evaluation assurance level a package consisting of assurance components from part 3 of the cc that represents a point on the cc predefined assurance scale at present the cc defines seven hierarchical eals from eal 1 to eal 7 the hig
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... tend to fall in silence and let the most talkative ones the talking Nunan (19 99) also points out that one of the classroom variables that have had a marked effect on student participation in oral ... others Week Total Vinh 10 10 35 Nam 11 6 32 Giap 4 18 Giang 4 21 33 % 30 % 17 % Total 25 29 30 22 10 6 20% Table 4a Summary of the number of turns in PTP3 group interaction Week Cuong 19 Binh 11 ... planning time prior to subsequent individual presentations, planners focused their attention on content rather than on the language The analysis of group data also showed that with the exception...
- 77
- 890
- 5
A Plasmonic Photocatalyst Consisting of Silver NanoparticlesEmbedded in Titanium Dioxide
... a fourth approach, namely plasmonic photocatalysis The idea of plasmonic photocatalysis is as follows TiO2 of anatase phase is a semiconductor with a band gap of 3. 26 eV ,12 so near UV irradiation ... T.; Tominaga, J Nanotechnology 2006, 17 , 17 17 - 17 21 ( 21) Berenger, J.-P J Comput Phys 19 96, 12 7, 36 3 - 37 9 (22) Miyauchi, M.; Nakajima, A. ; Watanabe, T.; Hashimoto, K Chem Mater 2002, 14 , 2 812 -2 816 ... photocatalysis Similar ideas were already outlined in the past .14 ,15 For example the photoinduced charging and dark discharging of a silver core as a means to modulate the surface plasmon band of Ag@TiO2...
- 5
- 344
- 0
A STUDY ON THE DIFFICULTIES IN STUDYING TOEIC READING OF NON ENGLISH MAJORS AT ELEMENTARY LEVEL AT HAIPHONG PRIVATE UNIVERSITY
... graduation paper Survey questionnaire: A survey was conducted for the non English majors at elementary level at Haiphong Private University about their attitudes, evaluations about theirs matters ... internalizing their meaning one at a time But reading is actually a very complex process that requires a great deal of active participation on the part of the reader To get a better sense of the complexity ... these easy steps Purchase a copy of Vacation the Nation, New York's #1 Travel magazine Fill out the application card (found in the center of the magazine) Mail the card and $ 21 95 US to the address...
- 58
- 1,537
- 1
A STUDY ON IMRPOVING SPEAKING SKILL OF THE 1ST YEAR STUDENTS OF PRE INTERMEDIATE LEVEL AT FPT UNIVESITY THROUGH GROUP WORK
... In addition to that, some of them did not pay attention to the teacher’s words or just slept Although the administrator has applied the policy of marking, that is the total mark is the 30 % of ... information sharing and role-play to encourage real communication Speaking skill at our university is considered to be so important that any student has to take an oral exam at the end of each ... orientation program, to be aware of the importance of learning as well as the activities The second thing is that the administrator and the faculty of English Department should arrange the teaching...
- 40
- 1,026
- 2
Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... classroom age : 21 – 24 Sex : male Instrumentation Audio – recording Questionnaire Observation note The implementation of the study Time : 10 weeks Total number of participants: 16 ... Department at MSA - Nature of group work - Relationship between group work and individual presentation Objectives of the study contribute more theory to the understandings of group discussion find ... subject-verb agreement and pronouncing morpheme-s in plurality? Methods of the study Qualitative : - Observation - Questionnaire Quantitative: - Descriptive statistics Subjects of the study 16 post-elementary...
- 15
- 798
- 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... replication: enzymological functions and activity regulation via metal cofactors Biochem Biophys Res Commun 286, 10 73 10 81 Sato A, Kanai A, Itaya M & Tomita M (20 03) Cooperative regulation for Okazaki ... for the full length gene; the 5¢-F primer as 5¢-primer and 5¢-GGCGCGAGATCTTTATTACGC GTCGAGCTCCGCCGTCGAGTC -3 as 3 -primer for the RNase H domain; and 5¢-GGGCCGCCCCATATGGG CGCCCCCGCGACCTTC -3 as ... genomic DNA as a template The PCR primers were 5¢-CCTCCTC CTCATATGGCTGACCAGGCGCCCCGCCCCGCGC -3 (5¢-F primer) as 5¢-primer and 5¢-GGTGGTGGTAGAT CTTTATCAGCGCAGGTGGGACGTCTCGTTG -3 (3 F-primer) as 3 -primer...
