a focus on mossy cell loss and mossy fiber sprouting in the dentate gyrus
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"
... leading to impaired daily activity and creating a sensation of heaviness and discomfort There was no family history of similar disorders A conventional approach was applied, involving elevation ... physicians as first contact care givers and through the continuity of care that they can offer, may play an important role in the diagnosis and the monitoring of the long-term impact of lymphedema on ... and inguinal area leading to disfigurement and functional impairment The patient had a negative family history of edema He received a diagnosis of primary lymphedema at the age of 13 years Since...
- 5
- 443
- 0
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus
... species in Balsas, in the Southern part of the Region Amazonas, in Chacanto, Region Cajamarca and in various localities in the Region La Libertad (San Vicente/Pusac, Santa Rosa/El Tingo, Vijus, Chagual, ... Pramuk 1999, Brack 2004) The Huancabamba Depression in the Piura, Cajamarca, Amazonas and San Martin Regions is the major structural and physiographic break of the Andes consisting of a complex system ... Sechuran fox (Pseudalopex sechurae), the puma (Puma concolor), the jaguar (Panthera onca), the ocelot (Leopardus pardalis) the tayra (Eira barbara), the collared peccary (Pecari tajacu), and the...
- 264
- 492
- 0
báo cáo hóa học:" Effect of borax on immune cell proliferation and sister chromatid exchange in human chromosomes Malinee Pongsavee" docx
... cultures in each borax concentration was carried out in duplicate fashion Mean absorbance was calculate for the control wells and for each borax concentration in the test wells The degree of immune cell ... seaweed It is associated with loss of mammary myoepithelial cells in tissue culture provides a potential mechanism for increasing invasive mammary carcinoma [5] and induced colonic neoplasia in ... chemical and physical agents exhibiting diverse modes of interaction with DNA These agents are capable of inducing SCE The SCE technique is a sensitive means of monitoring DNA damage The borax concentrations...
- 6
- 580
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... (Allard Kaptein) helped in conceiving the study and helped to draft the manuscript AK (Annemieke Kavelaars) and CH were involved in drafting and revising the article AB helped in conceiving the ... M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated transcriptional activation: therapeutic potential in autoimmune diseases ... primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG)...
- 10
- 462
- 0
Tài liệu Sexual Coercion and Reproductive Health, A focus on Research doc
... Major institutions -such as the United Nations' General Assembly, the Pan American Health Organization and the Organization of American States -recognized the gravity of gender-based abuse and ... that teaches male mastery and domination over women must be altered" : The changes in Ghanaian culture that I envision can be compared in a way to the weaving of the traditional Ghanaian kente ... documented consequences of sexual abuse are early onset of sexual activity and an inability to distinguish sexual from affectionate behavior (Donaldson, Whalen and Anastas, 1989; Browne and Finkelhor,...
- 64
- 612
- 0
báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx
... http://www.jhoonline.org/content/2/1/46 Dasatinib Dasatinib is a thiazole carboximide with potent activity against BCR-ABL and also SFKs [15] This agent has 325fold greater activity against unmutated BCR-ABL in vitro than imatinib, ... associated with dasatinib therapy are predominantly mild or moderate (grade or by the National Cancer Institute Cancer Therapy Evaluation Program criteria), and are self-limiting or resolve following ... clinical concerns These problems may either prevent a patient from attaining a sufficient clinical response (suboptimal response), or may cause a patient to lose an existing one (relapse) In the...
- 6
- 337
- 0
A study on syntactic, lexical semantic and rhetorical features of word groups containing words denoting seasons in vietnamese and english
... infer the following metaphorical meaning features of the Containing Spring/Autumn and Other Words word group containing xuân that are examined by us: a) Word Groups Containing Spring (WGCS) and ... as follows: To the extent of descriptive research, observation and - Collecting and classifying data investigation are methods of collecting data Observation and - Analyzing data investigation ... the rationale, aims and To achieve the aims and objectives of the study, the following research the following questions are raised: What are the syntactic, lexical-semantic and rhetorical features...
- 13
- 1,056
- 1
A study on prepositions of direction and some errors made by vietnamese learners
... better and better Organization of the study With a clear organization in which there are three main parts designed, I hope that readers can easily read Part one is the introduction, including rationale, ... may also show the relation of a whole clause to a verb or an adjective, the clause is an adjective clause and a noun, the clause is an attribute clause Understanding them clearly we can use them ... was critical and demanding and yet very caring and supportive along the way I also wish to send many thanks to the Dean of Foreign Language Department of Hai Phong Private University, Ms Tran...
- 55
- 1,038
- 3
A STUDY ON UNREAL CONDITIONAL SENTENCES AND WAYS TO TRASLATE THEM INTO VIETNAMESE
... UNREAL CONDITIONALS INTO VIETNAMESE I Translation of unreal conditionals in the present II Translation of unreal conditionals in the past III Translation of Conditional inversions IV Translation ... translation Literal translation Faithful translation Semantic translation TL emphasis Adaptation free translation Idiomatic translation Communicative translation Word-for-word translation The ... by the same message and /or statement in another language E Nida, another famous theorist, holds the view that translation is an art, a skill and a science Taking some definitions of translation...
- 65
- 692
- 1
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... forming a lesion approximately mm in diameter Draining lesions resulting from vaccination should be kept clean and bandaged Scabs form and heal usually within months after vaccination BCG vaccination ... as long as months after vaccination BCG vaccination often results in permanent scarring at the injection site More severe local reactions include ulceration at the vaccination site, regional suppurative ... BCG vaccination for their patients are encouraged to discuss this intervention with personnel in the TB control programs in their area To obtain additional consultation and technical information,...
