hedge classification in biomedical texts with a weakly supervised selection of keywords
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
... for hedge classification in biomedical texts As regards the degree of human intervention needed,our classification and feature selection model fallswithin the category of weakly supervised machinelearning. ... byour feature selection process had unigram equiva-lents that were eliminated due to the noise present in the automatically generated training data.We manually examined all keywords that had a P ... or statements in a hedge or negatedcontext typically appear as false positives, theproper handling of these language phenomenais of great importance in biomedical text min-ing. In this paper...
- 9
- 407
- 0
A memory–based learning approach to event extraction in biomedical texts pptx
... semantic analysis. Our goal wasto investigate the performance of a memory–basedapproach to the event extraction task, using onlythe information available in the training corpus andmodelling ... Linguistics A memory–based learning approach to event extraction in biomedical texts Roser Morante, Vincent Van Asch, Walter DaelemansCNTS - Language Technology GroupUniversity of AntwerpPrinsstraat ... development data be-cause the gold test data have not been made available.(1) IFN-alpha enhanced tyrosine phosphorylation of STAT1, STAT3, STAT4, STAT 5a, andSTAT5b.We use the IB1 algorithm as implemented...
- 9
- 451
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... primers TEHA1: ACACAGATCTCTGCA-GGGCACCCCAGGCTTTACA and TEHA2: ACACCC-ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 wasamplified. TEHA3: ACACAGATCTCTGCAGTGAAATG-AGCTGTTGACAATTA and TEHA4: ACACCCATGGT-CTGTTTCCTGTG ... GGGATGTTGAAACGCTTGTTG and GFP6_R: CGGTCACGAACTCCAGCAG,respectively. The input of total RNA was 2 lg. A mixturecontaining total RNA, dNTPs (Invitrogen, Carlsbad, CA,USA) and 5 pmol of each ... was amplified from thevector pAff8eGFP using TEHA7: ACACCTGCAGCGAT-CCCGCGAAATTAATAC and TEHA8: ACACCCATGG-TATATCTCCTTCT, introducing restriction sites for PstIupstream and NcoI downstream of...
- 11
- 445
- 0
Báo cáo khoa học: "Anaphor resolution in unrestricted texts with partial parsing" doc
... automatically apply a partial parsing that allows us to deal with other kinds of anaphors as well as pronouns. In this work we are going to apply a partial parsing on the output of a POS tagger in order ... unrestricted texts with partial parsing A. Ferr~indez; M. Palomar Dept. Languages and Information Systems Alicante University - Apt. 99 03080 - Alicante - Spain antonio@dlsi.ua.es mpalomar@dlsi.ua.es ... of anaphora are pronominal references, surface- count anaphora and one-anaphora. In order to solve these anaphors we work on the output of a part -of- speech tagger, on which we automatically...
- 7
- 274
- 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... using a non-linear Kalman filter and applyit to Australia. The results suggest that long-term in ationexpectations in Australia are well anchored within the ReserveBank of Australia’s in ation ... thebond, not in ation at a certain date in the future; government bonds in Australia are coupon bearing, which means that yields of similar-maturity nominal and in ation-indexed bonds are not strictly ... equates to a turnover ratio of around 7 for nominal bonds and 2½ for in ation-indexed bonds (see Australian Financial Markets Association 2008).6 In ation swaps are now more liquid than in ation-indexed...
- 32
- 347
- 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... and H2(xt)) are used to calculate a set of forecast observation points. This set of points is used to estimate a meanand variance of the data forecasts.• The mean and variance of the data ... lack of data wecannot do this and instead estimate in ation forward rates as part of our model.4where fit,sis the instantaneous in ation forward rate determined at time t andapplying at ... dBu(B2)ESTIMATING INFLATION EXPECTATIONS WITH A LIMITED NUMBER OF INFLATION-INDEXED BONDSRichard Finlay and Sebastian Wende1. IntroductionReliable and accurate estimates of in ation expectations are...
- 39
- 395
- 0
Báo cáo khoa học: "Automatic Classification of Verbs in Biomedical Texts" potx
... the challenging nature of biomedi-cal texts. They are complex both in terms of syn-tax and semantics, containing complex nominals,modal subordination, anaphoric links, etc.Researchers have ... research has been encouraging but it hasso far concentrated on general language. Domain-specific lexical classification remains unexplored,although it is arguably important: existing clas-sifications ... semantic classification of biomedical terms and nouns, less work has been done on the(manual or automatic) semantic classification of verbs in the biomedical domain (Friedman et al.,2002; Hatzivassiloglou...
- 8
- 387
- 0
báo cáo hóa học: " Activation of microglial NADPH oxidase is synergistic with glial iNOS expression in inducing neuronal death: a dual-key mechanism of inflammatory neurodegeneration" docx
... oxi-dases in Alzheimer's disease and other types of dementia?IUBMB Life 2003, 55:307-313.18. Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H,Yamaguchi T, Hayakawa T, Nunomura A, ... microglia can become activated by a range of factors, including pathogens and pro-inflammatorycytokines, and can lead to the subsequent death of co-cul-tured neurons [8,9]. Activated astrocytes and/or ... are expressed as mean ± SEM and were analysed forsignificance using ANOVA.ResultsInflammatory activation of glia in neuronal-glial cultures does not lead to substantial death of the co-cultured...
- 15
- 382
- 0
Tài liệu Báo cáo khoa học: NMR structure of AII in solution compared with the X-ray structure of AII bound to the mAb Fab131 pptx
... revealed a high incidence of Asx motifs with the aspartate orasparagine as the first residue. Specifically Asx motifsoccur with the side chain aspartate carboxyl grouphydrogen-bonded to a main ... family of 13 structures was obtained with a backbone RMSD of 0.73 ± 0.23 A ˚. AII adopts a fairlycompact folded structure, with its C-terminus and N-ter-minus approaching to within 7.2 A ˚ of ... there are threegeneral approaches that can be utilized to extract structuralinformation [4]: a peptide (ligand)-based approach, a receptor-based approach, and approaches that target theligand–receptor...
- 12
- 597
- 0
More than Six in Ten Unhappy with Obama on Deficit… Handling of Economy at New Low potx
... Wording: Overall, do you have a favorable or an unfavorable impression of Barack Obama? Registered Voters Overall, do you have a favorable or an unfavorable impression of Barack Obama? ... in Afghanistan Asked of Registered Voters Question Wording: Do you approve or disapprove of how President Barack Obama is handling the war in Afghanistan? Nature of the Sample: Adults ... Fighting War in Afghanistan Asked of Registered Voters Question Wording: Thinking about the costs and benefits to the United States of the war in Afghanistan, overall, do you think it has been...
- 23
- 575
- 0
rfid in the supply chain a guide to selection and implementation
... ME.NT2000.XPSavant servercollects data,monitors eventsand manages tasksTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gTa gReaderReader ReaderReader Reader ReaderEPC ... Chain: A Guide to Selection and Implementation animal identification, automotive, and maintenance/security. The process of attaching a tag to a supply item begins with entering the data into a tag ... complex as the supply chains become more globaland collaboratively communicate with one another over the Web in a standard way that spans interorganizational and geographical boundaries.One way of...
- 452
- 483
- 0
Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot
... used instead of VAD.Finally, DAPK methylation and oligoclonal reconstitu-tion as potential adverse and favorable risk factors in mye-loma warrants further validation with larger number of patients ... conception, design, and acquisition of data,analysis and interpretation of data, writing and approval of the manuscript.Competing interestsThe author declares that they have no competing interests.Received: ... IgG/kappa from freekappa, one IgG/lambda from free lambda). One devel-oped a double IgG/kappa from a single IgG/kappa, andtwo patients had complete change of parapro tein (onefrom IgA/kappa to...
- 7
- 489
- 0
báo cáo hóa học: " Measuring health-related quality of life in Hungarian children with heart disease: psychometric properties of the Hungarian version of the Pediatric Quality of Life Inventory™ 4.0 Generic Core Scales and the Cardiac Module" pptx
... refinement and validation of the originalinstrument and linguistic validation to a number of Eur-opean and other languages have been described in man ypapers [30-35]. Results of research with disease-specificmodules ... survival, as a result a progressively increasing number of patients areliving with congenital heart disease. Thi s increasednumber of children living in that chronic conditionmeans that clinicians ... sensitivity and responsiveness in longi-tudinal studies. The Hungarian translation of thePedsQL™ may further facilitate international compari-sons and analysis of pediatric health care outcomesacross...
- 12
- 619
- 2
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008