build upon the history of the founder s experience with her prior firms to effectively position the consulting firm as a leader in environmental compliance information and consulting for technology products

Tài liệu The History Of England, Volume I, Part Viby From Charles Ii To James Ii (illustrated Edition) (dodo Press) By David Hume ppt

Ngày tải lên : 19/02/2014, 05:20

... king, was persuaded to abandon that party; and, as a reward for his compliance, was created archbishop of St Andrews The conduct of ecclesiastical affairs was chiefly intrusted to him; and as ... his gratitude towards many of that persuasion, on account of their faithful services in his father s cause and in his own A proclamation, for form s sake, was soon after issued against Jesuits ... invisible leader At length, the magistrates, having assembled some train bands, made an attack upon them They defended themselves with order as well as valor; and after killing many of the assailants...

422
608
0

The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

Ngày tải lên : 22/03/2014, 11:20

... rise of transnational corporations that can easily shift investments across the globe serves to pressure nations into acceding to their demands for changes that reverse reforms associated with the ... caregivers and by-pass the public system There is no general assistance for caregivers but an Invalidity Care Allowance is available to caregivers of disabled citizens US: The US health insurance system ... increasing income and wealth inequalities and the weakening of social infrastructures within Canada and elsewhere as resulting from the ascendance of concentrated monopoly capitalism and corporate...

17
843
0

WORKING PAPER SERIES NO 1471 / SEPTEMBER 2012: FEEDBACK TO THE ECB’S MONETARY ANALYSIS THE BANK OF RUSSIA’S EXPERIENCE WITH SOME KEY TOOLS pdf

Ngày tải lên : 22/03/2014, 21:20

... is part of the analytical work in the area of monetary analysis At this stage the aspects of monetary analysis related to extracting information from monetary developments in order to assess the ... prices in Russia in 2005-2007 could have positively affected transactions demand for money as transactions in asset markets increased The increase in wealth due to the growth of asset prices may also ... organizations and households) in the Banking System Survey This information provides a basis for further enhancing of monetary analysis by using the data on sectoral money holdings See also “Sectoral...

63
659
0

Báo cáo y học: " Axial torsion as a rare and unusual complication of a Meckel’s diverticulum: a case report and review of the literature" ppsx

Ngày tải lên : 11/08/2014, 00:23

... cm flange of ileum that was encompassed within the vascular territory of the inflamed, unhealthy, and friable mesentery An end -to- end seromuscular, single-layered anastomosis using a 4-0 synthetic ... of the MD In cases where there is a greater degree of torsion, there is also a greater vascular compromise to the MD [2] This risks infarction and perforation, which are associated with greater ... MD, such as lipomas, have also been recognized as a potential cause of torsion [12] Complications associated with this presentation include intussusception, with the tumor as the lead point,...

4
441
0

Tài liệu Báo cáo " Study on Monte-Carlo calculation of peak efficiencies of the superpure Hp Ge detector (Gmx) in environmental gamma spectrometry with using MCNP4C2 " pptx

Ngày tải lên : 13/02/2014, 04:20

... electrons and secondary photons created in these interactions are also tracked until all of their energy has been dissipated in the various materials or escaped out of the physical space included in the ... geometry in the front of the detector on it s axis at the source-detector distance of 25 cm with using the various assumed values of the dead layer thickness and compared the obtained calculating results ... plexyglass plate having the radius of cm The plexyglass plate is located in front of the detector on it s axis at the source-detector distance of 2.95 cm The results of modeling calculations are shown...

6
463
0

Tài liệu The Value of the Case Study as a Research Strategy doc

Ngày tải lên : 20/02/2014, 11:20

... describes cases with a single source of information as holistic cases, cases with multiple sources of information as embedded cases He cautions that embedded cases may be mistakenly classified as holistic ... underlying the case study itself is of a holistic nature Case studies may either focus on a single case or use a number of cases: A single case may form the basis of research on typical, critical ... if other researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained to \allow...

15
587
0

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Ngày tải lên : 07/03/2014, 15:20

... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as the ... lethality of a Dras1 Dras2 strain In order to investigate the interaction of Sut2p with the Ras/cAMP pathway, we constructed a strain (denoted as MR349) that was deleted for both RAS genes This ... processes in Dgpa2 Dras2 cells, as it was not possible to propagate these cells without a suppressorplasmid, such as p426MET25-RAS2 When Dgpa2 Dras2 cells were grown without a suppressor-plasmid,...

