average monthly withdrawals and discharges at permitted municipal and nonmuncipal water supply sources and wastewate

Báo cáo khoa học: "The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs" ppt

Ngày tải lên : 07/08/2014, 20:23

... Primer-F: CATTGCTGCTGGATTTACAGTTG MGB Probe: CGTAATTCTTAACTTCCTT Primer-R: AGCATCCTGGAGAGATCAGCAT NM213861 IFN-γ Primer-F: AGCTCTGGGAAACTGAATGACTTC MGB Probe: AATTCCGGTAGATAATCT Primer-R: TGATGAGTTCACTGATGGCTTTG ... with a UNG incubation step at 50 C and 10 o AmpliTaq Gold Activation at 95 C, followed by a 2o o step temperature cycling (15 sec at 95 C, at 60 C) and 35 cycles to complete polymerization Histology ... TGATGAGTTCACTGATGGCTTTG X53085 TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAG MGB Probe: TGTAGCCAATGTCAAAGC Primer-R: GGCATTGGCATACCCACTCT M29079 X54859 β-actin Primer-F: CGACGGGCAGGTCATCAC MGB Probe: CTGCGGCATCCACGA...

6
179
0

Báo cáo toán học: "Bounds for the average Lp-extreme and the L∞-extreme discrepancy" pptx

Ngày tải lên : 07/08/2014, 13:21

... coordinates: z = v − x − h and z = v − x + h If we translate edge points v and w, v ≤ w, of anchored boxes [0, v) and [0, w) by a vector a ≥ 0, then it is a simple geometrical observation that the ... talk at the Oberwolfach seminar “Discrepancy Theory and its Applications”, Report No 13/2004, Mathematisches Forschungsinstitut Oberwolfach [12] E Novak, H Wo´niakowski When are integration and ... (p/2, k, n) that appears there has to be substituted by the number T (p, k, n) deﬁned above) For that reason we state here the bounds for the average Lp -star discrepancy av∗ (n, d) that we get by...

11
208
0

Báo cáo toán học: "The asymptotic behavior of the average Lp−discrepancies and a randomized discrepancy" docx

Ngày tải lên : 08/08/2014, 12:22

... Random Variables (Proceedings of the Steklov Institute of Mathematics), American Mathematical Society (1988) [2] R Bhatia and C Davis, A Better Bound on the Variance, American Mathematical Monthly ... idea will be intimately tied to what makes an interval “typically the electronic journal of combinatorics 17 (2010), #R106 random” Taking two random points in [0, 1] and looking at the interval ... a random interval could be simulated as follows: we start by taking any random point α in [0, 1] and then take a random length β from [0, 1] and move this length along the starting point (and...

18
182
0

Developing the management strategies for financing activities for water supply sector at the Vietnam development bank (VDB) to 2015 and vision to 2020

Ngày tải lên : 27/03/2015, 15:29

117
410
0

CHEMICAL ANALYSIS OF WATER AND WASTEWATER

Ngày tải lên : 23/07/2013, 20:57

... chromatography Strontium Water quality Sulfate Water quality, water pollution Sulfide Water quality, water pollution Sulfite Surfactants Tannin, Lignin Water pollution, oxygen scavenger Water ... Chemical oxidationtitration Ozone Water treatment Titration Pesticides Water pollution Gas chromatography pH Water quality and pollution Potentiometry Phenols Water pollution Distillation-colorimetry ... ion chromatography Fluoride Water treatment, toxic at high levels Spectrophotometry, potentiometry, ion chromatography Hardness Water quality, water treatment AA, titration Iodide Seawater intrusion,...

25
793
0

Analysis on the Optimal Dispatching of Mixed-pump Stations and the Operating-mode Adaptability Based on Safety Water Supply

Ngày tải lên : 05/09/2013, 09:38

... algorithm and linear programming approach Advances in Water Resources 2(6), 667–676 Tu, M-Y, Hsu, N-S and Yeh,W G., 2003 Optimization of reservoir management and operation with hedging rules J Water ... Applied Soft Computing., 7:783-790 ZEKAI SEN, MIKDAT KADIOGLU, 2000 Simple Daily Dynamic Adaptive Operation Rules for Water Resources Optimization Water Resources Management., 14: 349-368 Carlos E Mariano-Romero, ... after the first optimization, and will be considered as the dispatching commands After that, during the second optimization, the pump parallel operation scheme and the speed ratio of speed governing...

8
461
0

Children’s Health Deficits due to Diarrhoea: Effects of Water Supply and Sanitation Systems in Slums with Different Water Logging Conditions

Ngày tải lên : 05/09/2013, 10:15

... tap water supply, using an overhead latrine or not having a latrine, not filtering or boiling water, no water treatment procedures, defecating in open field rather than a latrine and without hand ... findings for (a) family status, utilities for (b) water supply and (c) sanitation systems and attitudes for (d) water treatment at home, (e) children’s defecation habits and (f) hygiene practices ... < USD30 Utilities: Water supply Households using tap water supply Households using ground water Households using surface water Households using mixed sources of water Sanitation system Households...

15
702
0

King County Solid Waste and Wastewater Treatment Utility Operations docx

Ngày tải lên : 06/03/2014, 23:20

... Additionally, the landfill discharges wastewater into the sewer at a cost of approximately $1 million per year The landfill could capture the wastewater and recirculate it over the top of the landfill to ... of Natural Resources and Parks Utility rates are determined by the utilities’ operations costs and approved by the King County Council The Wastewater Treatment Division generates approximately ... 2016 and 2018 by not transporting garbage to another location The landfill could capture and sell additional methane generated from the recirculation of wastewater into the landfill We estimate...

147
299
0

Innovations in Minimizing Waste and Wastewater Effluent from Food and Beverage Processing Operations pdf

Ngày tải lên : 08/03/2014, 23:20

... wastewater to be treated by facility Reduced hydraulic loading of wastewater to local waterway Reduced total suspended solids (TSS) and organic load to wastewater treatment system and local waterway ... Significant water use reduction Estimated annual savings of $37,500 and a payback of years All wastewater is discharged to the City of Guelph sanitary sewer and treated at the municipal wastewater treatment ... investigation into PLTP’s water usage and wastewater generation identified strategies, in conjunction with the services of Eyre Peninsula Water Treatment, to minimise water usage The implemented strategies...

68
380
1

Water and Wastewater Finance and Pricing pot

Ngày tải lên : 08/03/2014, 23:20

... Identification of Wastewater Capital Requirements and Sources FY 2003 Through FY 2008 (in 000s) Capital and Financial Planning for Water and Wastewater Utilities 27 28 Water and Wastewater Finance and ... knowledge of water and wastewater rate structures and rate-setting practices as the project manager for various rate surveys, including the 2000, 2002, and 2004 Water and Wastewater Rate Surveys ... ensuring that appropriate water and wastewater services are provided to customers The operations and management of water and wastewater systems have changed signiﬁcantly over the last 35 years At one...

429
965
1

Volatile Organic Compounds in the Nation’s Ground Water and Drinking-Water Supply Wells pdf

Ngày tải lên : 14/03/2014, 19:20

... of water that is clean and safe for drinking and recreation and that is suitable for industry, irrigation, and habitat for fish and wildlife Escalating population growth and increasing demands ... of water and wastewater (sidebar 26) Chlorination of water and wastewater produces an estimated 0.37 million gallons of chloroform in the United States annually,(64) which includes the treatment ... applications and can contaminate ground water through sources such as landfills and dumps, leaking storage tanks, septic systems, leaking water and sewer lines, stormwater runoff, and the atmosphere...

112
573
0

Biotechnology for waste and wastewater treatment n cheremisinoff

Ngày tải lên : 16/03/2014, 18:11

... stages of landfills fall in this category Municipal Wastewater Sewage is about 99.95% water and 0.05% waste It is the spent water supply of a community Due to infiltration of groundwater into ... material, quantities and ratios depend on the nature of the wastewater Characteristics of wastewaters are measured in terms of Chemical Oxygen Demand (COD), Biochemical Oxygen Demand (BOD), and ... mix the activated sludge with the wastewater and to supply oxygen needed for microbes to breakdown the organic materials This mixture of activated sludge and wastewater in the aeration tank is...

243
405
0

Biotechnology for waste and wastewater treatment

Ngày tải lên : 16/03/2014, 18:11

... stages of landfills fall in this category Municipal Wastewater Sewage is about 99.95% water and 0.05% waste It is the spent water supply of a community Due to infiltration of groundwater into ... material, quantities and ratios depend on the nature of the wastewater Characteristics of wastewaters are measured in terms of Chemical Oxygen Demand (COD), Biochemical Oxygen Demand (BOD), and ... processes and digesters are illustrated in Figures and MUNICIPAL TREATMENT PLANT SLUDGES Wastewater sludge is being generated in enormous quantities at sewage treatment plants, particularly at activated...