- 10
- 561
- 1
Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf
... product at the end of period We will make the conservative assumption that the residual value is zero. 13 Details of the analysis are presented in the electronic companion, available as part of the online ... overconsumption in terms of the rate of consumption or the total consumption across the two periods We use the literature that argues that a moderate rate of consumption of caffeine, alcohol, soft drinks, ... develops a framework that can be used to address related issues such as the impact of healthier alternatives and government regulations, such as taxation and advertising restrictions, on the nature of...
- 16
- 488
- 0
formation of zno thinfilms consisting of nano-prisms and nano-rods with a high
... prism-shaped ZnO rods with a low aspect ratio It seems that Al3þ ions suppress the role of C6H5O3À ions by reducing the concentration of C6H5O3À ions through the possible formation of an AlC6H5O7 compound ... different solutions 400 18 5.0x10 10 Mobility (cm2V-1s -1) 3. 1 Carrier concentration (cm -3) 3. 0 -1 10 Solution A Solution D Fig The electrical resistivity, carrier concentration and mobility of the ZnO ... in the sample grown in solution D, which contained both Na3C6H5O7 and Al(NO3)$6H2O as the surfactant chemicals These characteristics were attributed to the surfactant ions It is well known that...
- 5
- 274
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... 10 0.0) 75 .0 ( 53. 8, 96 .3) 0.0 /18 .1 0.0/ 27. 4 0.0 / 37 .5 0.0/25.0 -0. 13 9 0.022 0. 13 3 0 .19 4 0 . 37 4 0 .7 63 0 .33 7 0. 234 Communication Worry 94 94 83. 3 (66 .7, 10 0.0) 65.0 (45.0, 90.0) 1. 1 /39 .4 1. 1 /18 .1 72 71 ... purposes) Health and Quality of Life Outcomes 2009, 7 :32 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Sales E: Family burden and quality of life Qual Life Res 20 03, 12 (Suppl 1) :33 - 41 Helgeson VS: ... Parent HRQL 75 .7 (62.5, 91 .3) 74 .4 (59.4, 90.0) 81 .3 ( 61. 8, 10 0.0) 73 . 6 ( 57. 4, 83. 6) -0. 211 73 . 5 (60.0, 84 .7) -0.0 51 75 .0 (56 .3, 93. 8) -0 .16 5 72 70 .8 (54.2, 91. 7) 43 Emotional Functioning 73 75 .0 (60.0,...
- 11
- 552
- 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... 19 97, 20 :11 69 -11 75 Page of 10 (page number not for citation purposes) Journal of Orthopaedic Surgery and Research 2009, 4 :10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Søballe K, Hansen ES, Rassmussen ... Bezerianos A, Dimarogonas A, Sutherland C: Monitoring of fracture healing by lateral and axial vibration analysis J Biomech 19 90, 23: 3 23- 330 Collier J, Donarski J, Worley J, Lay A: The use of externally ... International, Haasrode, Belgium) The vibration analyser generates the excitation signal which is amplified and sent to the shaker The vibration analyser, the portable computer and the amplifier...
- 10
- 542
- 0
Indian and Northern Affairs Canada Internal Audit Report Financial Audit of the Settlement Allotment Prepared by: Audit and Assurance Services Branch April 9, 2009 pptx
... tracking database to monitor the claims at each stage of payment approval and the timing of payments This database also provides information for the preparation of monthly reports to the Deputy ... report The conclusions were based on a comparison of situations, as they existed at the time of the audit and against the audit criteria It should be noted that the conclusions are only applicable ... schedules a formal hearing and assigns an Adjudicator The claim is settled at a hearing, after which the Adjudicator prepares a Decision stating the decision and establishes the amount of the settlement...
- 13
- 413
- 0
báo cáo hóa học:" A Process and Outcomes Evaluation of the International AIDS Conference: Who Attends? Who Benefits Most?" docx
... Outcomes Evaluation The survey outcomes data indicated that 91% of the delegates who answered the question indicated they intended to change their HIV/AIDS work as a function of attending the XV IAC, ... operate at a loss With the available data to date, host country does not appear to be a factor related to the cost of implementing the IAC nor the amount of income generated The Bangkok IAC cost ... either from sub-Saharan Africa (24%) and Asia (32 %) Using survey response as a proxy indication of attendance by country is problematic but, at this point, no other data are available Abstract...
- 11
- 464
- 0
báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot
... brainstorming prior to new material New material introduced straight away, spot checks were used at the end of each activity Ongoing evaluation None: evaluation at end of training Daily evaluation ... Africa Reprod Health Matters 20 01, 9 ( 17 ) :16 0 -16 9 Renju et al Journal of the International AIDS Society 2 010 , 13 : 32 http://www.jiasociety.org/content/ 13 / 1 /32 Page 12 of 12 18 Dickson KE, Ashton ... results of this study We are also grateful to the Regional Medical and Education Officers of Mwanza and the National Directors of National Institute of Medical Research and AMREF for their support Author...