8
485
0

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21

... merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae ... recombinant proteins were used for preparation of the antibodies against red algal PsbQ¢, PsbV and PsbU, cyanobacterial PsbU and green algal PsbQ The antibodies against spinach PsbP and PsbQ were ... was detected in diatoms, haptophyte and brown algae The psbP gene was found in P tricomutan but not in T pseudonana, suggesting that the psbP gene was lost at least in some algae of the red lineage...

11
501
0

Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot

Ngày tải lên : 18/06/2014, 16:20

... the carrier rate was significantly low in the normal hearing controls, were calculated, the rate was increased to 5.5% b) Additionally, about 13% of patients had moderate hearing loss, whereas ... subjects prior to blood sampling The parents of pediatric patients were interviewed with regard to age of onset, family history, mother s health during pregnancy, and patient s clinical history, including ... regions followed by Big Dye sequencing and analysis using ABI 3100 DNA sequencing machine (ABI, Foster City, USA.) and ABI 3100 Analysis Software v.3.7 NT according to manufacturer s procedures Results...

7
695
0

báo cáo hóa học:" Multiple functions of the von Willebrand Factor A domain in matrilins: secretion, assembly, and proteolysis" ppt

Ngày tải lên : 20/06/2014, 01:20

... the MIDAS motif in MATN-1 abolish its ability to form pericellular filamentous network [9] This indicates that one of the functions of the vWF A domain of matrilins is to act as an adhesion site ... sets (Table 1) These modified cDNAs were cloned to pcDNA3.1 in a similar fashion The sequence of all the inserts was confirmed by DNA sequencing Transfection of Matrilin cDNAs cDNA constructs ... these residues are conserved in all matrilin family members across species, they are not part of the MIDAS motif [13] This suggests that these residues in the vWF A domain may play other important...

13
382
0

The phrase Phrase as a group of words, which makes sence, but not complete sense,

Ngày tải lên : 13/07/2014, 23:26

... of a noun and all it modifies Ex: The senile old man disease Many case of infectious A story as old as time The Phrase A noun phrase: A noun phrase consits of a noun and all it modifies Ex: The ... words in underline are phrases in examples below: The sun rises in the east Peter sat on a wall The girl with red hair is an artist The Phrase There are five commonly occurring types of phrase in ... English: Noun phrase Adjective pharse Verb phrase Adverb phrase Preposition pharse The Phrase There are five commonly occurring types of phrase in English: A noun phrase: A noun phrase consits of...

9
512
0

Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx

Ngày tải lên : 07/08/2014, 16:20

... bypass the frost itself in a way, as its characteristics are always difficult to define accurately at the tree scale This type of experiment also has the advantage that the relative risks can be calculated ... exactly In the case of other late frosts, these characteristics may vary widely and so may lead to the same or other damage, which is even more severe As a result of this study, we only possess ... factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical and a causal value, i.e functional and more precisely morphogenetic...

8
348
0

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Ngày tải lên : 09/08/2014, 01:23

... potential of T effector cells The fact that the same stimulatory signal leads neither to the release of cytotoxic effector molecules from CTLs, such as perforin and R441 Arthritis Research & Therapy ... respond to these signals, migrate to the joint, breach endothelial barriers, infiltrate the inflamed foci and sustain inflammatory processes by secreting cytokines in response to direct costimulation ... with the manufacturer 's instructions (IFN-γ, tumor necrosis factor-α and IL-6, cytokine sandwich ELISA; IL-4, OptEIA mouse IL-4 set) Statistical analysis Statistical significance was calculated with...

14
505
0

báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf

Ngày tải lên : 10/08/2014, 22:20

... information available From gross pathological examination, the mass was obviously unlikely for carcinomas, as tumors at this large size usually present as a bulky mass, often with necrosis, and ... radiation therapy, and the sites of sarcomas are usually soft tissue in origin Even though her history indicated that the biopsy diagnosis was high-grade urothelial carcinoma, the diagnosis was ... residual cervical dysplasia or neoplasm was detected All 12 lymph nodes showed no neoplasm The disease was clinically and pathologically staged as T4b N0 M0 After surgery, our radiation therapist...

