cyanosis unreponsive to supplemental oxygen therapy and in the face of a normal partial pressure of oxygen in arterial blo
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt
... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview ... Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system Child and Adolescent ... before in other Sub-Saharan African settings The translators were extensively trained and the translation was discussed in detail Nevertheless, cultural bias might have influenced the findings, as...
- 9
- 405
- 0
Báo cáo khoa học: Sp1 binds to the external promoter of the p73 gene and induces the expression of TAp73c in lung cancer doc
... blot analysis demonstrated an increase in DNp73 in representative squamous cell carcinoma and adenocarcinoma samples relative to the adjacent normal tissues DNp73 levels are affected by Sp1 and ... fibroblast cell lines (CCL171 and IMR90), and substantially increased in the lung epithelial anaplastic carcinoma cell line (CALU6), the small cell carcinoma cell line (DMS53), the squamous lung cancer ... enhance the transactivation activities of TAp7 3a and TAp73b [39,40] In addition, lack of exon 11 in TAp73c results in the truncation of a second transactivation domain, located within amino acids 381–399,...
- 14
- 393
- 0
NATIONAL ACTION PLAN for CHILD INJURY PREVENTION: An Agenda to Prevent Injuries and Promote the Safety of Children and Adolescents in the United States pptx
... to galvanize a national effort What are Our Goals? The overall goal of the NAP is to stimulate a national coordinated effort to reduce child and adolescent injury and its accompanying death and ... Unintentional injury death rates are highest for American Indians and Alaska Natives • Unintentional injury death rates are lowest for Asians or Pacific Islanders • Unintentional injury-related death rates ... developing effective educational materials, cataloging and sharing what works (best practices), and paying attention to educational needs and gaps at all levels from primary education to professional...
- 92
- 375
- 0
Báo cáo y học: "Inflammatory Signals shift from adipose to liver during high fat feeding and influence the development of steatohepatitis in mice" pot
... the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and the Animal Welfare Act under the supervision of our institutional Animal Care and Use Committee Animals ... weeks was accompanied by an increase in the serum levels of alanine aminotransferase (ALT), indicative of progressive liver damage (Table 1) We measured a variety of serum cytokines and mediators ... course of HFC feeding demonstrated that there was an inflammatory milieu in these mice Histological analysis reveals hepatic steatosis and inflammation in HFC-fed mice Histological examination...
- 14
- 336
- 0
Báo cáo y học: "A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pdf
... Implementation Science 2009, 4:35 zation-wide training and leadership behavior modeling to bring about significant cultural change and quality and financial gains In contrast to the number of transformational ... Both authors read and approved the final manuscript Author's information JV is a health services research doctoral candidate and the project coordinator for the Center for Health Organization Transformation ... for Health Organization Transformation and Professor and Head of the Department of Health Policy and Management in the School of Rural Public Health at the Texas A& M Health Science Center in College...
- 9
- 821
- 0
Báo cáo y học: "Inflammatory Signals shift from adipose to liver during high fat feeding and influence the development of steatohepatitis in mice" pptx
... the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and the Animal Welfare Act under the supervision of our institutional Animal Care and Use Committee Animals ... weeks was accompanied by an increase in the serum levels of alanine aminotransferase (ALT), indicative of progressive liver damage (Table 1) We measured a variety of serum cytokines and mediators ... course of HFC feeding demonstrated that there was an inflammatory milieu in these mice Histological analysis reveals hepatic steatosis and inflammation in HFC-fed mice Histological examination...
- 14
- 306
- 0
báo cáo khoa học: " A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pot
... Implementation Science 2009, 4:35 zation-wide training and leadership behavior modeling to bring about significant cultural change and quality and financial gains In contrast to the number of transformational ... Both authors read and approved the final manuscript Author's information JV is a health services research doctoral candidate and the project coordinator for the Center for Health Organization Transformation ... for Health Organization Transformation and Professor and Head of the Department of Health Policy and Management in the School of Rural Public Health at the Texas A& M Health Science Center in College...
- 9
- 644
- 0
báo cáo khoa học: " Accelerating harm reduction interventions to confront the HIV epidemic in the Western Pacific and Asia: the role of WHO (WPRO)" pot
... was the beginning of a pragmatic and humanitarian approach to the treatment of drug addiction [4] In 1984, to control an outbreak of hepatitis B in the Netherlands and pressured by the Association ... before the age of 18 years and shift to injecting very fast Heroin is the main drug of injection; however, an increasing number of people use ATS as their main drug of choice Rates of sharing of injection ... developing and adapting guidelines for the treatment of addiction, organizing advocacy workshops and supporting the secretariat of the Task Force The main partnership of WHO in the country is with the...
- 13
- 268
- 0
Research on the movement of rock and soil on slope in the mountanious region from Quang Tri to Thua Thien Hue and proposite the suitable prediction measures (tóm tắt + toàn văn)
... remote sensing image analysis saw that in the mountainous areas in research had 420 points of the moving rock and soil on slope and sloping roof In particular, sloping roof on the road, including construction ... in the mountainous areas from QT to TTH The natural - technical factors in the mountainous areas from QT to TTH Name Sloping degrees and sloping roof , (degrees) Annual average rainfall intensity ... evaluation, thereby selected the main factors were the cause and mainly affecting conditions of landslide on slope in the mountainous 14 areas from QT to TTh as follow (Table 3) Table The main...
- 29
- 322
- 0
Photoimmunotherapy of melanoma via combination of hypericin photodynamic therapy and in vivo stimulation of dendritic cells by PNGVL3 HFLEX plasmid DNA
... and encouragement I am also deeply grateful to my co-supervisor Associate Professor Malini Olivo, Principal Investigator of the Laboratory of Photodynamic Diagnosis and Treatment, National Cancer ... 4% of all skin cancers but causing almost 80% of skin cancer deaths A well-know feature of 26 malignant melanoma is that the tumor cells can spread haematogenously and lead to distant metastases ... to DC-based vaccines A notable Phase III trial was conducted to compare the efficacy of autologous peptide-pulsed DCs with dacarbazine in metastatic melanoma utilizing a cocktail of class I and...
- 130
- 331
- 0
DEVELOPING, USING AND ANALYZING THE RESULTS OF INTERVIEWS TO DETERMINE THE FEELINGS OF FOREIGN TOURISTS ON THEIR VISIT TO VIET NAM
... Cambodia, and Vietnam And the reason why the north American tourists come to Vietnam much more than before? Because, at this time, there is a presidential racing in America, and one of them is ... tourist coming to Vietnam at this time, and divided into three occupations: tourists from European, Oceanian and North American In general, the greatest number of tourist who coming to Vietnam recently ... humor and very easy to get an open talk with them Besides that, they also asked them for some visiting places in Hanoi, where they have to go and to see And, for only one hour, we finished our interview...
- 31
- 1,149
- 0
Advances in Relationship Marketing Thought and Practice: The Influence of Social Network Theory
... relationships and achieve relationship marketing outcomes (Balasubramanian and Mahajan 2001; Devaraj, Porter and Sun 2006; Dholakia et al 2004; Kozinets 2002; Muniz and O’Ginn 2001; Porter and Donthu ... could inform us! • Leveraging social media to drive marketing relationships – – – – – Viral marketing via the Internet Social Networking Sites Blogging Podcasting Instant Messaging Interdisciplinary ... (Frenzen and Nakamoto 1990) • Weak ties are not that strong in B2B – The more valuable the info, the less powerful is the weak tie (Frenzen and Nakamoto 1990) – Weak ties among horizontal partners are...
- 31
- 482
- 0
Foreign direct investment in Vietnam: An overview and analysis the determinants of spatial distribution across provinces
... the ASEAN behind Singapore and Malaysia (Mirza and Giroud 2004) Several country-specific advantages have been pointed out as the main factors allowing Vietnam to attract such a large amount of ... for a number of key investors These data allow us to estimate separate equations for each country The FDI by provinces are available for EU, US, Japan, China, ASEAN, Thailand, Taiwan, and Singapore ... of that host country rather than in others Finally, multinationals must have the ability to internalise the O and L advantages.13 National Determinants There are only a few studies that examined...
- 68
- 996
- 2
(1) how learners approach learning, both in and out of classrooms, and (2) the kinds of strategies and cognitive processing they use in second language acquisition
... create associations of positive affect towards the foreign language and its speakers as well as towards the learning activities involved Learning training can help students to face up to the emotional ... value of (3.02) The category included students regulating and managing their learning, using strategies for planning, monitoring and evaluating their learning Students reported using all the metacognitive ... approach (CALLA) Metacognitive strategies Advance organization Previewing the main ideas and concepts of the material to be learned, often by skimming the text for the organizing principles Advance...
- 83
- 622
- 0
developing, using and analyzing the results of interviews to determine the feelings of foreign tourists on their visit to viet nam
... traditional markets we have to calculate to right way Thus, the Old quarter need manage and arrange again to avoid breaking space of the Old quarter b Entertainment in Hanoi Our team also find ... understand and popular - All in all, our team caught the interesting information, the feeling of tourists when they travel in Hanoi in the particular and Vietnam in the general 30 V/ RECOMMENDATIONS ... and to know what they can and don’t in Vietnam No one choose Tour Company for finding information It is very easy to understand because they are afraid of quality of the company Altogether, almost...
- 31
- 730
- 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx
... (given in kb) was determined by kHindIII Size of the bands observed in each autoradiogram is indicated at the right side The 6.6 kb band detected in lanes b, c, and d in autoradiogram (B), and lanes ... but also are likely to participate in the establishment and maintenance of an active chromatin state [18,28,29] In addition to their presence in and adjacent to active or potentially active genes, ... (Palo Alto, CA, USA) The intensity of bands on the Northern hybridization was compared by typhoon 9210 and image quant (Amersham Biosciences, Piscataway, NJ, USA) Acetylation status of H3 and H4...
- 11
- 638
- 0
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf
... endothelial cells were incubated with probes shown in Table and Fig Arrows indicate the bands that are interacting with these probes All the lanes have labelled probes The adding of extracts and ... TAC CGC ATC ACA GTC TC GCA AAT GCG CCA GGT ACC TTC TGG GAA CTC GAG TTC CCA GAA GGT ACC TGG CGC ATT TGC CCG CCC TTT TGA GGT ACC AGA GAA CGC CTG CAG GCG TTC TCT GGT ACC TCA AAA GGG CGG CTG GGA ACT ... GGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAG CAGGAAGTTCGA-3¢; Ets (PU.1), 5¢-GGGCTGCTTG AGGAAGTATAAGAAT-3¢; Stat3, 5¢-GATCCTTCTG GGAATTCCTAGATC-3¢; and C/EBP, 5¢-TGCAGATT GGGCAATCTGCA-3¢ are from Santa Cruz Biotechnology...
- 13
- 525
- 0
Whatever Happened to Frank and Fearless- The Impact of the New Public Management on the Australian Public Service ppt
... the Australian Wheat Board (AWB) to the regime of Saddam Hussein in order to obtain contracts for the sale of Australian wheat to Iraq, involving the Department of Foreign Affairs and Trade (DFAT); ... edited a book on Westminster Legacies in Asia and the Pacific — Westminster Legacies: Democracy and responsible government in Asia and the Pacific He was a chief investigator in a major Australian ... Auditor-General and the former head of the Department of the Prime Minister and Cabinet as a ‘watershed in administrative thinking and reforms’ whose ‘enduring themes have proved to 10 A failure of public...
- 176
- 735
- 0
The Power of “Independence”: Defending and Extending the Jurisdiction of Accounting in the UK pdf
... emerged as a distinctive group, rather than as a branch of legal practice, is attributable to a combination of state sponsorship and the disdain of lawyers for accounting work Capitalising upon the ... about accountants’ claims to independence are routinely appeased by introducing some reforms and refinements into their self-regulatory arrangements, by updating ethical and disciplinary arrangements ... defend the authority and independence of accountancy practices in general and the prevailing regulatory arrangements in particular But, to repeat, whenever reference is made to the accountancy profession...
- 15
- 571
- 0
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
... (ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and GateHISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat gatgatgatgatgatgatg) The ... gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat gccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatga tgatgatgatgatgatgct tatcgtcatcgtcc) The resulting ... physiological substrates, and determined the Km constants of native CPU from plasma, recombinant WT CPU and YQ CPU for Hip-Arg and bradykinin using an arginine kinase-based kinetic assay [27] Data are presented...
- 15
- 397
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25