- 12
- 370
- 0
báo cáo hóa học:" Psychometric evaluation of the Osteoporosis Patient Treatment Satisfaction Questionnaire (OPSAT-Q™), a novel measure to assess satisfaction with bisphosphonate treatment in postmenopausal women" potx
... Over 75 % of patients had been taking bisphosphonates for greater than year and 46% had been on medication greater than years (Table 1) , indicating that they had adapted particularly well to the ... participated in the study design, analysis and interpretation of findings All authors read and approved the final manuscript 11 12 13 14 15 16 17 National Institutes of Health: Osteoporosis and ... (%) Range Convenience Daily Activities Overall Satisfaction Side Effects Composite Satisfaction Score 83. 4 81. 1 84 .1 89.6 84.9 13 . 5 16 .9 15 .7 14 .3 10 .6 83. 3 83. 3 83. 3 95.8 86.9 1. 0% 1. 0% 1. 0% 1. 0%...
- 9
- 629
- 0
báo cáo hóa học: " Psychometric evaluation of the SF-36 (v.2) questionnaire in a probability sample of Brazilian households: results of the survey Pesquisa Dimensões Sociais das Desigualdades (PDSD), Brazil, 2008" docx
... 54.0 3 1, 996 2, 8 37 16 .1 22.8 46.4 41 .3 2.4 6 .3 70 .7 69.8 48 .3 41 .3 50.4 45 .7 3. 6 -1. 1 76 .5 75 .5 53. 0 47. 4 Total 12 ,4 23 10 0.0 49 .3 2.4 74 .7 52.9 51. 1 -1. 1 76 .9 53. 7 (*) Missing values: years of ... obtained among scales to the F-value of the scale Data from the heads of Page of 10 households and their spouses were weighted to represent the total Brazilian population The software SPSS v . 17 was ... a nationally representative probability sample Data quality was satisfactory, with a high response rate and use of all response categories, suggesting that there were no problems related to the...
- 10
- 569
- 0
Báo cáo hóa học: " A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting" pptx
... necessary equipment to execute the neonatal transfers Therefore, ambulances avoided wasting time in an attempt to locate a neonatal ventilator or working incubator The allocation of a dedicated ambulance ... judgement to prioritise P1 incidents before dispatching them It is suggested that in the case of neonatal and maternity incidents, the fact that these patients are already accommodated at a health facility ... (2008) 10 22 32 26 21 79 Neonatal (2005) 78 40 11 8 39 20 17 7 Neonatal (2008) 22 34 56 48 24 12 8 Inter-facility (2005) 58 23 81 33 20 13 4 Inter-facility (2008) 35 21 56 35 23 11 4 All other calls...
- 6
- 432
- 0
Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf
... 3. 874 3. 8 73 5 3. 8 73 3. 872 5 3. 872 3. 8 71 5 3. 8 71 3. 870 5 3. 870 0 Time (s) 10 Figure 4: Noise measurements at output from analogue stage Vout versus Time 10 second recording at 50 Hz sample rate (500 readings) ... profile the beta radiation from an Sr-90 brachytherapy source and was found to be particularly easy to use and to provide stable and repeatable results [3] Due to the high sensitivity available from ... to an accuracy of ±44 μV It can be seen from the data shown in Figure that the noise floor of the electronic system, equivalent to an output of 3. 87 mV peak to peak from the analogue buffer stage,...
- 6
- 391
- 0
Báo cáo hóa học: " Research Article A Framework for System-Level Modeling and Simulation of Embedded Systems Architectures" ppt
... generated by the application simulator and consumed by the architecture simulator In short, they map application event names onto architecture event names Sesame ’s application simulator is called ... code of each Kahn process is instrumented with annotations describing the application’s computational actions, which allows to capture the computational behavior of an application The reading from ... Sesame associates latency values to the incoming application events that comprise the computation and communication operations to be simulated This is accomplished by parameterizing each architecture...
- 11
- 400
- 0
training quality assurance of the public vocational training centers in southeast area
... status of Considering 21 status of trainees To bring out the graduated exam questions To prepare the graduated exam questions To prepare the facilities To establish graduated exam board To organize ... quality assurance conditions, but also must consider the suitability and adaptability of graduates to the labor market In the concept of “relative quality”, postgraduate particularly emphasize the ability ... Training Establishing graduated exam board division (inviting local officials to participate in graduated exam board and corporating technical officers to participate marking practical exam papers...
- 26
- 296
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose