... ΔΨm 5’-RACE β2m mitochondrial membrane potential 5'-rapid amplification of cDNA ends β2-microglobulin aa AAH AFP ALAS ANOVA ATP amino acid atypical adenomatous hyperplasia α-fetoprotein δ-aminolevulinate ... 62 Ando E, Tanaka M, Yamashita F, Kuromatsu R, Takada A, et al Diagnostic clues for recurrent hepatocellular carcinoma: comparison of tumour markers and imaging studies Eur J Gastroenterol Hepatol ... Takayama T, Makuuchi M, Hirohashi S, Sakamoto M, Okazaki N, et al Malignant transformation of adenomatous hyperplasia to hepatocellular carcinoma Lancet 1990;336:1150-1153 17 47 Sakamoto M, Hirohashi...
... and characterization of a novel zinc finger protein that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization ... 58 B E B AAAAAAAA C A B D AAAA B A 71 47 217 42 S S M S 1 – – – 25 – B A C A 67 130 160 98 S S M M – – – 13 30 AA B B Accession no in the NCBI protein database proteins Filamentous ... N, 5¢-CATGAACCGGTTTGGTAC-3¢ as the 5¢ primer, and C, 5¢-CTATCCCACGGTGACAA AGC-3¢ as the 3¢ primer The sequence between these primers was amplified by PCR using Ex Taq DNA polymerase (Takara, Tokyo,...
... complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs ... each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢ Actin fractionation ... order actin structures, such as bundles and cables, is crucial to stabilize the organization of transvacuolar strands and maintain overall cellular architecture As mentioned above, CRP1 may participate...
... (1977) Analysis of singleand double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange Proc Natl Acad Sci USA 74, 4835–4838 Savonet, V., Maenhaut, C., ... N., Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A. , Saito, Y., Nakao, K., Jockusch, B.M & Narumiya, S (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, is a target ... actin microfilaments and cytokeratin intermediate filaments, and with the appearance of a marked cytokeratin and actin immunoreactivity at the cell junctions [28,42] The latter cytoskeleton changes...
... gaggctgccctgcgctccgctttgctttgggattaatttattctgcatct gctgagaggggcaccccagccatatcttacactttggtaaagcagaaaac caggaaaattttcttaaaatatccacaatattccttgagtgagtcagaat ctatagccggttagtgatggtttcaggcagaatcgtgttcgtgtctgttt tgctcgattcctttcctaagttaaataaatgcaagcctctgaacttctgt ... aaaaaacaaccatttcctctctgctgagagccagggaaggcgagctctgc gcacacgggcgtccctgcagcagccactctgctttccaggaccggccaac tgccctggaggcatccacacaggggcccaggcagcacagaggagctgtga acccgctccacaccggccaccctgcccggagcctggcactcacagcaggc ... GCGCGCTTTCGCCGTGGGCTGGACAATGACTACGTGGAGTCACCATGCTG A R F R R G L D N D Y V E S P C * Agtcgcccttctcagcgttccatcgatgcacacctgctatcgtggaacag cctagaaaccaagggactccaccaccaagtcacttcccctgctcgtgcag aggcacgggatgagtctgggtgacctctgcgccatgcgtgcgagacacgt...
... non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads that did not match any of those ... correspond to any annotated small RNA Our small RNA cloning strategy only captures small RNAs that are, as miRNAs, 5’-phosphorylated and, Page of 13 thus, eliminates RNA degradation products generated ... non-coding RNA annotations (ncRNA.org) Read counts correspond to undifferentiated (ND.1 and ND.2), day differentiated (AD3.1 and AD3.2) and day differentiated (AD8.1 and AD8.2) hMADS cell samples,...
... CCC AGC CGG AAG AAG-3’ and 5’-CGC GTC GAC CAC AAT GAT GTC ATA GAC-3’ and digested with BamHI-SalI and ligated to C-terminal of EcoRI-BamHI fragment in pUC19 The full length of BIG3 at EcoRI-SalI ... Abbreviations aa amino acid ACTH adrenocorticotropic hormone AMPK AMP-activated Protein Kinase AOX coenzyme A oxidase AP-1 adaptor protein-1 ARF ADP ribosylation factor Arg arginine ARNO ARF nucleotide ... pair: 5’-GCC GAA TTC CCA GAT GCT AAA GAA G-3’ and 5’-TAT GTC GAC AGG CCT GAG AGA TCC A- 3’ The PCR product was digested by EcoRI-SalI and ligated into pET-41b(+) vector His-BIG1Sec7 was generated...
... acids are either saturated or unsaturated In the membrane, stearic acid and palmitic acid are the most common saturated fatty acids254 The most common unsaturated fatty acid is oleic acid Arachidonic ... isozymes and have revealed that it is an intramolecular reaction at both serine and threonine residues on both regulatory and catalytic domains132-134 Autophosphorylation of PKC has a Km value for ATP ... one contains almost the entire extracellular domain and the other contains a short ectodomain stub followed by a transmembrane domain anda long cytoplasmic tail After ligand binding, a change occurs...
... TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT ... genomic DNA contamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5¢-ATCACCATCGGCAACGAGAG-3¢ and 5¢-TGGAGTTGTAGGTGGTCTCGTG-3¢)...
... were extracted, and the target ZI3 1A gene was amplified by PCR with primers 5¢-AAATA TAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGC GTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by ... signal-amplifiable target strain (FG1; ZI3 1A Fc) and an excess amount of signal-amplifiable nontarget strain (FG0; None–Fc) Several mixing ratios were used, as shown in Table The final ratios of target ... episomal plasmid caused by signalling in yeast J Biochem 143, 667–674 22 Ishii J, Izawa K, Matsumura S, Wakamura K, Tanino T, Tanaka T, Ogino C, Fukuda H & Kondo A (2009) A simple and immediate...
... composed of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered ... triad made of a catalytic nucleophile serine, associated to a proton carrier histidine anda charge relaying aspartic (or glutamic) acid To further investigate the biochemical characterization ... connecting helix a8 to strand b8, a five-residues loop connecting strand b3 to helix a1 and two small helices (a4 and a6 ) The catalytic site consists of a functional catalytic triad found in all serine...
... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain showing the same ... DL, Jacobsen BM, Flodin A & Skalnik DG (2000) Cloning of a mammalian transcriptional activator that binds unmethylated CpG motifs and shares a CXXC domain with DNA methyltransferase, human trithorax,...
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... harvested and extracts separated into nuclear and cytoplasmic fraction by centrifugation (see Materials and methods) Twenty micrograms of each fraction were loaded per lane on a 10% SDS-polyacrylamide ... stabilize ARE-containing mRNAs [68] and has been associated with the activation of c-Jun N-terminal kinase (JNK) [69] Similarly, activation of MAP kinase-activated protein kinase has been associated...
... C-terminal Caskin1 are functional and may interact with SH3 domain-containing proteins, such as Abi2 [We have also found an in vivo association and colocalization of Abi2 with Caskin1 (A Balazs, ... proline-rich region and its fragments from the bacterial extracts was started by boiling the proteins at 100 °C for and loading the supernatants on an Ni–agarose affinity chromatograph The heat stability ... modulators, and signalling molecules including kinases and phosphatases [47] A variety of scaffold proteins, such as members of the MAGUK, Shank and Homer families, serve to organize PSD As a result...
... gold and alkylated gold, and from a quantitative amino acid analysis for glass and the formaldehyde resin (see details in supplementary Fig S3) Surface area per molecule was calculated by a assuming ... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... Mrcp-19k was amplified from M rosa total cDNA using the primers 5¢-ACC AAC GCA GCA GTT ATG GT-3¢ and 5¢-GCT GCA CAT CTT CGA CCT CA-3¢, and then subcloned KOD-plus DNA polymerase (Toyobo, Osaka, Japan)...
... site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA G-3¢ and 5¢-CTT AGG AGA TGT AGG ACC CAG TGT CCT TTT G-3¢) To create pStrep–BroxC408S ... AAA GAC CCC AAC GAG AAG CGC GAT CAC-3¢ and 5¢-GTG ATC GCG CTT CTC GTT GGG GTC TTT GCT CAG CTT GGA CTG-3¢) pmGFP–Brox C408S , which has a point mutation at amino acid 408, was created by PCR-based ... Strep-tag II and pAb to FLAG) and secondary antibodies [Alexa Fluor 488-conjugated goat anti-(mouse IgG) and Cy3-labeled goat anti-(rabbit IgG)] The fluorescence signals of Alexa Fluor 488 (A, D,...