drumlins canoe shaped hill of till formed as glacier over runs a moraine forming it into a swarm of drumlins more common with ice sheets
Children security as part of the " living together with floods" strategy in the Mekong river delta, VietNam
... and protect water sources and sanitation facilities including the installation of cleaning water supply via piped system, clearing of waste matter, cover and removal of stagnant water and unused ... The 2nd Vietnam National Strategy and Action Plan for water - related disaster mitigation and management in the period 2001 - 2020 adopts a key strategy of preparedness and mitigation to the ... needed Students can participate in such environmental campaigns Mass media and health care centers play an important role in propaganda, explanation, and control the water-borne disease epidemic...
- 8
- 514
- 2
An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite
... units which may constitute words or parts of words” A morpheme may be defined as the minimal linguistics sign, a grammatical unit that is an arbitrary union of a sound and a meaning and that cannot ... of English The suffix can attach to practically any adjective, and apart from 13 adjectival base words we find nouns as in “thingness”, pronouns as in “usness” and frequently phrases as in “all-or-nothing-ness” ... pre-intermediate” such as rules of grammar, prefixes, suffixes, idioms and phrases,… Based on the data of this survey, 32% of the students have problems with rules of grammar 20% of them have problems with...
- 63
- 988
- 3
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot
... including kinases and phosphatases [47] A variety of scaffold proteins, such as members of the MAGUK, Shank and Homer families, serve to organize PSD As a result of its modular character and ability to ... proteins, such as Abi2 [We have also found an in vivo association and colocalization of Abi2 with Caskin1 (A Balazs, V Csizmok, P Tompa, R Udupa & L Buday, unpublished results).] Caskin1 is a scaffold ... a rather normal distribution, with an average length of 86 amino acids, the distribution of linker regions is wide, with an average length of 140 amino acids, and a maximal length as long as...
- 13
- 408
- 0
synthesis, growth mechanism and room-temperature blue luminescence emission of uniform wo3 nanosheets with w as starting material
... until its pH value is up to 1.7 Then, the suspension was transferred into a Teflon-lined autoclave with a capacity of 45 mL The autoclave was placed into an oven and heated at 180 1C for 24 h After ... yellow precipitate was separated out and used as the precursor A total of 0.4 g of precursor was added into 19.0 mL of de-ionized water to form a suspension and M HCl was dropped into the suspension ... atomic densities and unsatisfied bonds, resulting in variations of surface energy The facet with a larger surface area has a smaller surface atom density, which results in a lower surface energy...
- 4
- 357
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... tryptophan Automated measurement of the b-galactosidase activity due to basal and stress-induced expression of the interaction-responsive, GAL7 promoterregulated LacZ gene of PJ69-4 was as previously ... as well as a plasmid bearing the YIL117w-LacZ reporter gene [27], which monitors the activity of Rlm1p, a transcription factor activated by cell integrity MAP kinase Loss of cell integrity MAP...
- 11
- 427
- 0
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc
... labelling was observed with a granular appearance (C) Soluble GPV in the supernatants of CHO/GPV cells was analysed by Western blotting with the mAb V.5 An 82 kDa band was detected in untreated samples, ... presence of increasing concentrations of methotrexate Analysis of permeabilized cells by confocal microscopy revealed an intracellular pool of GPV with a granular appearance (Fig 1B) Analysis of culture ... revealed a positive signal starting at 60 of chase and having a molecular mass (82 kDa) consistent with a fully mature form This band was not observed in the cell lysates at any chase time and conversely...
- 7
- 363
- 0
Báo cáo hóa học: " Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trial" potx
... manual wheelchair with a new rear antitip device American journal of physical medicine & rehabilitation/Association of Academic Physiatrists 2009, 88:61-65 Kirby RL, MacDonald B, Smith C, MacLeod ... data at cycle after returning the patients to an upright position even while using a wheelchair with a V -shaped seat Moreover, we found that the overall peak pressure was often located on either ... wheelchair with a Vshaped seat (16” Model, KARMA MEDICAL PRODUCTS CO., LTD.) features an anti-sliding V -shaped seat that “sinks” to a maximum downward angle of 20 degrees, whereas the backrest can...
- 8
- 375
- 0
Báo cáo hóa học: " Self-propagating high-temperature synthesis of nano-TiCx particles with different shapes by using carbon nano-tube as C source" doc
... phase Al Ti decreases greatly than that of the graphite being used as the carbon source (Figure 1a) In contrast to the graphite and C black, carbon nano-tube (CNT) has much finer sizes Furthermore, ... expensive, and energy consuming In fact, in contrast with the external addition methods, the method with nanoparticles in situ synthesis has the advantages of a more homogeneous distribution of the nanoparticles, ... dissolves more slowly because of the poor chemical reactivity between carbon and the Cu (or Al) melt as well as very limited solubility of carbon in molten Cu and Al In this case, the TiC x forms and...
- 7
- 447
- 0
vFacile Fabrication of Uniform Polyaniline Nanotubes with Tubular Aluminosilicates as Templates" pptx
... nm And the inner hollow cavity of the PANI/HNTs hybrids remained at about 10 nm as the raw HNTs (Fig 1a) It indicated that the polyaniline layer with the thickness of about 10 nm was only coated ... destroyed with more conc HCl added The weight ratio of the PANI coated with HNTs templates was found to be 43.67% It indicated that almost all the aniline had been polymerized to form the coaxial coatings ... irradiated ultrasonically for 30 Then 100 mL of the acidic aqueous solution of APS (containing APS 6.80 g and conc HCl 1.00 mL) was added dropwise into the colloidal mixture within 30 with magnetic...
- 4
- 231
- 0
báo cáo khoa học: "Lymphomatoid granulomatosis masquerading as interstitial pneumonia in a 66-year-old man: a case report and review of literature" pps
... treated With Rituximab alone Arch Neurol 2008, 65:662-665 Mizuno T, Takanashi Y, Onodera H, Shigeta M, Tanaka N, Yuya H, et al.: A case of Lymphomatoid granulomatosis/angocentric immunoproliferative ... refractory cases but the clinical implications of this modality have not been reported in large studies [13] Case Presentation A 66-year-old Caucasian man with no significant past medical history ... PT/INR, aPTT, fibrinogen and TSH D-dimer was elevated at 15.4 (normal
- 6
- 208
- 0
báo cáo khoa học: " Inflammatory pseudotumors of the kidney and the lung presenting as immunoglobulin G4related disease: a case report" pps
... autoimmune pancreatitis: revised proposal J Gastroenterol 2006, 41(7):626-631 Kamisawa T, Okazaki K, Kawa S, Shimosegawa T, Tanaka M, Research Committee for Intractable Pancreatic Disease and Japan Pancreas ... nephritis associated with autoimmune pancreatocentric disease Am J Surg Pathol 2007, 31(10):1586-1597 Okazaki K, Kawa S, Kamisawa T, Naruse S, Tanaka S, Nishimori I, Ohara H, Ito T, Kiriyama S, ... presented with a renal mass, and thus underwent a nephrectomy as the mass was mistaken for a malignant tumor Many of these patients were subsequently diagnosed with IgG4-related systemic disease by pathological...
- 4
- 237
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Benign giant mediastinal schwannoma presenting as cardiac tamponade in a woman: a case report" ppsx
... http://www.jmedicalcasereports.com/content/5/1/61 schwannoma presenting as cardiac tamponade in Recklinghausen’s disease had a rapidly fatal outcome after pericardial drainage, whereas in our case, drainage ... presenting with life-threatening cardiac tamponade caused by a large volume of pericardial effusion Previous reported cases of malignant meidiastinal Kato et al Journal of Medical Case Reports ... reported as malignant intrapericardial schwannomas with cardiac tamponade [7,8] To the best of our knowledge, this is the first reported case of a benign extrapericardial mediastinal schwannoma presenting...
- 3
- 320
- 0
báo cáo khoa học: "Efficacy of postural techniques assessed by videofluoroscopy for myasthenia gravis with dysphagia as the presenting symptom: a case report" pot
... For an evaluation of dysphagia, a thorough history and clinical examination provide valuable information The swallowing ability of patients with myasthenia with dysphagia typically, but not always, ... Rison RA: Reversible oropharyngeal dysphagia secondary to cricopharyngeal sphincter achalasia in a patient with myasthenia gravis: a case report Cases J 2009, 2:6565 Colton-Hudson A, Koopman WJ, ... with a positive anti-acetylcholine receptor antibody test The MG stage was assessed as grade IIA according to the Osserman classification at that time A clinical swallowing evaluation by a speech/language...
- 4
- 299
- 0
báo cáo khoa học: " Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperparathyroidism in a woman: a case report" ppt
... surface and was measured as 20 mm × 15 mm × 10 mm on gross examination Histopathological examination revealed a parathyroid adenoma with foci of epithelioid granuloma representing non-caseating ... lymphadenopathy APMIS 2007, 115:754-758 Kar DK, Agarwal G, Mehta B, Agarwal J, Gupta RK, Dhole TN, Mishra SK: Tuberculous granulomatous inflammation associated with adenoma of parathyroid gland manifesting ... of occasional acid-fast bacilli in such cases As it happened in our case, Jacob et al [8] could not detect the origin of granulomatous inflammation, and owing to the fact that tuberculosis was...
- 4
- 157
- 0
báo cáo khoa học: " The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma – report of a case" pptx
... bronchioloalveolar adenocarcinoma as well as adenocarcinomas of the salivary glands [13] Since the patient in this case report presented with an additional adenocarcinoma of the lung, the primary site ... rate and slight nuclear atypia can better be assessed as polymorphous low-grade adenocarcinoma Hence, the majority of adenocarcinomas will be of high malignancy grade, as in this case, characterized ... mandible Examination of the patient did not reveal facial paralysis, paraesthesia and palpable regional lymphadenopathy Haematologic parameters were all within normal range For further elucidation,...
- 5
- 338
- 0
Báo cáo y học: " Construction of Metabolically Biotinylated Adenovirus with Deleted Fiber Knob as Targeting Vector" ppsx
... the antibody Our lab has developed metabolically biotinylated Fab fragments against rat APP (833cb Fab) which has one biotin residues located at the C-terminal side of the C1 domain of the heavy ... vector to MA104/APP or MA104 cells preincubated with biotinylated antibodies targeting rat APP Cells were incubated with chemically biotinylated J310 antibodies against APP, then transduced with the ... Chrastina A, Lwata K, Zinn KR, Baldwin R, Testa JE, Schnitzer JE: Live dynamic imaging of Page of caveolae pumping targeted antibody rapidly and specifically across endothelium in the lung Nat...
- 6
- 263
- 0
Báo cáo y học: " Long-term gas exchange characteristics as markers of deterioration in patients with cystic fibrosis" pot
... appropriate as an alternative to arterial PaO2 However, the discrepancy between capillary and arterial PaO2 increased with increasing PaO2 Reproducibility of earlobe blood gas measurements was assessed ... comparing PaCO2 measurements with a mean PaCO2 of 33.7 ± 0.32 mmHg for blood gas measurements associated with normal FEV1 versus a mean PaCO2 of 35.1 ± 0.29 mmHg in association with abnormal FEV1 ... than years of age (blood gas analysis and lung function data not available), and in CF patients (2.9%), fewer than annual measurements were available Some of lung function data in the database...
- 12
- 291
- 0
Báo cáo y học: "Citrullinated vimentin as an important antigen in immune complexes from synovial fluid of rheumatoid arthritis patients with antibodies against citrullinated proteins" pot
... determined ability or disease status variation can not be excluded as contributing factors By means of this broad range approach, Fibβ, possibly citrullinated, was found as an antigen in SF from RA patients ... Takizawa Y, Suzuki A, Sawada T, Ohsaka M, Inoue T, Yamada R, Yamamoto K: Citrullinated fibrinogen detected as a soluble citrullinated autoantigen in rheumatoid arthritis synovial fluids Ann Rheum ... A, Hayashi H, Tahara K, Yamamoto K: Identification of citrullinated antigen as component of immune complex in synovial fluids from patients with rheumatoid arthritis Arthritis and Rheumatism...
- 10
- 309
- 0
Fabrication of 3d photonic crystals with self assembled colloidal spheres as the template
... (A) PhC model with diamond structure (Maldovan and Thomas, 2004) and (B) Diamond array of silicon spheres (Garcia-Santamaria et al., 2002) 14 Chapter Literature Review 2.1.2 Colloidal self-assembly ... simple and easy to implement, a large quantity of defects and the large possibility of forming a mixture of colloidal crystal phase reduce its application in fabrication of PhCs Self-assembly ... technology, it can be easily integrated in the optical devices PhCs of silicon with a RI of 3.5 (Blanco et al., 2000) and gallium with a RI of (Miguez et al., 200 1a) have been fabricated, which guarantee...
- 214
- 466
- 0
Numerical quantum modeling of field effect transistor with sub 10nm thin film semiconductor layer as active channel physical limits and engineering challenges
... conduction band edge is of a parabolic nature, characterized by a transverse mass (mt ) and longitudinal mass(ml ) In general case, longitudinal and transverse axis of k space will not neccessary aligned ... bands of Si 100 thin film (8atm Si film + 8atm vacuum with H passivation) calculated with ab initio method (using CASTEP, Local Density Approximation) and via empirical pseudopotential method with ... [Luttinger55] approach Fig shows the comparison of hole subband structure calculated with an eight-band and six-band ˙ Hamiltonian for a Si and Ge quantum well with a 100 surface and a thickness of 3 0A It...
- 237
- 254
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose