creating daos and a data manager
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... 29 Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR Quantification of Vgf- and pro-SAAS-derived peptides in endocrine tissues and the brain, and their regulation by diet and cold ... the ALS phenotype 98 10 11 12 13 14 Acknowledgements Supported by ALS grant from the Department of Veterans Affairs, NCCAM 5R21 AT002602-02 and NCCAM 1R21 AT003632-0 1A1 to GMP and NARSAD and...
- 8
- 499
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT ... genomic DNA contamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5¢-ATCACCATCGGCAACGAGAG-3¢ and 5¢-TGGAGTTGTAGGTGGTCTCGTG-3¢)...
- 12
- 568
- 0
CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx
... demand a multidisciplinary collaborative approach among different professionals and organizations in the community Overseas experiences have shown that community-based, and coordinated medical and ... coordination and quality of community-based care This can be done by fostering a holistic and continuous approach, and strengthening social support through the collaboration of formal and informal ... volunteers reflected that the linkage between hospitals and social welfare agencies was inadequate (Department of Social Work and Social Administration, HKU, 1998) Indeed, the varying needs of elderly...
- 7
- 507
- 0
Creating a glass object with max and vray
... cheked and on V-ray shadows parameters check Transparent shadows and area shadow Use a plane for the scene and assign a white color to this It looks fine, but not really :) The glass need something ... Image Sampler(Antialising), turn of the Adaptive subdivision For the glass materials use this settings: and for the liquid this For the lighting I have used an Omni light, V-ray shadows cheked and ... reflect To this use a HDRI map You can find some HDRI images at this address http://athens.ict.usc.edu/Probes/ and assign this to V-ray Environment and the result And with caustics the scene will...
- 14
- 279
- 0
![picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease](https://media.store123doc.com/images/document/14/y/ob/small_oby1401382455.jpg)
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease
... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... a MySQL database to hold the information and site configuration data Most service providers have MySQL databases available for simple hosting; virtual and dedicated services have MySQL and PHP ... Installing Joomla! 1.6 requires a series of steps on a Webserver Ǡ A MySQL database with a username, password, and database name is required Ǡ The database is created via the Website control panel...
- 320
- 858
- 0
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... clinical samples, follow-up clinical information and final writing of the manuscript VM, SS, PC and EB participated in acquiring clinical and laboratory data, data analysis and data interpretation ... interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and drafted the manuscript All authors read and approved the final manuscript...
- 6
- 300
- 0
o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... clinical samples, follow-up clinical information and final writing of the manuscript VM, SS, PC and EB participated in acquiring clinical and laboratory data, data analysis and data interpretation ... interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and drafted the manuscript All authors read and approved the final manuscript...
- 6
- 312
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... common disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence ... fracture site, allowing vascular regeneration and eliminating further damage to the peripheral and intramedullary blood supply which occurs during plate and screw fixation and intramedullary nailing ... Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's disease of bone in Japan J Bone Miner Metab 2006, 24:186-190 Takata S, Hashimoto J, Nakatsuka K, Yoshimura...
- 4
- 402
- 0
Báo cáo lâm nghiệp: "Do trees use reserve or newly assimilated carbon for their defense reactions? A 13 C labeling approach with young Scots pines inoculated with a bark-beetle-associated fungus (Ophiostoma brunneo ciliatum" pptx
... 2.8 Statistical analyses 2.6 Extraction and purification of C and N metabolites from sapwood and phloem Starch, soluble proteins, soluble sugars and amino-acids were extracted and purified according ... area was measured with a leaf area meter (Delta-T Devices, Cambridge, UK) Once Ψwp had reached a threshold of around –2 MPa (after approx 10 days), saplings were watered to field capacity and ... well-watered controls (Figs 2a and 2b) Daily water use was about 0.45 L day−1 from an available soil water reserve of about L Predawn needle water potential (Ψwp ) fluctuated around −0.34 MPa throughout...
- 8
- 411
- 0
Báo cáo lâm nghiệp: " Scots pine responses to number and density of inoculation points with Leptographium wingfieldii Morelet, a bark beetle-associated fungus" docx
... Mean values of damage extent were calculated in each tree, and resulting values were compared between modalities Means are presented with their standard error Analysis of variance (ANOVA) was achieved ... (figure 3) Resin-soaked and desiccated sapwood areas were around 5-15 % in parameter and the damaged sapwood area response to all treatments, and did not dis- cent play any change with density ... the areas on a transparent paper and by measuring them with a planimetre (ΔT area metre, ΔT Devices, Cambridge, UK) The outer bark was removed at around 10 inoculation points in each...
- 10
- 168
- 0
Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx
... cisplatin and taxol combined with radiotherapy, and is disease-free at the time of publication A comprehensive family history was taken and a formal pedigree was assembled (Fig 2) The patient's father ... colon cancer shortly after diagnosis at age 55, and three other paternal family members had cancer in an unknown site The patient's paternal grandmother died at an early age of unknown causes ... authors have read and approved the final manuscript Acknowledgements The authors thank Mark S Hochberg for guidance and support, Mei X Peng for technical assistance, and Melinda Kwan for advice...
- 6
- 480
- 0
Báo cáo y học: "Complex regional pain syndrome with associated chest wall dystonia: a case report" ppt
... significantly changed after baclofen treatment (Table 1) She was maintained at a dose of 600 μg/day of intrathecal baclofen and has been asymptomatic in regard to lethargy, weakness, nausea, headaches, ... that colocalize vasoactive neuropeptides with glutamate and are also pivotal in neurogenic inflammation [21] Substance P is released from pain afferents and activates NK1 receptors on lamina ... μg/day, Dilaudid 26.5 mg/day †† Patient intrathecal medication dose at time of study: Baclofen 400 μg/day, Dilaudid 21.5 mg/day Irwin and Schwartzman Journal of Brachial Plexus and Peripheral...
- 4
- 457
- 0
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... anti-RNP antibody, and anti-SS -A antibody Bilateral hand X-rays showed mild swelling and destruction of the metacarpo-phalangeal (MP) and proximal-inter-phalangeal (PIP) joints He was diagnosed to have ... Yoshiba F, Ohsaka M, Miyazaki K, Yamazaki E, Sakai R, Tamaru J, Kishi K, Kanamori H, Higashihara M, Hotta T, Ishigatsubo Y: Remission of lymphoma after withdrawal of methotrexate in rheumatoid arthritis: ... (Figure 1A) , and a diagnosis of AML-MLD was made based on World Health Organization (WHO) criteria [4] The immunophenotype of blasts was CD7, 13, 33, 34, and HLA-DR positive, and an abnormal karyotype,...
- 6
- 314
- 0
Báo cáo y học: "A dentigerous cyst associated with bilaterally impacted mandibular canines in a girl: a case report" potx
... canines and the dentigerous cyst The resultant data were reconstructed, and multi-planar and orthoradial views were examined The coronal and axial slices revealed that the dentigerous cyst was ... panoramic slice of the anterior mandible shows a well-defined radiolucent area encompassing both impacted mandibular canine crowns with no separation The border of the radiolucent area appears ... left mandibular canine A cone-beam computed tomography scan was ordered and made one month later (iCAT Imaging Sciences, Hatfield, PA, USA) using a 17cm × 16cm × 17cm field of view to evaluate...
- 4
- 316
- 0
Báo cáo y học: "Fibrous dysplasia of bone associated with softtissue myxomas as well as an intra-osseous myxoma in a woman with Mazabraud’s syndrome: a case report" pptx
... radiology-based diagnosis However, histopathological confirmation is always mandatory Histopathologically, the characteristics of fibrous dysplasia and intra-muscular myxoma are as described in this case ... Multiple intramuscular myxomas: another extraskeletal manifestation of fibrous dysplasia Cancer 1971, 27:1167-1173 Okamoto S, Hisaoka M, Ushijima M, Nakahara S, Toyoshima S, Hashimoto H: Activating ... this article as: van der Wal et al.: Fibrous dysplasia of bone associated with soft-tissue myxomas as well as an intra-osseous myxoma in a woman with Mazabraud’s syndrome: a case report Journal...
- 7
- 590
- 0
báo cáo khoa học: "Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report" pps
... 30353, AlKhobar, 31952, Saudi Arabia 2Radiology Department, Saad Specialist Hospital, Prince Faisal Bin Fahed Street, P.O Box 30353, AlKhobar, 31952, Saudi Arabia Authors’ contributions HE analyzed ... antagonists and neuropathy Journal of Muscle Nerve 2008, 37(3):281-292 Ravaglia S, Corso A, Piccolo G, Lozza A, Alfonsi E, Mangiacavalli S, Varettoni M, Zappasodi P, Moglia A, Lazzarino M, Costa A: Immune- ... was done and showed bilateral normal retinochoroidal thickness and bilateral normal optic nerve thickness Magnetic resonance imaging (MRI) of the brain and brain stem with and without contrast...
- 4
- 268
- 0
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx
... literature As health care providers, physicians should be aware of this rare but life-threatening complication of PEG-IFNa 2a treatment Abbreviations AA: aplastic anemia; AIHA: autoimmune hemolytic anemia; ... Sabaghi F, Talebian A: Association of aplastic anaemia and Fanconi’s disease with HLA-DRB1 alleles Int J Immunogenet 2008, 35:453-456 19 Ramos-Casals M, Garc a- Carrasco M, López-Medrano F, Trejo ... nausea, anorexia, diarrhea, psychiatric symptoms, alopecia, injection-site reactions, leukopenia, thrombocytopenia, hemolytic anemia, cough, dyspnea, rash, pruritus, insomnia, and ataxia, have...
- 5
- 352
- 0
Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf
... proof reading of the manuscript RSY has approved the final manuscript All authors have read and approved the final manuscript Acknowledgements Discussion Ranitidine is a H2 receptor antagonist ... not find any association between allergies to metronidazole and buscopan and the development of an anaphylactic reaction to ranitidine Consent was obtained from the patient for publication of ... widely used for acid peptic disease and usually well tolerated Anaphylactic reaction to ranitidine is rare and only a few cases have been reported in the literature Most of the patients reported...
- 2
- 318
- 0
Báo cáo khoa hoc:" Papillary carcinoma arising in a thyroglossal duct cyst with associated microcarcinoma of the thyroid and without cervical lymph node metastasis: a case report" pot
... anterior part of the neck between the thyroid cartilage and hyoid She was in good health otherwise and her past medical history was unremarkable A cervical ultrasound showed a lesion which appeared ... given as an adjuvant treatment The patient has been following without any metastasis for two years Discussion A mass in the neck is a common clinical finding and differential diagnosis may be ... cancer [9] In our case, we made a radical surgical method with total tyroidectomy and bilateral neck dissection due to findings on cervical CT Dedivitis RA, Guimareas AV: Papillary thyroid carcinoma...
- 3
- 311
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25