ber function of the signal to noise ratio in a gaussian channel
báo cáo hóa học: " Effects of the physiological parameters on the signal-to-noise ratio of single myoelectric channel" doc
... signal- to- noise ratio (SNR), defined as the ratio of the amplitude of a desired signal to the amplitude of noise, can be used as a measure of the quality of an ME signal processor Root-mean-square, ... as the ratio of the MSV estimation at the channel output and the variance of the estimation The definition of SNR in this study is the same to that in Zhang's investigation [5], as shown in Eq.1 ... over to level off at rmax = 1/tarp The MUAP is another key factor in the ME channel Generally it is the summation of action potentials generated by the simultaneously activated muscle fibers in the...
- 10
- 387
- 0
Báo cáo hóa học: " Research Article A Multiuser MIMO Transmit Beamformer Based on the Statistics of the Signal-to-Leakage Ratio" doc
... Model -Gaussian Angle of Arrival (AoA) In this example, the spatial correlation among elements of the BS antenna array is modeled according to the distribution of the AoA of the incoming plane waves at the ... often the transmit beamformer is not capable of maintaining the ratio of the signal power to the leakage power above a certain threshold value The outage probability for the ith user is defined as ... channel information can be available at the BS only through the feedback from users The drawbacks of the feedback approach are the reduction of the system capacity because of the frequent channel...
- 10
- 317
- 0
Báo cáo vật lý: "Influence of the Silica-to-Surfactant Ratio and the pH of Synthesis on the Characteristics of Mesoporous SBA-15" ppt
... are available in the literature.10,11 It is reported that the ratio of the silica source to the surfactant ratio and the pH of the synthesis gel can greatly influence the characteristics of the ... varying the TEOS/TCP ratio but maintaining the pH value at 1.7 In each sample, the presence of micropores and mesopores was observed The total micropore area was lower than that of mesopores, indicating ... microporosity also decreases the surface area Influence of the Silica -to- Surfactant Ratio and pH 20 With the increase in the size of micelles, a corresponding increase in the pore size generally results.23...
- 15
- 571
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the ... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), ... days of the last instar nymph spreads into the oocyte cytoplasm (Fig 5), albeit towards the mid-instar, concomitantly with a steady increase in BgVgR protein levels (Fig 4), begins to accumulate...
- 11
- 414
- 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was conserved Significantly, typical c-cytochrome a and b maxima not appear ... can bind and catalyze the transformation of NH2OH The relevance of the lysyl-heme crosslink to catalysis is supported here by the lack of catalytic ability in mutant cytochromes P460 lacking the...
- 7
- 384
- 1
The leg-to-body ratio as a human aesthetic criterion pdf
... of the ANOVA results and the main effects of stimuli sex, LBR and their interactions are shown in Table Table ANOVA results with the main effects of leg -to- body ratio (LBR), stimuli sex and their ... Results A Â Â repeated measure analysis of variance (ANOVA) with 71 participants was computed The sex of the stimuli and LBR were treated as within subjects factors, and participant gender was treated ... suggesting that both male and female participants were rating the images in the same manner Discussion The results of this investigation are consistent with the idea that the LBR plays a role in...
- 7
- 408
- 0
Báo cáo y học: "Longitudinal evaluation the pulmonary function of the pre and postoperative periods in the coronary artery bypass graft surgery of patients treated with a physiotherapy protocol" ppt
... respiratory muscles for seconds [10] To measure the MEP, participants were instructed to deeply inhale up to the TLC, a forced exhalation (Valsalva maneuver) and maintain the strain with their ... coughing, from postoperative days to (Table 1) Statistical analyses Statistical analysis was performed in Statistica version 7.0 (Stasoft Corporation, Tulsa, USA) Sample size was calculated and ... oropharynx To measure the MIP, individuals were instructed to exhale up to the RV, inhale deeply with the manuvacuometer’s mouthpiece (Müller’s maneuver) in place and maintain the strain with their...
- 6
- 471
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... telomeres are uncapped in the absence of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects...
- 17
- 432
- 0
Design of LCL filters for the back to back converter in a doubly fed induction generator
... (10) Transfer function in (8) has a pair of poles located at the imaginary axis The imaginary poles will cause oscillation to the system, which requires the filter to be damped to avoid resonance ... rated at 2.5MW with a 690V voltage (line to line, 50Hz) The stator rotor turns ratio is 0.3, and other parameters are listed in the Appendix The converter dc-link capacitor is 20,000uF, the dc-link ... Damping resistors are widely used to increase the stability of the system due to its simplicity and reliability Studies have shown that the greater the damping resistor, the better resonant inhibition...
