caused by a mutation in the enzyme glucokinase gck
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... preserved because the patient had hemoperitoneum In addition, the remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy ... of a monolayer of inner circular muscle, which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, ... supply the mucosa and submucosa of the colon, penetrate the circular muscle The weakness of the vascular portals in the circular muscle possibly causes mucosal herniation into the subserosa [8]...
- 3
- 531
- 0
Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf
... with increasing concentration of TMPTMA up to 15 phr Therefore, in order to obtain PVC having the highest , 0.4 phr of DAPC and phr of TMPTMA can be used in the material Table 2: Linear thermal ... crosslinked by DAPC and TMPTMA is higher than that of the uncrosslinked samples It reflects an useful increase in service temperature of the material At any concentration of TMPTMA, a maximum glass transition ... between the uncrosslinked - and crosslinked PVC samples is 16oC Among the samples crosslinked by DAPC and TMPTMA, the sample containing 0.2 phr of DAPC and 15 phr of TMPTMA has the minimum softening...
- 5
- 377
- 0
Báo cáo y học: " Prediction of conformational changes by single mutation in the hepatitis B virus surface antigen (HBsAg) identified in HBsAg-negative blood donors" ppsx
... the a determinant loop Methionine, Alanine, Leucine, Isoleucine, and Valine are amino acids with non-polar, aliphatic side chains, while Threonine and Aspargine have a polar although uncharged ... result in increased number of variants circulating within individuals as well as in the population [2,32] The composition of variants in the viral population is maintained by its environment Variants ... participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
- 9
- 328
- 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine ... statistical analysis and drafting of the manuscript TR participated in the design of the study, patient recruitment, statistical analysis and drafting of the manuscript All authors read and approved ... of the manuscript FD and VC participated in the ADMA analysis DK participated in the design of the study and drafting of the manuscript RM participated in the design of the study, genotype analysis,...
- 7
- 265
- 0
Báo cáo sinh học: " A mutation in the MATP gene causes the cream coat colour in the horse" pot
... CCATGTCACCCCTTTCATTC CCAGGTTGCCCACTGTTGCC GGTAGTGGAGGCCCTTCTCC id CAACTCATTCATGTTTTAAC id CAACTCATTCATGTTTTAAC TGCTGACCGAAGGAAGAAG id AAACCTATCACCAGAATTAAC id AAACCTATCACCAGAATTAAC GGCTCTGTACCTCAACGGGG ... GCCCAAAAGATCCACGGGCAGGCTCGTCATGCACAGCATGGCCATGTTCGGCCGGGAATTTTGCTACGCGGTGGAGGCGG CCCAAGAGATCCACAGGGAGACTTGTCATGCACAGCATGGCCATGTTTGGCCGAGAGTTTTGCTATGCGGTGGAGGCAG GCCTAAAAGACCCACCAGCAGACTCATCATGCACAGCATGGCCATGTTCGGAAGAGAGTTCTGCTACGCGGTGGAGGCAG Cr q CCTACGTGACCCCAGTCCTGCTCAGCGTGGGCCTGCCCAAGCGTCTGTACAGCGTGGTGTGGCTGCTCAGTCCCGTCCTG ... GGGCCCATCAAAGCCTACTTATTTGATGTCTGCTCCCATCAGGACAAGGAGAGGGGCCTCCACCACCACGCTCTCTTCAC GGGCCCATCAAAGCCTACTTATTTGATGTCTGCTCCCACCAGGACAAGGAGAAGGGCCTCCACTACCATGCCCTCTTCAC GGGCCCATCAAAGCCTACTTATTTGATGTCTGCTCCCATCAGGACAAGGAGAAGGGCCTCCACTACCATGCCCTCTTCAC...
- 15
- 178
- 0
Báo cáo sinh học: "A mutation in the LAMC2 gene causes the Herlitz junctional epidermolysis bullosa (H-JEB) in two French draft horse breeds" doc
... γ2 mRNA could be explained by the degradation of mRNA containing a premature termination codon via the “nonsense-mediated mRNA decay pathway” [12,16,17] The identification of the causal mutation ... euthanised in general a few days after birth The histological analyses of the skin were performed in a single anatomo-pathology laboratory (Laboratoire d’anatomie pathologique vétérinaire, Amboise, ... reading frame and generates a premature termination codon The truncated γ2 subunit lacks its C-terminal domain that mediates the interaction with the two other subunits, α3 and β3, of laminin...