245
928
1

Butterworth heinemann handbook of water and wastewater treatment technologies

Ngày tải lên : 16/03/2014, 18:11

... comprising a water purification or wastewater treatment facility are functions of the legal and operational requirements of the treated water, the nature and degree of contaminationof the incoming water ... examined where appropriate in our discussions within later chapters 4 WATER AND WASTEWATER TREATMENT TECHNOLOGIES WHAT WE MEAN BY WATER PURIFICATION When we refer to water purification, it makes little ... Overview of Water and Wastewater Treatment, Introduction, What We Mean by Water F’urification, The Clean Water Act, 26 Introducing the Physical Treatment Methods, 33 Introducing Chemical Treatment,...

654
1.7K
1

AN IMPACT EVALUATION OF EDUCATION, HEALTH, AND WATER SUPPLY INVESTMENTS BY THE BOLIVIAN SOCIAL INVESTMENT FUND pptx

Ngày tải lên : 22/03/2014, 15:20

... Non-sif Water and Sanitation Projects Benefiting Treatment and Comparison Groups in Chaco and Resto Rural, 1993–97 Treatment group Non- SIF water projects Percent of households who benefited from water ... World Bank– financed Rural Water and Sanitation Project (Prosabar) Data from before and after the sif water supply investments in Chaco and the Resto Rural show that the main changes were a reduction ... mortality Water Supply: Matched Comparison The water case illustrates how impact evaluation estimates for a particular type of intervention can be generated by taking advantage of data from a...

34
458
0

The IBNET Water Supply And Sanitation Performance Blue Book - The International Benchmarking Network For Water And Sanitation Utilities Databook potx

Ngày tải lên : 22/03/2014, 16:22

... Brazil water Water and Sanitation Program wastewater wastewater treatment plant xvii IBNET: THE INTERNATIONAL BENCHMARKING NETWORK FOR WATER AND SANITATION UTILITIES Introduction Water essential ... example, regulatory associations (such as the Association of Water and Sanitation Regulatory Entities of the Americas [ADERASA]), national water associations, The IBNET Water Supply and Sanitation Performance ... IBNET Water Supply and Sanitation Performance Blue Book The IBNET Water Supply and Sanitation Performance Blue Book The International Benchmarking Network for Water and Sanitation Utilities Databook...

176
4.5K
0

ozone reaction kinetics for water and wastewater systems

Ngày tải lên : 01/04/2014, 10:35

... undergraduate, graduate, and postgraduate students, and for teachers and professionals involved with water and wastewater treatment Students who want to become involved with ozone applications in water ... in Wastewater .118 Critical Concentration of Wastewater 120 Characterization of Wastewater 121 6.3.1 The Chemical Oxygen Demand 122 6.3.2 The Biological Oxygen Demand ... problems in the aquatic environment where treated wastewater is released.17 Thus, organochlorine compounds generated from wastewater chlorination can harm aquatic organisms in receiving waters The U.S...

385
411
0

handbook of water and wastewater systems protection

Ngày tải lên : 01/04/2014, 11:46

... the water supply and wastewater systems in the United States • Chemical and microbiological threats for water system contamination • Monitoring for natural and manmade threats in drinking water ... The state of the art in protecting water and wastewater systems Alternative solutions that might be employed to address water and wastewater security problems Contributed chapters from US and international ... use by drinking water and wastewater managers and operators for dealing with homeland security and general emergency response 1.8.1 Current State of Water Supply and Wastewater Systems Security:...

544
2.8K
0

handbook of water and wastewater treatment plant operations frank r. spellman

Ngày tải lên : 01/04/2014, 11:46

... of their critical water and wastewater infrastructure The nation’s water and wastewater infrastructure consisting of several thousand publicly owned water and wastewater treatment plants, more ... Detention Time in Minutes Wastewater Sources and Characteristics 18.5.1 Wastewater Sources 18.5.1.1 Generation of Wastewater 18.5.2 ClassiÞcation of Wastewater 18.5.3 Wastewater Characteristics 18.5.3.1 ... to take a hard look at privatization and/ or re-engineering Decaying infrastructures — Many water and wastewater operations include water and wastewater infrastructures that date back to the early...

669
4.6K
0

Quantity of Water and Wastewater pptx

Ngày tải lên : 19/06/2014, 16:20

... Quantity of Water and Wastewater Related to and integral with the discussion on quantity are the important knowledge and background on the types of wastewater, sources of water and wastewater, and methods ... industrial wastewaters are also produced Sanitary wastewaters produced in industries may be called industrial sanitary wastewaters To these wastewaters may also be added infiltration and inflow Wastewaters ... types of wastewaters be discussed first The two general types of wastewaters are sanitary and non-sanitary The non-sanitary wastewaters are normally industrial wastewaters Sanitary wastewaters (or...

50
421
0