a modelling study using a realistic finite element model of the head
Development of a realistic finite element model of human head and its applications to head injuries
... wave propagation paths in the facial skeleton and the intracranial brain presented to study the association of the traumatic brain injury (TBI) with the facial trauma sequences Fractures of facial ... facial bones and cranial bones as well as intracranial injuries are evaluated based on the tolerance limits of the biomechanical parameters General trend of maximum intracranial biomechanical parameters ... that the each of the NDT markers consists of a cluster of several elements in which the elemental average values of the strain data are collected (C) The bar chart shows the percentage of material...
- 347
- 367
- 0
Báo cáo y học: "Developing a realistic sexual network model of chlamydia transmission in Britain" pot
... complexity and the ability to validate the model with data More data are needed on sexual life histories as well as further analysis of the sensitivity and robustness of the model assumptions The advantages ... by the rate of new partnership formation, the availability of suitable partners, the rate at which partnerships dissolve, and the gap between partnerships Individuals are available to form a new ... Table The model fits better to the male data than the female data, due to the choice of fitting procedure (i.e., the model was fitted to male behavioural data) In both males and females, the model...
- 11
- 305
- 0
Patient specific finite element modeling of the human lumbar motion segment
... usually based on established standard values which have been adopted over years The concomitant drawback of these generic models is that they are unable to give accurate analysis results at a patient-specific ... generated consist of a large quantity of tiny cubic hexahedral elements, or so-called voxels, with their size defined by the spatial resolution of the image stack The advantage of this approach ... that the internal nodes of the FE mesh are moved at interpolated distances so that the shape of the elements remains FEA compliant (a) (b) Fig 4.2 (a) A thin steel plate tacked at points (b) Application...
- 102
- 235
- 0
Tài liệu Báo cáo khoa học: "A Finite-State Model of Human Sentence Processing" docx
... at the Disambiguating Region A total of 30 pairs of a garden-path sentence and its ambiguous, non-garden-path control were tested for a comparison of the probability decrease at the disambiguating ... Jurafsky A probabilistic model of lexical and syntactic access and disambiguation Cognitive Science, 20:137–194, 1996 A E Kim, Bangalore S., and J Trueswell A computational model of the grammatical aspects ... and Language,, 47:50–68, 2002 C.D Manning and H Sch¨ tze Foundations of u Statistical Natural Language Processing The MIT Press, Cambridge, Massachusetts, 1999 S Narayanan and D Jurafsky A bayesian...
- 8
- 446
- 0
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot
... to 32 g The animal experiments were performed in compliance with the guidelines of the Federation of European Laboratory Animal Science Association (FELASA) and approval was granted by the Institutional ... 4°C Thereafter, the supernatants were aliquoted and stored at -70°C until analysis The concentrations of total protein in the brain extracts were measured by Bradford assay (Bio Rad Laboratories, ... brain: (1) The first part of the experimental study was designed to investigate a potential role of TNF-dependent regulation of intracranial IL-18 expression in a standardized model of CHI, using...
- 6
- 436
- 0
Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf
... to the inter-channel distance and the direction of arrival (DOA) angle To solve the problem, a reasonable statistical model for the distribution of IPD error and its Gaussian approximation are ... (RIR) of each channel, and then the delay was determined by finding the direct paths from the two measured RIRs A systematic overview of the stat -of- the- art of TDE techniques was summarized in the ... effect The relative performance of the TDE was evaluated through a number of trials in a simulated rectangular room (12 × 10 × m ) The microphone array is located at (3,3,2) and the distance from the...
- 19
- 455
- 0
Báo cáo khoa học: "Radiation-induced cancer after radiotherapy for non-Hodgkin''''s lymphoma of the head and neck: a retrospective study" ppsx
... analysis of data All authors have read and approved the final manuscript Additional material Additional file Table S1 Characteristics of the radiation-induced head and neck cancer patients (n ... removed the second cancers (one each of laryngeal cancer and esophageal cancer) which arose near the radiation field from the analysis of radiation-induced cancer according to the criteria that Sakai ... Calcaterra TC, Abemayer E, Fu YS, Parker RG: Postirradiation Sarcoma of the Head and Neck Cancer 1993, 72(3):887-893 Lagrange JL, Ramaioli A, Chateau MC, Marchal C, Resbeut M, Richaud P, Lagarde...
