska and the most isolated of island communities It is estimated that half the world’s population was infected, and that of those ... convert a sea into a freshwater lake He argued persuasively that the Paris Basin in Tertiary times was an inlet of the sea, with the salinity diminishing eastwards as the distance from the open marine ... numerical domination of benthic communities, and foraminifera, with the final disappearance of a major, large-sized group, the fusulinids On land, there was a significant loss of because of the limitations...
- 241
- 259
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... Dogan A, Flanagan A, Teague J, Futreal PA, Stratton MR, Wooster R: The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website Br J Cancer 200 4, 91:355-358 20 Mitelman Database ... the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they ... primary blasts Haematologica 200 8, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer 201 0,...
- 10
- 618
- 0
báo cáo hóa học: " Analysing the causes of chronic cough: relation to diesel exhaust, ozone, nitrogen oxides, sulphur oxides and other environmental factors" pptx
... that they have no competing interests Authors' contributions BGK and AF have planed the study BGK has peformed the data analysis and interpretation and drafted the article TK, AVM and UW have all ... percent change in symptom exacerbation among adults and asthmatics is linear Also, the single-pollutant associations between ozone exposure and hospital admissions for respiratory diseases and daily ... observations, but also on the neurophysiological and -anatomical understanding of the cough reflex In this respect it is generally accepted, that airway pollutantcaused airway irritation leading...
- 8
- 334
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25