6
493
0

báo cáo khoa học: "Dermatofibrosarcoma presenting as a nodule in the breast of a 75-year-old woman: a case report" pps

Ngày tải lên : 10/08/2014, 23:20

... quadrant of her left breast (Figures and 2) Echography confirmed the presence of a lesion measuring 14 × mm Based on imaging, the diagnosis was a probable angiosarcoma (Figures and 4) She has a history ... reconstruction with a prosthesis for invasive ductal carcinoma of her right breast, and now presented with a mass in her left breast Mammography showed a dish-shaped skin nodule in the upper outer quadrant ... is a rare neoplasm of soft tissues and its location in the breast is extremely uncommon Confusion is possible with other primary breast lesions Case presentation: A 75-year-old Caucasian woman...

8
295
0

Báo cáo y học: " Toxoplasmosis presenting as a swelling in the axillary tail of the breast and a palpable axillary lymph node mimicking malignancy: a case report" potx

Ngày tải lên : 10/08/2014, 23:22

... cytology of needle aspirate [6] and serological tests are important in the diagnosis of toxoplasmosis and it was not until both were available in this case that a diagnosis of toxoplasmosis was ... Conclusions Toxoplasmosis rarely presents as a mass in the axillary tail of the breast and may be considered as a differential diagnosis in patients presenting with axillary lymphadenopathy FNAC and ... obligate intracellular parasitic protozoa The infection produces a wide range of clinical syndromes in humans, land and sea mammals, and various bird species Toxoplasmosis passes from animals to...

4
399
0

Báo cáo y học: "Dermoid cyst of the urinary bladder as a differential diagnosis of bladder calculus: a case report" pps

Ngày tải lên : 11/08/2014, 10:23

... diagnosis of bladder mass, and the patient as well as the Figure Sweat glands, hyalinized fibroblastic tissue Sweat glands, hyalinized fibroblastic tissue Page of (page number not for citation purposes) ... midline position of the bladder mass in this patient was suggestive of a dermoid cyst Histology confirmed skin, skin adnexial structures (sweat glands, hair follicles) adipose tissue and fibroblastic ... skin tissue consisting of stratified squamous epithelium, papillary and reticular dermis, skin adnexial structures including sweat glands and hair follicles Interspersed between were lobules of...

3
231
0

Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps

Ngày tải lên : 11/08/2014, 12:20

... popliteal fossa, performed to accurately assess the relations of the cysts to the surrounding structures and to exclude any other pathology, additionally showed involvement of his genicular arteries ... diagnosis in young patients presenting with claudication, particularly if there are no risk factors for peripheral vascular disease Our report raises the possibility that the extension of CAD to ... with percutaneous transluminal angioplasty Vasc Endovascular Surg 2009, 43(4):399-402 12 Khoury M: Failed angioplasty of a popliteal artery stenosis secondary to cystic adventitial disease: a...

4
333
0

Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot

Ngày tải lên : 11/08/2014, 14:21

... detected after a time of exposure to EFV as short as three weeks The K103N bearing strain persisted as the dominant quasispecies for over three years in the absence of any further drug pressure, as ... in the Infectious Disease Unit, for assistance with this case report We are also indebted with Mr Paolo De Cono, for assistance with laboratory assays Dr E Polilli was funded by an educational ... transmission Table GRT of proviral and plasma HIV, as interpreted by the Stanford HIV database algorithm (as of March, 2006) HIV-DNA resistance mutations HIV-RNA resistance mutations PI Major Resistance...

5
427
0

Báo cáo y học: " Double rupture of interventricular septum and free wall of the left ventricle, as a mechanical complication of acute myocardial infarction: a case report" pot

Ngày tải lên : 11/08/2014, 23:21

... grafting applied to the LAD and saphenous vein bypass grafting to the obtuse marginal branch) LV cavity to Doppler showing a systolic flow (SF) from the Pulsed wave the pseudoaneurysm and a diastolic ... resonance imaging (MRI) is also a useful tool for the confirmation of diagnosis, particularly when there is a pseudoaneurysm Before the 198 0s, there was a vogue for managing patients with cardiac ... patients [14] Conservative measures such as diuretics, inotropes, nitroprusside and intraaortic balloon counterpulsation are used for the initial stabilization of these patients, as a bridge to surgery...

5
280
0