- 7
- 326
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Spindle cell oncocytoma of the adenohypophysis in a woman: a case report and review of the literature" pdf
... salivary gland remnants Epithelial markers are expressed, S-100 protein and EMA are negative Oncocytic variant of a pituitary adenoma Synaptophysin and chromogranin are expressed a EMA, epithelial ... conceived of, coordinated with other coauthors and drafted and revised the manuscript HH, IC, IBS, SH, HJ, MZ and NK participated by acquisition and analysis of literature data and helped to draft the ... oncocytic variant, granular cell tumour, pituicytoma, oncocytic neoplasm arising from developmental salivary gland remnants and oncocytic variant of a pituitary adenoma [2-4] Rarely, they should...
- 4
- 440
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Development of Buffalo Hump in the course of antiretroviral therapy including raltegravir and unboosted atazanavir: a case report and review of the literature" pot
... neck There was no localized accumulation of fat in her abdomen and in the submental region of her neck The hump in the back of her neck was causing neck pain, headaches off and on and sleep apnea ... was causing her discomfort and affecting the motion of her neck An ultrasonography scan of the cervical region reported a large amount of subcutaneous fat around the posterior aspect of the Page ... of antiretroviral therapy including these drugs: on the basis of our data we can formulate the hypothesis of a pharmacological pathogenesis that underlies the development of this case of Buffalo...
- 4
- 408
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: High origin of a testicular artery: a case report and review of the literature." pptx
... TAs are paired and usually originate from the anterolateral or lateral aspect of the abdominal aorta The TA is a long, thin vessel that arises at an acute angle from the abdominal aorta, at the ... Ozan et al [6] Furthermore, Xue et al found a right TA artery arising from the anterior surface of the abdominal aorta at the level of the left renal artery [14] The first attempt at classification ... artery and a superior suprarenal artery In another case, Onderoglu et al reported the case of a high origin of the right TA located at the level of the right renal artery lineage [4] It branched off...
- 4
- 348
- 0
Báo cáo y học: " Health status and lifestyle factors as predictors of depression in middle-aged and elderly Japanese adults: a seven-year follow-up of the Komo-Ise cohort study" doc
... Blumenthal JA, Babyak MA, Doraiswamy PM, Watkins L, Hoffman BM, Barbour KA, Herman S, Craighead WE, Brosse AL, Waugh R, Hinderliter A, Sherwood A: Exercise and pharmacotherapy in the treatment of major ... Technology, Japan, and a Gerontology and Health Grant from Gunma Prefecture The authors wish to express their gratitude to the mayors and staff of the Village of Komochi and the City of Isesaki for their ... quantitatively represents mental and physical complaints The Japanese-language version of a 1999 survey questionnaire used as part of the Alameda County Study [19] was used for the second-wave...
- 10
- 480
- 0
Báo cáo y học: " Successful closed manipulation of a pure lateral traumatic dislocation of the elbow joint using a modified Stimson''''s technique: a case repor" ppt
... preparation of the manuscript All authors read and approved the final manuscript Written informed consent was obtained from the patient for publication of this case report and accompanying images ... have adapted a modification of Stimson's original method to reduce a purely lateral elbow dislocation Such an atraumatic and mechanically simple technique can prove very useful in a busy casualty ... olecranon in a purely medial direction requires both hands from the main operator, with the assistant constantly applying counter-traction The ease of reduction justifies the use of an additional...
- 3
- 269
- 0
Báo cáo y học: " Oral tolerance inhibits pulmonary eosinophilia in a cockroach allergen induced model of asthma: a randomized laboratory study" pptx
... http://www biomath.info/ The coefficient of variance was calculated as the ratio of the standard deviation and the mean of each data set or CV = standard deviation/mean Sacrifice and Data Collection ... significant advantage over standard therapeutic agents in that it addresses the fundamental cause of asthma rather than modifying downstream mediators In addition allergen desensitization has the advantage ... for human asthmatics in that it addresses the primary cause of allergic asthma exacerbations rather than simply blunting the symptoms In addition oral tolerization offers significant advantages...
