... et al., 2008) with the median sample size calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner ... thedesign longitudinal? Sub-total Sample and measures Response rate satisfactory? Sampling source appropriate? Are participants sampled to minimise bias? Use of valid and reliable paper and ... Response rate satisfactory? Sampling source appropriate? Are participants sampled to minimise bias? Use of valid and reliable paper and pencil measures a Sub-total Results Confounding variables controlled...
... such a way that line crossings are avoided when connecting clusters As we can see, the dissimilarities among the top 30 associations to palm are all in the upper half ofthe scale and not very distinct ... algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary of Contemporary English (LDOCE), or in lexical databases ... hierarchical tree are related tothe hand sense of palm, and all other words are related to its tree sense However, it is somewhat unsatisfactory that the word frond seems equally similar to both...
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... al A B C D other Statistical analysis (Student’s t-test) between the MR-1R values and the sum ofthe values ofthe omcA– and the omcB– mutants revealed that there is no statistically significant...
... Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality ofthe matrix An appropriate algebraic method that has the capability to reduce the dimensionality ofa ... length ofthe differential vector falls below a threshold or, alternatively, the agreement with any ofthe centroids becomes too low This way an ambiguous word is assigned to several parts of speech, ... three discovered clusters are much more salient Also, widely and rural are well within the adjective cluster The comparison ofthe two dendrograms indicates that the SVD was capable of making appropriate...
... possession ofthe bones of his grandfather or some of his relations ofa longer antiquity They have other sorts of tombs, as when an Indian is slain in that very place they make a heap of stones (or ... when the term of mourning ceases, at the end ofthe year, they have high mass said for the benefit ofthe soul ofthe departed; after this they again appear upon the arena of their wild sports and ... grounds, always be happy and have eternal life After burial a feast was always called, and a portion ofthe food of which each and every relative was partaking was burned to furnish subsistence to the...
... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... English, the string analyz-iti-able isarguably well-formed as far as the phonology is concerned, but is ill-formed syntactically since -ity attaches to adjectives, not to verbs, and able attaches ... for the sentence: ngarrka.ngku.ka marlu marna.kurra luwa.rnu ngarni.nja.kurra 'The man is shooting the kangaroo while it is eating grass.' Figure 2b isthe syntactic representation for that sentence...
... representation ofthe predicate-argument part ofthe German IS grammar is more due to time constraints than to any far reaching claims about the mutual relationships between an IS and an Upper ... These relate particular instances of what isto be expressed tothe categories of semantic organisation that the grammar's semantics requires These categories, and the relationships among them, ... acceptable translation Because the prepositional phrase isa modifier ofthe main process (indicated by the role feature and the fact that the main process and the modifier are siblings in theIS representation)...
... several operations ofthe physician, the surgeon, and the dentist; in the same way as the investigations ofthe Educationist are intended to direct the operations ofthe Teacher Now the mode of ... on a strict adherence to this law; and the fear of departing in this case from the particular usages of our ancestors is equally unreasonable Soft ground in the valleys compelled them to travel ... with the cultivation ofthe mind, accounts in a very satisfactory manner for the beneficial results which usually accompany the study of languages, mathematics, and some other branches of education...
... would regard mathematical objectivity as really what mathematical Platonism is all about To say that some mathematical assertion has a Platonic existence is merely to say that it is true in an objective ... equivalent, in a speciWed sense, to each ofthe other members xviii Preface To mathematicians (at least to most of them, as far as I can make out), mathematics is not just a cultural activity that ... upwards from the water into the heavens As he stood there, a dark cloud became apparent at the head ofthe beam, giving the whole structure the appearance ofa distant giant parasol, glowing...
... neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ring to them ... computational study in the literature that can be applied tothe automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... take a majority decision Nevertheless, in almost 73% ofthe cases the absolute majority ofthe annotators agreed on the annotation of this dimension Table shows the micro and macro-average of the...
... need of revision A crucial part ofthe success of many ofthe experiments in this thesis was the result ofa fruitful collaboration with Harold Craighead and Jeevak Parpia’s lab This began when ... Cornell and the secretaries that take care ofthe paperwork and negotiate thegrand bureaucracies ofthe academic world, Douglas Milton, Judy Wilson, Deb Hatfield, Kacey Bray, Larissa Vygran, and ... electrically contacted suspended beam and a nearby gate electrode A voltage Vg, applied to this capacitor induces a charge q = CgVg onto the beam where Cg isthe capacitance ofthe beam tothe gate electrode...
... much faster approach isto use a VRayFastSSS2 material The parameters of which are available as an extension ofthe standard VRay Advanced material and as a standalone material called the VRayFastSSS2 ... This time we’ll use the SSS layer in the VRay Advanced material to make a semi accurate portrayal ofa marble floor ‘VrayAdvancedMaterial’ and ‘VRayFastSSS2 Material’ SSS calculated as part of ... Note: These files are all available in the VrayBlendMaterial folder figure 4.37 Page 50 Page 51 VRayDisplaceMaterial The VRayDisplaceMaterial allows the usage of Displacement maps in VRay It’s...
... In this case b is referred to as a divisor of a, and ais called a multiple of b The relation bJa is reflexive and transitive but not symmetric; in fact if bla and alb then a = b Clearly also ... for all rationals p/q (q > 0) For the proof, we shall assume, as clearly we may, that ais real, and we shall apply the mean-value theorem to P, the minimal polynomial for a We have, for any rational ... called the discriminant of k and it turns out to be an important invariant An algebraic integer ais said to be divisible by an algebraic integer p if a l p is an algebraic integer An algebraic...
... many years, and I am a big believer in him as a coach One of his greatest assets is his ability to market and sell a program Here’s a coach who was a walk-on QB at UCLA and worked his way toa ... is on the up and up Weis is smart and wanted to hear what I had to say about his team, especially how they compared tothe other top programs I visited Smart people ask questions and then listen ... Appalachian State visited the Big House and beat Michigan It was a combination of good coaching, the spread offense, and a bunch of Appalachian State players who wanted to prove something tothe big...
... Spread Spectrum ESPRIT Estimation of Signal Parameters by Rotational Invariance Techniques ETOA Elapsed Time of Arrival FPGA Field-Programmable Gate Array GeoD Geographical Distance GPS Global ... based system, a 300 MHz clock is used in [121] for accurate timing 2.1.3 Angle of Arrival Another class of range-based localization isthe use of angular estimates instead of distance estimates ... Ni,ref , and Ni,trans in Eq 2.9 Values of λ and α are estimated by the simulated annealing (SA) [92] algorithm The benefit of applying SA is that in theory the generation of an accurate signal strength...
... now at the small print Biblical scholars widely agree that the ‘bread saying’ derives from the historical Jesus Many argue as well that the ‘cup saying’ is also traceable tothe historical Jesus ... religious and racial separation God’s reign here and hereafter was for all human beings The parables of Jesus show this universal horizon Even in the Parable ofthe Tax-collector and the Pharisee, the ... Prior tothe feeding ofthe five thousand, Mark tells of Jesus sending the Twelve on a trial mission: they are to proclaim and heal (Mark 6: 13) This mission of proclamation and healing means sharing...