... for hedge classification in biomedical texts As regards the degree of human intervention needed,our classification and feature selection model fallswithin the category ofweaklysupervised machinelearning. ... byour feature selection process had unigram equiva-lents that were eliminated due to the noise present in the automatically generated training data.We manually examined all keywords that had a P ... or statements inahedge or negatedcontext typically appear as false positives, theproper handling of these language phenomenais of great importance inbiomedical text min-ing. In this paper...
... semantic analysis. Our goal wasto investigate the performance ofa memory–basedapproach to the event extraction task, using onlythe information available in the training corpus andmodelling ... Linguistics A memory–based learning approach to event extraction inbiomedical texts Roser Morante, Vincent Van Asch, Walter DaelemansCNTS - Language Technology GroupUniversity of AntwerpPrinsstraat ... development data be-cause the gold test data have not been made available.(1) IFN-alpha enhanced tyrosine phosphorylation of STAT1, STAT3, STAT4, STAT 5a, andSTAT5b.We use the IB1 algorithm as implemented...
... primers TEHA1: ACACAGATCTCTGCA-GGGCACCCCAGGCTTTACA and TEHA2: ACACCC-ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 wasamplified. TEHA3: ACACAGATCTCTGCAGTGAAATG-AGCTGTTGACAATTA and TEHA4: ACACCCATGGT-CTGTTTCCTGTG ... GGGATGTTGAAACGCTTGTTG and GFP6_R: CGGTCACGAACTCCAGCAG,respectively. The input of total RNA was 2 lg. A mixturecontaining total RNA, dNTPs (Invitrogen, Carlsbad, CA,USA) and 5 pmol of each ... was amplified from thevector pAff8eGFP using TEHA7: ACACCTGCAGCGAT-CCCGCGAAATTAATAC and TEHA8: ACACCCATGG-TATATCTCCTTCT, introducing restriction sites for PstIupstream and NcoI downstream of...
... automatically apply a partial parsing that allows us to deal with other kinds of anaphors as well as pronouns. In this work we are going to apply a partial parsing on the output ofa POS tagger in order ... unrestricted textswith partial parsing A. Ferr~indez; M. Palomar Dept. Languages and Information Systems Alicante University - Apt. 99 03080 - Alicante - Spain antonio@dlsi.ua.es mpalomar@dlsi.ua.es ... of anaphora are pronominal references, surface- count anaphora and one-anaphora. In order to solve these anaphors we work on the output of a part -of- speech tagger, on which we automatically...
... using a non-linear Kalman filter and applyit to Australia. The results suggest that long-term in ationexpectations in Australia are well anchored within the ReserveBank of Australia’s in ation ... thebond, not in ation at a certain date in the future; government bonds in Australia are coupon bearing, which means that yields of similar-maturity nominal and in ation-indexed bonds are not strictly ... equates to a turnover ratio of around 7 for nominal bonds and 2½ for in ation-indexed bonds (see Australian Financial Markets Association 2008).6 In ation swaps are now more liquid than in ation-indexed...
... and H2(xt)) are used to calculate a set of forecast observation points. This set of points is used to estimate a meanand variance of the data forecasts.• The mean and variance of the data ... lack of data wecannot do this and instead estimate in ation forward rates as part of our model.4where fit,sis the instantaneous in ation forward rate determined at time t andapplying at ... dBu(B2)ESTIMATING INFLATION EXPECTATIONS WITH A LIMITED NUMBER OF INFLATION-INDEXED BONDSRichard Finlay and Sebastian Wende1. IntroductionReliable and accurate estimates ofin ation expectations are...
... the challenging nature of biomedi-cal texts. They are complex both in terms of syn-tax and semantics, containing complex nominals,modal subordination, anaphoric links, etc.Researchers have ... research has been encouraging but it hasso far concentrated on general language. Domain-specific lexical classification remains unexplored,although it is arguably important: existing clas-sifications ... semantic classification of biomedical terms and nouns, less work has been done on the(manual or automatic) semantic classification of verbs in the biomedical domain (Friedman et al.,2002; Hatzivassiloglou...
... oxi-dases in Alzheimer's disease and other types of dementia?IUBMB Life 2003, 55:307-313.18. Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H,Yamaguchi T, Hayakawa T, Nunomura A, ... microglia can become activated by a range of factors, including pathogens and pro-inflammatorycytokines, and can lead to the subsequent death of co-cul-tured neurons [8,9]. Activated astrocytes and/or ... are expressed as mean ± SEM and were analysed forsignificance using ANOVA.ResultsInflammatory activation of glia in neuronal-glial cultures does not lead to substantial death of the co-cultured...
... revealed a high incidence of Asx motifs with the aspartate orasparagine as the first residue. Specifically Asx motifsoccur with the side chain aspartate carboxyl grouphydrogen-bonded to a main ... family of 13 structures was obtained with a backbone RMSD of 0.73 ± 0.23 A ˚. AII adopts a fairlycompact folded structure, with its C-terminus and N-ter-minus approaching to within 7.2 A ˚ of ... there are threegeneral approaches that can be utilized to extract structuralinformation [4]: a peptide (ligand)-based approach, a receptor-based approach, and approaches that target theligand–receptor...
... Wording: Overall, do you have a favorable or an unfavorable impression of Barack Obama? Registered Voters Overall, do you have a favorable or an unfavorable impression of Barack Obama? ... in Afghanistan Asked of Registered Voters Question Wording: Do you approve or disapprove of how President Barack Obama is handling the war in Afghanistan? Nature of the Sample: Adults ... Fighting War in Afghanistan Asked of Registered Voters Question Wording: Thinking about the costs and benefits to the United States of the war in Afghanistan, overall, do you think it has been...
... ME.NT2000.XPSavant servercollects data,monitors eventsand manages tasksTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gReaderReader ReaderReader Reader ReaderEPC ... Chain: A Guide to Selection and Implementation animal identification, automotive, and maintenance/security. The process of attaching a tag to a supply item begins with entering the data into a tag ... complex as the supply chains become more globaland collaboratively communicate with one another over the Web in a standard way that spans interorganizational and geographical boundaries.One way of...
... used instead of VAD.Finally, DAPK methylation and oligoclonal reconstitu-tion as potential adverse and favorable risk factors in mye-loma warrants further validation with larger number of patients ... conception, design, and acquisition of data,analysis and interpretation of data, writing and approval of the manuscript.Competing interestsThe author declares that they have no competing interests.Received: ... IgG/kappa from freekappa, one IgG/lambda from free lambda). One devel-oped a double IgG/kappa from a single IgG/kappa, andtwo patients had complete change of parapro tein (onefrom IgA/kappa to...
... refinement and validation of the originalinstrument and linguistic validation to a number of Eur-opean and other languages have been described in man ypapers [30-35]. Results of research with disease-specificmodules ... survival, as a result a progressively increasing number of patients areliving with congenital heart disease. Thi s increasednumber of children living in that chronic conditionmeans that clinicians ... sensitivity and responsiveness in longi-tudinal studies. The Hungarian translation of thePedsQL™ may further facilitate international compari-sons and analysis of pediatric health care outcomesacross...