- 11
- 322
- 0
investigation into compatibility between repair material and substrate concrete using experimental and finite element methods
... (Parameswaran 2004) The large number of commercially available repair materials with a wide variation in the mechanical properties makes the proper selection of a suitable patch repair material a ... and Al-Hasan 1997) If the repair material is a mortar then ASTM C 109 standard practice was used For deeper repair, coarse aggregate was used with the repair material and ASTM C 39 standard practice ... repair material The repair material was cast against a thin steel plate on the bottom The plate had a layer of epoxy and was impregnated with a sand grit applied to improve bond to the repair material...
- 168
- 223
- 0
A STUDY ON DEMOTIVATING FACTORS IN READING LESSONS OF THE 10th FORM STUDENTS AT HIGH SCHOOL FOR GIFTED STUDENTS, HANOI NATIONAL UNIVERSITY OF EDUCATION
... Table of contents List of tables and charts Abstract PART A: INTRODUCTION Rationale of the study Aims of the study Research questions Significance of the study Scope of the study Method of the ... presents the rationale, the aims, and the research questions, the significance of study, the scope of the study, the method of the study and the design of the study Part B: DEVELOPMENT, consists of the ... National University of Education when they are engaged in reading lessons The results of the findings can be of great use for the teachers of the classes surveyed in the way that they can adapt their...
- 76
- 552
- 4
Finite element model for nonlinear analysis of steel–concrete composite beams using Timoshenkos beam theory
... daata In Fig 17, it can be noted n that thee curve of thhe analyticaal results liess almost alw ways among the experimenntal results of the two hallves of the bbeam Fig.17 Deflected shappe at ... NUMERICAL EXAMPLES The numerical solutions of the proposed model are compared against experimental data obtained by earlier experimental study In the fact that, a group of two CB which material limited ... partiaal interactionn, based on kinematic assumptions a s substantiallly similar to o the analytiical solution was w reportedd by Schnaabl et al ((2007) Thee nonlinear behaviour of materiall is...
- 16
- 549
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare ... the cerebral hemispheres AC result from accumulation of CSF surrounded by an arachnoid membrane Vernooij et al 15 found that AC has a prevalence of approximately 1% in the normal population There ... temporal fossa AC Helland et al 20 found the Na+–K+–2Cl− cotransporter NKCC1 gene was escalated in AC and NKCC1 was present in the AC wall These finding indicated NKCC1 gene might play an important...
- 4
- 652
- 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... monitor the acetylation status of the MMTV promoter subjected to TSA treatment, we used a chromatin immunoprecipitation assay (ChIP) and evaluated the acetylation status of the so-called B- and nucleosome ... nucleosome B area) become deacetylated whereas the acetylation of both H3 and H4 of nuclesome F was increased [42] Addition of TSA resulted in only an insignificant increase of the acetylation level of ... may change the bulk acetylation pattern of histones, and in this way alter the structure of chromatin incorporating them To see whether the increased transcription leakage observed at early addition...
- 10
- 500
- 0
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc
... Butikofer and Valerie Verne for the ELISA assays We thank Pr Roland Douce and Dr Michel Matringe and Mickaela Homan for critical reading of the manuscript Special ă thanks to Maighread Gallagher ... Systems Modelling Database and can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the aspartate-derived amino acid biosynthetic pathway ... initial concentration of cysteine minus the concentration of NAD+ at time, t A small error is made in this calculation as a consequence of the time delay in the enzymatic chain Subtraction of the...
- 13
- 906
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... gene) and quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene) BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2 Activity values are given as mean values ± standard ... using the following pair of primers: 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned as a fusion with GAL4bd ... pair of primers: 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢ BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1...
- 10
- 464
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25