- 8
- 215
- 0
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx
... interface of alpha and beta chains of the Hb tetramer Several hemoglobin variants have substitutions affecting this interface All these substitutions can affect the cooperative nature of oxygen binding ... Hemoglobin 2005, 29:91-106 Giardine B, van Baal S, Kaimakis P, Riemer C, Miller W, Samara M, Kollia P, Anagnou NP, Chui DH, Wajcman H, Hardison RC, Patrinos GP HbVar database of human hemoglobin variants ... (http://globin.bx.psu.edu/hbvar/menu.html accessed on May 04, 2007) [15] All these Hb variants are inherited in an autosomal dominant manner High affinity Hb variants release oxygen in the tissue relatively...
- 5
- 418
- 0
Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt
... Carotenoid and retinal biosynthesis in Fusarium fujikuroi The pathway involves CarRA, CarB, the cleaving oxygenases CarX and CarT, and a postulated dehydrogenase CarD Desaturations introduced by the CarB ... primers CarBG-2F (5¢-TGGGCGAGCTCATGAGCGACATTAAGAA ATCTG-3¢) and CarBG-3R (5¢-CGCTCAGAACGACA CCGTTTG-3¢) The presence of the carB36 mutation was checked using a FokI (Takara Shuzo, Kyoto, Japan) restriction ... following the manufacturer’s instructions Two microlitres of cDNA were used for the amplification of carB using the primers 5¢-ATGAGCGACATTAAGAA ATCTG-3¢ and 5¢-CTAATTCGCAGCAATGACAAG-3¢ The PCR was performed...
- 16
- 440
- 0
DSpace at VNU: Negative absorption coefficient of a weak electromagnetic wave caused by electrons confined in rectangular quantum wires in the presence of laser radiation
... expression, the ACF of a weak EMW in the absence of laser radiation in a RQW can be obtained by setting E01 = The ACF is numerically calculated for the specific case of a GaAs/GaAsAl RQW Computational ... shows that the ACF of a weak EMW has many maxima (peaks) These results show that under the in uence of laser radiation, the ACF of a weak EMW in a RQW can have negative values Thus, in the presence ... expression for the ACF of a weak EMW in the presence of laser radiation in a RQW and to show clearly that the ACF can have negative values, in this section, we numerically calculated the ACF for the specific...
- 7
- 111
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... Fig 3A showing only the rates obtained in the absence of a Du In this case, the impairment of the ATP synthesis rates in the mutant was higher than twofold, especially in the low DpH range Again, ... We have introduced the single point mutation aGlu210 fi Lys and have investigated detailed functional aspects of the ATP synthase in native membranes The corresponding mutation in the E coli enzyme, ... concentration in each sample was measured in a luminometer (LKB 1250) with the ATP-Monitoring Kit (Bioorbit) The small amount of ATP synthesized in the dark (due to the adenylate kinase reaction) was...
- 9
- 580
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... was set by the addition of small amounts of concentrated HCl or NaOH, and was in the range 6.5– 9.5 The rate of enzymatic activity was determined by monitoring the initial linear increase in absorbance ... G-3¢ and 5¢-GAGAGCTCGAGAACAGAACTTCAAGAC CGTGGCAGGAGC-3¢ The NcoI and XhoI sites used for further cloning are shown underlined The amplified DNA was first cloned into pGem-T Easy (Promega, Madison,...
- 9
- 327
- 0
Báo cáo "The dependence of the nonlinear absorption coefficient of strong electromagnetic waves caused by electrons confined in rectangular quantum wires on the temperature of the system" doc
... ) and length Lz , embedded in GaAlAs The carriers (electron gas) are assumed to be confined by an infinite potential in the ( x, y ) plane and are free in the z direction in Cartesian coordinates ... Numerical results obtained for a GaAs/GaAsAl CQW show that α depends strongly and nonlinearly on the temperature T of the system As the temperature increases the nonlinear absorption coefficient increases ... on the temperature T of the system As the temperature increases the nonlinear absorption coefficient increases until it reached the maximum value (peak) and then it decreases At different values...
- 6
- 414
- 2
Báo cáo khóa học: Modulation of activity of NADH oxidase from Thermus thermophilus through change in flexibility in the enzyme active site induced by Hofmeister series anions ppt
... presence of chaotropic agents, and the active site of the enzyme opened, facilitating the arrival of the substrate and leading to an increased rate constant and an increased Michaelis constant To test ... in the substrate-binding site leads to the increase in Km, i.e a decrease in the affinity of the enzyme for the substrate The decrease in kcat, however, can be only partially explained by the ... donor/substrate and the acceptor/flavin cofactor in the hydride transfer and/or other side chains with an active role in the catalytic site of NADH oxidase Modulation of the conformational dynamics by the...
- 10
- 316
- 0
STUDY ON EPIDEMIOLOGICAL FEATURES, APPLICATION OF DIAGNOSTIC KIT FOR DETECTION OF TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN CATTLE AND BUFFALOES IN A FEW NORTHERN MOUNTAINOUS PROVINCES AND RECOMMENDATION FOR PREVENTIVE AND TREATMENT MEASURES
... (using trypamidium samorin) in treating trypanosomiasis in buffaloes and cattle During the treatment let the affected animals stay in their stable for - days and having good feeding ring and management ... Silva A S (2010) indicate that clinical signs in trypanosome infected buffaloes and cattle include falling and rising fever, emaciation, anemia, edema, corneal inflammation, swelling of the testes ... outbreak of trypanosomiasis and mortality rates of buffaloes and cattle in Winter and Spring Exterminating sucking flies and gad flies that transmit tripanosomiasis - Exterminating flies and gad...
- 14
- 590
- 0
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx
... repivarin, fondaparinux, and enoxaparin requires dose reductions in patients with renal impairment Because of increased intracranial bleeding risk (41), enoxaparin is also given in reduced doses in ... strategy is supported by recent registry data (82-84) and study data (85) Facilitated PCI In contrast to pharmacoinvasive therapy, the strategy of facilitated PCI relies on the idea that early initiation ... Association Task Force on Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction: a report of the American College...
- 12
- 323
- 1
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... profound bilateral sensorineural hearing impairment on audiograms Careful medical examinations revealed no clinical features other than hearing impairment DNA was extracted from the peripheral blood ... Najmabadi H, Nishimura C, Kahrizi K, Riazalhosseini Y, Malekpour M, Daneshi A, Farhadi M, Mohseni M, Mahdieh N, Ebrahimi A, Bazazzadegan N, Naghavi A, Avenarius M, Arzhangi S, Smith RJ: GJB2 mutations: ... DJ, Pandya A, Siemering KR, Chamberlin GP, Ballana E, Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat M, Abeliovich D, Dahl HH, Estivill X, Gasparini P, Hutchin T, Nance WE, Sartorato...
- 7
- 695
- 0
Báo cáo sinh học: "Post-ERCP bacteremia caused by Alcaligenes xylosoxidans in a patient with pancreas cancer" pps
... imipenem, piperacillin/tazobactam and trimethoprim/sulfametoxazole and resistant to the third generation cephalosporins with the exception of the cefoperazone/sulbactam, amikacin and tobramycin In previous ... as a source of infection but any environmental contamination couldn't be indicated Thatthe patient had symptoms of infection one day after ERCP made us think that the infection was from the intestines ... it was reported that A. xylosoxidans was resistant to most of the antimicrobial agents [15,17,18] In summary, the post-ERCP bacteremia caused by A. xylosoxidans was presented in a 70-year-old man...
- 3
- 400
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... from the prolactine producing pituitary adenoma, the hyperplasia of the parathyroid glands and the well-differentiated non functioning pancreatic endocrine carcinoma, functioning bilateral adrenocortical ... tumor in the body and tail of the pancreas and (iv) functioning bilateral adrenal tumors, was established The patient was submitted to an exploratory laparotomy through a bilateral subcostal incision ... 89:143-150 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial isolated primary hyperparathyroidism...
- 7
- 412
- 0
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc
... histological features of lobular carcinoma and infiltrating ductal carcinoma The family history suggested LFS: the patient's father was diagnosed with dorsal soft tissue leiomyosarcoma at the age of ... compared with the following three databases: International Agency for Research on Cancer (IARC) database; the Human Gene Mutation Database (HGMD), and the P53 Knowledgebase [11,19,20] Cloning ... we searched for the specific alteration in the index patient's father and two halfsisters (paternal side) This mutation was also detected in the father, as well as in patient III-1 (III-2 was wild-type)...
- 7
- 403
- 0
Báo cáo y học: "A polymorphism in the human serotonin 5-HT2A receptor gene may protect against systemic sclerosis by reducing platelet aggregation" potx
... hypothesis would confirm previous findings indicating that 5-HT is more relevant in the maintenance of the vascular phenomena that underlie the pathogenesis of SSc, rather than in determining their ... functional role of a naturally occurring amino acidic substitution of the 5-HTR 2A gene in a population of Italian SSc patients The 5-HT concentrations are increased in plasma samples from SSc [16] as ... final concentration Platelet aggregation was recorded for minutes and the maximum light transmission in this period was measured The response to 5-HT was then calculated as the fold increase in...
- 7
- 411
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008