- 6
- 573
- 0
variation of the germinable soil seed banks in a pasture infested by parthenium hysterophorus l.at kilcoy, south-eastern queensland
... introduced into new locations as seed, it has now spread over many regions of East and South Africa, parts of South East Asia, to certain Pacific Islands, to India, Pakistan, and Australia It has spread ... bunks, railway tracks, bus stops on road sides and other waste lands (Mahadevappa 1999) Parthenium weed has also spread into Trinidad, Guyana, Jamaica, Nepal, Israel, South Korea, Taiwan, North ... its main growth season in Australia is summer, coinciding with the abundance of rainfall Soil moisture is also a contributing factor affecting the duration of flowering (Navie et al 1998b) Although...
- 100
- 313
- 0
báo cáo hóa học:" Validation of the Rasch-based Depression Screening in a large scale German general population sample" doc
... the manuscript MB participated in the analysis and interpretation of the data MW participated in the design of the study and the statistical analysis HG and EB participated in the design of the ... study and coordinated the data acquisition CN contributed to the analysis and interpretation of the data SG have been involved in drafting and revising the manuscript, and coordinated the study and ... Unidimensionality and local independence To evaluate unidimensionality and local independence the residual correlation matrix was examined A principal component factor analysis of the residuals (PCFAR)...
- 8
- 544
- 0
Báo cáo lâm nghiệp: "Effect of leaf biomass and phenological structure of the canopy on plot growth in a deciduous hardwood forest in northern Japan" pot
... 726 M Takiya et al Table I Stem number and basal area in the study plots Thinning was performed in 1984 Values (stem number and basal area just before and after thinning and thinning ratio) are ... LB1: biomass of leaves falling from May to September; LB2: biomass of leaves falling from October to November a Plot basal area measured at the beginning of the 2-year intervals (m2 ha−1 ); b ... Annual leaf biomass was calculated by summing monthly leaffall To quantify the phenological pattern of leaffall and the corresponding phenological structure of the canopy, annual leaf biomass was...
- 8
- 347
- 0
Báo cáo khao học: "Dominance of the mycorrhizal fungus Rhizopogon rubescens in a plantation of Pinus pinea seedlings inoculated with Suillus collinitus" ppsx
... TTT.GAGATA AAAGTTA.TT TTCCGAGATA AAAGTTAATT TCT.GAGATA AAAGTTAATT 300 CGCATCGATG AAGAACGCAG CGCATCGATG AAGAACGCAG CGCATCGATG AAGAACGCAG 350 TCTACAGTGA ATCATCGAAT TCTACAGTGA ATCATCGAAT TCTACAGTGA ATCATCGAAT ... TCCTTGA CTCGGG.CTC 550 TCGACTTTGC GCGACAAGGC TCGACTTTGC GCGACAAGGC TCGACTTTGC GCGACAAGGC 600 AAGCGCATGA ATGAAG.GTT AAGCGCATGA ATGAAG.GTT AAGCGCACGA ATGAAATGTT 650 CTTCCGAGAG AAAACGTCTT CTTAGNAGAG AAAACGTCTT ... ACAACTTTCA GCAATGGATC TCTTGGCTCT 301 R rubescens (AJ277644) CGAAAAGCGA TATGTAATGT GAATTGCAGA ITS RFLP type I (AJ277645) CGAAAAGCGA TATGTAATGT GAATTGCAGA R rubescens (AF158018) CGAAAAGCGA TATGTAATGT GAATTGCAG...
- 8
- 267
- 0
Báo cáo khoa học: "Measurement and modelling of the photosynthetically active radiation transmitted in a canopy of maritime pine P Hassika" doc
... figure The increase in the canopy PAR reflectance at the beginning and at the end of the day is due to the interception of the top of the plant canopy For this day the average PAR reflectance above ... shows the different terms of the radiation balance in the PAR above and below the canopy for clear weather (day 193) as a function of the hour of the day The transmission of the incident PAR varies ... photosynthetically active radiation (PAR) intercepted and the combined effects of water vapour concentration and air temperature Internal CO concentrations in the intercel2 lular spaces of the...
