a specialist in diagnosing and treating disorders of the stomach and intestine is known as
Báo cáo khoa học: Antimicrobial and conformational studies of the active and inactive analogues of the protegrin-1 peptide docx
... A, Marigliano A, DellaVittoria A, Nadolski P et al. (2007) In- vitro activity of the synthetic protegrin IB-367 alone and in combinationwith antifungal agents against clinical isolates of Candida ... antimicrobialactivity of IB-367 and BM-1 against Gram-negativebacteria was similar, however. Interestingly, BM-2,inactive against bacteria, displayed a better antifungalactivity than either IB-367 ... IB-367 and BM-1exhibited antimicrobial activity against all the bacteria,but were less active against the fungi (see Table 1). In contrast, BM-2 showed a marked decrease in activityagainst all the...
- 13
- 427
- 0
Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx
... GGGGGATCCCCATAATCCACTCCACCTGCTAAA44 GGGGGGGATCCT CATTATTTCCCTTCT66 AATACCGCCATGTATAATATCTATTACTTC67 GTAATAGATATTATACATGGCGGTATTGAA75 GGGGGGGCCATGGAAAGAGCAGACGATTT4294 H P. Chen et al.(Eur. ... standard [6]. The Table 1. PCR primer names and seq uences.Primername Sequence21 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA33 CCGGAATTCTTATTTCCCTTCTCTCATCTC40 GCGCGCCATGGAAAAAGATCTACAGTTAAGA41 GGGGGATCCCCATAATCCACTCCACCTGCTAAA44 ... Chemistry, Academia Sinica, Nankang, Taipei, TaiwanD-Ornithine aminomutase from Clostridium sticklandiicomprises two strongly associating subunits, OraS and OraE, with molecular masses of 12 800 and...
- 5
- 401
- 0
Tài liệu STRATIGRAPHY AND AMMONITE FAUNA OF THE VOLGIAN AND BERRIASIAN ROCKS OF EAST GREENLAND ppt
... PLATE VII. 1v Stratigraphy and Anr~nonite Fauna of East Greenland 13 the same as the gradient of the stream, and for this reason it was found impossible to correlate or place in stratigraphical ... Garniericeras, Snbcraspedirrs and Pnrncrnspedites. Snbcra- spedites is placed in Tollinae, as explained below. Paracrapedites is also excluded (see CASEY 1962). Garniericeras was made the type ... an Upper IIartzfjdd Sandstone, of early Cretaceolis date, comprising the remainder of the formation. In south-western Jameson Land the Hectoroceras Beds arc of Berriasian age. Tn the Niesrn...
- 50
- 451
- 0
Báo cáo khoa học: Interaction of the E2 and E3 components of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus ppt
... pyruvatedehydrogenase complexes. Proc Natl Acad Sci USA 96,1240–1245.17 Takenaka A, Kizawa K, Hata T, Sato S, Misaka E-J,Tamura C & Sasida Y (1988) X-ray study of baker’syeast lipoamide dehydrogenase at ... responsible forbinding E3 in the majority of organisms. In icosahe-dral complexes, the PSBD is also involved in the bind-ing of E1 [1,2]. The catalytic (acyltransferase) coredomain, which assembles ... the octahedral oricosahedral inner core of the complexes, is proposed tobind E1 in the octahedral complexes [2,3], and is loca-ted at the C-terminus. Each of the individual domains is separated...
- 10
- 558
- 0
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt
... acid (homoalanine orBABA), and a novel branched amino acid designatedAA. HMBC correlations allowed us to trace the BABA-acylated alanine, which was in turn linked toN-4 of terminal Fuc4N residue ... development againstfish diseases and possibly against tularemia in humans.Here we present the results of the structural analysis of the lipopolysaccharide of the first known fish Francisel-la sp., ... The membranes were then washed and further reacted with a 1 : 4000 dilution of second antibody, goat antirabbit IgGconjugated to alkaline phosphatase (Caltag Laboratories,Burlingame, CA, USA) and...
- 12
- 397
- 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... 2).Enzymatic activity The PPIase activity was determined by protease-couplingassay [31,32] and RNase T1refolding assay [33]. For the protease-coupling assay, chymotrypsin was used as the protease ... 5Â-AGAGAGAATTCATATGTCAGATTTGTTCAG-3Â for N-domain+,5Â-CTGAAAACGCTAAGCATATGGGTATTACGA-3Â forC-domain, and 5Â-CTTGCTGATGCACATATGGGGAAAGAAAGC-3Â for C-domain+, where underlined basesshow the position of the NdeI ... proteins remain to be analyzed. Because the prolyl isomerization is a spontaneous reaction and the rate for this reaction increases as the reaction tempera-ture increases, the PPIase activity cannot...
- 11
- 332
- 0
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.
... field of word._ Analyzing the culture and linguist of the word “meal” in English and in Vietnamese equivalents._ Comparing the cultural and linguistic analysis of the English word “meal” and ... formal and well-mannered when they serve tea. The people here favor the black tea of India and Ceylon served in china cups with handles and matchingsaucers. In Britain, tea is made in a pot, using ... introducewhat the English often drink.3.2.1. TeaThere is a saying that the British like a nice cup of tea in the morning and a nice cup of tea at night. And at half past seven, their idea...
- 54
- 1,037
- 1
Tài liệu Live Red in support of the Heart and Stroke Foundation of Manitoba pdf
... community relationships,ãhelp reduce the devastating effects of Manitoba’s leading causes of death and disability.Since 80% of Canadians have at least one risk factor for heart disease or stroke, ... Red casual day fundraisers are very popular and simple to plan.Dinner, gala or social - Coordinate an evening of dinner and dancing in support of HSFM. Benefit dinners are great for rewarding ... fight against heart disease and stroke. No matter how big or small, your efforts will make a lasting difference in the lives of Manitobans.“My father died of a heart attack when he was 64-years-old....
- 57
- 557
- 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... (5Â-CCGAGCTCGAGACGTGAAGCGACAATCTCGCAATCT-3Â) containing an XhoI (Promega) site upstream of the start codon and an antisense primer (5Â-CAGCCAAGCTTCTCACTCTTTGATGAAATGCATCT-3Â) con-taining a HindIII ... proton-translocating pyrophosphatase; AsPPase, Ascaris suum inorganicpyrophosphatase; rAsPPase, recombinant A. suum inorganic pyro-phosphatase; L3, third-stage infective larvae; L4, fourth-stage larvae;ES, ... Takeharu Miyoshi1, Harue Kasuga-Aoki1, Takashi Isobe1, Takeshi Arakawa2,Yasunobu Matsumoto3 and Naotoshi Tsuji11Laboratory of Parasitic Diseases, National Institute of Animal Health,...
- 13
- 691
- 0
Tài liệu Research evaluation of economic, social, and ecological implications of the programme for commercial tree plantations: case study of rubber in the south of Laos PDR pptx
... areas land Ministry of Industry and Crafts manages industrial land Ministry of Public Statements and Culture manages cultural land Ministry of National Protection and Ministry of National ... Lampan Xayalade Research officer, National Land Management Authority 4. Champaphai Khambuasy Office of information and news, Land Management Authority, Champassak province 5. Somdy Phrommasen ... separate Laos from Thailand. Laos was seen as an enclosed land, a locked land, without a sea port. This led to the building of the link roads of Indochina. Indochina in the colonial era Laos...
- 135
- 708
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu