it is one of the latest finishing m c in textile it can be used in stead of tumble dryer it can finish of textile material without any change of fabric appearance

Finishing process and parameters

Ngày tải lên : 06/08/2015, 13:09

... low GSM fabric About 10 GSM can be controlled Dimensional stability can be also controlled  Brio machine: It is one of the latest finishing m/ c in textile It can be used in stead of Tumble dryer ... of finishing:  1) Chemical finishing: Softener, Biopolishing, Enzyme, UV Protection, Anticreaase, Silicon Finish etc  2) Mechanical finishing: Shrinkage, Raising and Shearing, Finishing effects: ... Compactor Finishing effect of Compactor m/ c Before Compactor Finishing       Small amount of water is contained Crease mark Luster medium Hand feel medium GSM isn’t adjusted Shrinkage is...

49
309
0

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Ngày tải lên : 07/11/2012, 14:44

... metaphor, quality can appear in the form of a circumstantial element or a participant In the meantime, the original carrier can become the epithet of a participant and its role in the clause becomes less ... Second, it can increase the information load of the nominal group by nominalizing the dynamic process and putting several epithets before the head of the nominal group, and thus succeeds in condensing ... language is as it is since it co-evolves with the meanings which co-evolve with the community’s contexts of social interaction Then, language and social is treated as complementary levels of semiosis...

53
1K
3

The Female Brain is one of the most-talked-about books of the year. ppt

Ngày tải lên : 08/03/2014, 23:20

... evaporate because of the way the chemicals in those substances affect the brain Your immediate reality can change in an instant If chemicals acting on the brain can create different realities, what ... Giedd, Jill Goldstein, Mel Grumbach, Andy Guay, Melissa Hines, Nancy Hopkins, Sarah Hrdy, Tom Insel, Bob Jaffe, Martha McClintock, Erin McClure, Eleanor Maccoby, Bruce McEwen, Michael Meaney, Barbara ... and the other girls were making Boys will this to one another—they are not concerned about the risk of conﬂict Competition is part of their makeup And they routinely ignore comments or commands...

302
491
1

Báo cáo hóa học: "TAp73 is one of the genes responsible for the lack of response to chemotherapy depending on B-Raf mutational status" pot

Ngày tải lên : 18/06/2014, 16:20

... from American Tissue Culture Collection (ATCC) All tumor cell lines were maintained in Dulbecco’s minimal essential medium (DMEM) supplemented with 5% fetal bovine serum, mM L-Glutamine, 100 U/mL ... oxaliplatin plus cetuximab In comparison, in SW-480 and Caco-2 cells treated with oxaliplatin in monotherapy or in combination with cetuximab, increasing mRNA TAp73 levels were observed In these cells ... apoptotic function and helps to understand the action mechanism of this drug Methods Tumor cell lines and culture conditions HT-29, SW-480 and Caco-2 human colorectal carcinoma cell lines were obtained...

8
471
0

The Man Who Laughs VICTOR HUGO PART 1- BOOK 2 CHAPTER 1 Superhuman Laws The snowstorm is one of the ppsx

Ngày tải lên : 07/07/2014, 03:20

... observation of magnetic effluvium Without effluvium a crowd of circumstances would remain enigmatic Strictly speaking, the changes in the velocity of the wind, varying from feet per second to 220 ... o'clock by a sort of intermittent fever Certain compositions and decompositions of forces produce phenomena, and impose themselves on the calculations of the seaman under pain of shipwreck The ... produces it as it produces the aurora borealis It is in the fog of the one as in the light of the other; and in the flake of snow as in the streak of flame effluvium is visible Storms are the...

5
376
0

Module III Scanning.Scanning - DefinitionScanning is one of the three components of intelligence ppsx

Ngày tải lên : 31/07/2014, 04:20

... the ACK scan and can also detect open ports ACK Scan: It is used to map out firewall ruleset Nmap: Scan Methods NMAP Scan Options -sT (TcpConnect) -sW (Window Scan) -sS (SYN scan) -sR (RPC scan) ... System architecture Services running on each computer The various types of scanning are as f ll follows: Port Scanning Network Scanning Vulnerability Scanning Types of Scanning Port Scanning • ... system disco er s stem Checking for Live Systems g y Checking for Live Systems - ICMP Scanning In this type of scanning, it is found out which hosts are up in a network b net ork by pinging them...

74
332
0

Energy is one of the most fundamental parts of our universe everything energy in one form or another

Ngày tải lên : 27/04/2015, 08:53

1
305
0

VUng tau is one of the very interested destinations in the southern vietnam

Ngày tải lên : 14/12/2015, 19:27

... The tourist could travel to Vung Tau any time in the year because the weather at here is not so hot and cool every time, you just need to avoid the weekend occasions because there are a lot of ... not miss the most famous attractions such as Bai Sau Beach, Bai Truoc Beach, Long Hai Beach, Bai Dua Beach, Con Dao Island, Vung Tau Light House, Statue of Jesus Christ, Thang Tam Temple… ... tourists arriving to Vung Tau at this time to relax so that all services are easy full booked and its prices are also always increased in the weekend time Exploring Vung Tau, you should not miss...

2
235
0

Báo cáo khoa học: "Effects of sustained subculture on apparent rejuvenation of the apple rootstock M.9 in vitro and in vivo" pps

Ngày tải lên : 09/08/2014, 02:21

... severely pruning the stock plants to give the maximum of Acknowledgments We wish to thank the Agricultural Genetics Company for contributing to the funding of this work Rooting summer References Howard ... rooting in vitro and subsequently of micropropagated plants in the field Similar increased rooting ability of cuttings from micropropagated stockplants of the plum rootstock Pixy has been sustained ... conventional source In vitro rooting of the two 1986 culture lines increased from a mean of 12 ± 7.8% after mo on proliferation medium to a maximum of 73 ± 8.1 % after 12 mo Rooting of culture line B was...

3
336
0

Hydrogen is one of two natural elements that combine to make water

Ngày tải lên : 09/06/2016, 14:47

... vehicles that can be plugged into the electric grid and contain an electric motor and also an ICE or other engine The Chevrolet Volt, the first commerciallymanufactured PHEV, became commercially available ... driving range For example, The Nissan Leaf, the first commercially-manufactured BEV, which became available in in some U.S states beginning in 2010, has a maximum range of 100 miles Mini E users have ... electricity That is because of the inherent inefficiency of the entire hydrogen fueling process, from generating the hydrogen with that electricity to transporting this diffuse gas long distances,...

17
456
0

Báo cáo sinh học: "One of the unusual features of Journal of Biology is its commitment to publish each research article online as" pdf

Ngày tải lên : 06/08/2014, 18:20

1
373
0

Computer illiteracy as one of the main problem of business student

Ngày tải lên : 26/10/2013, 17:15

... The problem of computer illiteracy as a one of main problems of business students Symptoms The main symptom of the computer illiteracy is an inability in computer working For example, student ... for them, instead of learning how to it themselves The third cause is lack of access to computer The fourth cause is dissatisfactory school base The fifth cause is insufficient allocation of application ... illiteracy is the lack of useful information in the course of information science The second cause is unwillingness to learning - many people think that easier to ask someone to something on computer...

4
351
0

Tài liệu [ Team LiB ] Configuring Your Safe Senders List The Safe Senders list is part of the Junk E-mail pdf

Ngày tải lên : 21/01/2014, 02:20

... you can' t enter addresses in the format of @*.microsoft.com You have to enter the entire text following the @ when you add addresses to the list After you've created a Safe Senders list, you can ... Using the right-click menu is the easiest way to add new addresses to the list However, you'll need to use this dialog to remove or edit addresses from the list The list doesn't support wildcards, ... Senders list, you can export it for use on other computers where Outlook 2003 is installed or use it as a backup copy if you need to reinstall Outlook or Windows [ Team LiB ] ...

2
341
0

Tài liệu Báo cáo khoa học: Acetylcholinesterase from the invertebrate Ciona intestinalis is capable of assembling into asymmetric forms when co-expressed with vertebrate collagenic tail peptide doc

Ngày tải lên : 18/02/2014, 17:20

... produce the A12 form of AChE To determine whether the catalytic subunits of C intestinalis AChE catalytic subunits could assemble into asymmetric forms of AChE in the presence of a collagenic tail, ... procedures; and organism, enzyme extracted from adult C intestinalis, as described in the Experimental procedures Source VmaxATCh (mAb ⁄ min) KmATCh (lM) KssATCh (mM) bATCh VmaxBTCh (mAb ⁄ min) ... Results The sequence of the ChE from C intestinalis suggests that the enzyme is an AChET The sequence for C intestinalis AChE contains 618 amino acids (see supplementary Fig S1) The members of the catalytic...

14
581
0

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Ngày tải lên : 19/02/2014, 05:20

... associated with the induction of HO-1 expression in human cancer cell lines HO-2 knockdown may mimic a certain physiological change that is important in the maintenance of cellular heme homeostasis We ... protein, in comparison with the low expression of HO-1 protein, in H146 small cell lung cancer cells is of particular interest because small cell lung cancer is derived from the airway neuroepithelial ... Eagle’s medium (Sigma) YN-1 cells were maintained in Iscove’s modiﬁed Dulbecco’s medium (Sigma), and K562, KG1 and Jurkat cells were maintained in RPMI-1640 medium (Sigma) Each medium contained...

14
487
0

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Ngày tải lên : 21/02/2014, 01:21

... ECF-A141Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q146A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s instructions (mutagenic ... or in vitro [3,4] Second, speciﬁcity of the reaction is determined by the metal ion: the enzyme is active only with the ÔcorrectÕ metal Although, in the complete absence of the ÔcorrectÕ metal, ... elusive Metal speciﬁcity may be considered as consisting of two, presumably distinct, stages First, selectivity in vivo of the proteins for their metal cofactor is a prerequisite, as the proteins must...

12
740
0

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

Ngày tải lên : 21/02/2014, 15:20

... the exact mechanism for complex formation and activation of the enzyme remains to be determined, it can be concluded that the insert within the catalytic domain is of importance for oligomerization ... located in the insert within the catalytic domain, close to the catalytic His264, and the proximity to the active site may explain the effect of oligomerization on enzyme activity Even though the ... represent means of two to ﬁve measurements each of two individual clones with the highest expression of each of the chimeras The activity in control cells transformed with vector alone is nmolÆmin)1Æmg)1...

6
520
0

Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt

Ngày tải lên : 06/03/2014, 00:20

... re-examine the heterologous synthesis of cytochromes c with or without coexpressed ccm genes from a plasmid In addition, the effects of Dsb proteins on cytochrome c synthesis have not been examined ... Biogenesis of cytochrome c H Inoue et al attachment to class I cytochromes c is catalyzed by the cellular machinery, resulting in cytochrome c biogenesis [5] For example, in some Gram-negative bacteria, ... gene, the heme-binding motif observed in general cytochromes c, Cys–X–X–Cys–His, was found to be located close to the C- terminus of the PHCP protein, which is conserved in other biochemically characterized...

8
606
0

Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

Ngày tải lên : 06/03/2014, 22:21

16
538
0