- 16
- 299
- 0
Báo cáo y học: ":Evaluation of the Patient Acceptable Symptom State in a pooled analysis of two multicentre, randomised, double-blind, placebo-controlled studies evaluating lumiracoxib and celecoxib in patients with osteoarthritis" pptx
... satisfied according to PASS Assessment of patient satisfaction by means of the PASS criteria can be approached in a number of ways: satisfaction at the end of a study period, time taken to achieve ... data on patient satisfaction according to PASS during and at the end of the study period and on patient achievement of sustained satisfaction by PASS Materials and methods A pooled analysis of ... variables – OA pain, patient's global assessment of disease activity, and WOMAC™ LK 3.1 Function – was originally estimated using the least square means obtained from an analysis of covariance...
- 11
- 455
- 0
Báo cáo y học: " A cross-sectional testing of The Iowa Personality Disorder Screen in a psychiatric outpatient setting" pot
... helped to draft the manuscript AAD participated in the design, performed statistical analyses and helped to draft the manuscript of the study All authors have read and approved the final manuscript ... GAF-S as measures of psychopathology and the GAF-F as a measure of function as well as the IPDS were significantly associated with the presence of PDs in bivariate analysis A new finding is that ... months are different from the way they usually are The IPDS was translated and back-translated into Norwegian by the last author with permission from Bruce Pfohl, MD Adaption of the IPDS into a selfadministered...
- 8
- 332
- 0
Báo cáo y học: " Simultaneous monteggia type I fracture equivalent with ipsilateral fracture of the distal radius and ulna in a child: a case report" docx
... dislocation of the radial head; proximal ulna fracture with post-dislocation of the radial head; fracture of the proximal radius and ulna with dislocation of the radial head Three Monteggia equivalent ... angulation of the fracture with anterior dislocation of the radial head; the second most common is fracture of the proximal third of the ulna, lateral angulation of the fracture and lateral dislocation ... [7], the child sustained three epiphyseal fractures (distal radius and ulna and proximal radius) and a diaphyseal (mid-shaft) ulnar fracture The authors explained the difficulty they had in attempting...
- 4
- 338
- 0
Báo cáo y học: " Evolution of the uniquely adaptable lentiviral envelope in a natural reservoir host" potx
... distances for each of the clones using the method of Tamura and Nei [94], and pairwise amino acid distances using the Gamma distance method in the program MEGA 2.1 [95] Average dN and dS were calculated ... region of envelope The gag region was amplified using shortgagF1 (5'TTAAGTCCAAGAACATTAAATGC-3') and shortgagR (5'GTAGAACCTGTCTACATAGCT-3') which correspond to bp 1493–1515 and 19371957 of SIVsmmH4, ... http://www.retrovirology.com/content/3/1/19 Table 2: Summary of intra-animal amino acid and nucleotide diversity and sequence length in V1V2 env Pairwise distances were calculated using the Gamma distance method with gamma shape parameter...
- 14
- 265
- 0
Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx
... 5'-AAGTGCAGAGTTCGATTCTGTACAA-3' Probe: 5'-CGGGTCACTGGGCGTCCACC-3' Reverse: 5'-GAACAACATGCATTCCGAGAAG-3' Forward: 5'-GCGCAGCGCGTTGAA-3' Probe: 5'-AACGAACAGTCATCACCACATCTCATCCAG-3' Reverse: 5'-GGATGGAGCTCGTCCAAGTG-3' ... treated according to the Principles of Laboratory Animal Care formulated by the U.S National Society for Medical Research and the Guide for the Care and Use of Laboratory Animals prepared by the ... 5'-GGATGGAGCTCGTCCAAGTG-3' Forward: 5'-GCCATCCTGACTATTTCACTGAAGA-3' Probe: 5'-AAGCCTACTTTTTCTCAAGGGCAGTCACCG-3' Reverse: 5'-GGGATGTACCCTTTTTTCTGAGAGT-3' Forward: 5'-TGTAGATTTTATCAGACTGAAGAGCTACTGT-3'...
- 10
- 378
- 0
MOTT TRANSITION OF THE HALF FILLED HUBBARD MODEL IN a TWO DIMENSIONAL FRUSTRATED LATTICE
... 74 Duc-Anh Le, Anh-Tuan Hoang Fig Hoppings in a two-dimensional frustrated lattice show that the frustrated system undergoes a metal-insulator transition at a certain critical value of the onsite ... energy, in the insulating regime U > UC , the imaginary part of the self-energy has a sharp peak whose weight is roughly independent of U The influence of the geometrical frustration on the critical ... extended as the geometrical frustration reduces the gap between the Hubbard bands The reduction of the gap implies that the critical correlation-driven metal-insulator transition Uc of the frustrated...
- 7
- 244
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25