- 27
- 1,309
- 3
Clearing the Waters: A focus on water quality solut ions pptx
... and data-sharing and management institutions Resources are needed to build national and regional capacity to collect, manage, and analyze water quality data Improve communication and education ... WWAP 2009) As water quality degradation continues, the prevalence and impacts of disease will increase, particularly among the poor and vulnerable (MA 200 5a) And sanitation and drinking water investments ... pumps and intakes and choking canals, leading to costly and continual maintenance challenges In South Africa, invasive plant species have altered local water quality and reduced water quantity as...
- 91
- 472
- 0
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx
... such as color and contrast in a landscape Flachsbart and Phillips (1980) used physical data for a variety of air pollutants and weather indicators and, more importantly, for a variety of averaging ... Saksena Sumeet Saksena is a Fellow in the Research Program at the East-West Center He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa ... on the links between air pollution and health in Northeast England Environmental Research 91: 163-171 26 Irwin A , Simmons P and Walker G 1999 Faulty environments and risk reasoning: the local...
- 32
- 380
- 0
A Tutorial on Network Security: Attacks and Controls potx
... a SA This field is a monotonically increasing identifier and is used to assist in anti-replay protection Authentication Data: Contains the integrity/authentication check value (keyed-HMAC) calculated ... and the stateful inspection firewalls take actions by only looking at the headers of the data packets An application proxy firewall acts as an intermediate gateway attempting to look not only at ... the datagrams sent as part of a SA This field is a monotonically increasing identifier and is used to assist in anti-replay protection Payload data: Indicates the data to be transferred Padding:...
- 21
- 469
- 0
The Gravity of Weight A CLINICAL GUIDE TO Weight Loss and Maintenance pdf
... general psychiatric and medical standards, and that information concerning drug dosages, schedules, and routes of administration is accurate at the time of publication and consistent with standards ... brain, and body” and to explain why the control of body weight and its maintenance are “so daunting for so many people.” The problems that they raise and the analyses that they conduct go far ... these measurements may vary considerably from examiner to examiner and even from one examination to another Often one examiner will take measurements several times in one area to get an average...
- 519
- 3,824
- 1
A study on translation of economic and trade terminology from english into vietnamese
... the definition of translation, translation method, and translation equivalence and relevant theory including: I Definition Translation, a phenomenon traditionally considered as an “art”, has existed ... However, the lexical words are again translated out of context Literal translation is considered the basic translation step, both in communication and semantic translation, in that translation starts ... it in a flattened diagram as below: SL Emphasis TL Emphasis Word-for-word translation Adaptation Literal translation Free translation Faithful translation Idiomatic translation Semantic translation...
- 69
- 920
- 7
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt
... second-order rate constants and concentrations of TM and PAI-1 on the rate of thrombin/ PAI-1 complex formation For various combinations of kon and koff for the thrombin/TM interaction, the concentration ... physiologic consequence of this interaction is an inactivation of the PAI-1 pool in the vascular wall by thrombin, making it no longer available for interaction with u-PA and VN, which can explain part ... have an additional heparin-like effect on the thrombin/PAI-1 interaction [19] In this way, only protein–protein interactions between thrombin and TM are considered At the highest concentration...
- 10
- 483
- 0
Báo cáo khoa học: "A Note on Categorial Grammar, Disharmony and Permutation" doc
... CatListGram In these aspects, CatListGram and GenComp are weakly equivalent 274 CONCLUSIONS None of the additional characteristics for CatListGram affects the weak capacity of a categorial grammar; i.e.: ... exclusive cancellation of primitives does not affect recognition capacity maintaining more than one argument stack does not affect recognition capacity merging argument stacks of primary and secondary ... fonetiek6.1eidenuniv.nl/hijzlndr/delilah.html) GenComp + Primitive Cancellation Constraint + Directed Stacks + Transparent Primary Category (but nevertheless) Fact Fact 4, Fact and Fact also hold mutatis mutandis for CatListGram...
- 2
- 231
- 0
a study on peel volatile constituents and juice quality
... octanal and decanal were higher in our Fourteen aldehyde components that identified samples Octanal has a citrus-like aroma, and in this analysis were octanal, nonanal, is considered as one of the ... (2000) [5] B Babazadeh- Darjazi, A Rustaiyan, A [19] F Antonucci, F Pallottino, G Paglia, Talaei, A Khalighi, K Larijani, B Golein, R A Palma, S.D Aquino, P Menesatti, Food Taghizad, Iran J Chem ... Correlation between pairs of characters 11 peel component and juice characteristics and altitude was evaluated using Pearson’s Variations among and within cultivars were correlation coefficient (Table...
- 14
- 333
- 0
a study on peel volatile constituents and juice quality
... octanal and decanal were higher in our Fourteen aldehyde components that identified samples Octanal has a citrus-like aroma, and in this analysis were octanal, nonanal, is considered as one of the ... (2000) [5] B Babazadeh- Darjazi, A Rustaiyan, A [19] F Antonucci, F Pallottino, G Paglia, Talaei, A Khalighi, K Larijani, B Golein, R A Palma, S.D Aquino, P Menesatti, Food Taghizad, Iran J Chem ... Correlation between pairs of characters 11 peel component and juice characteristics and altitude was evaluated using Pearson’s Variations among and within cultivars were correlation coefficient (Table...
- 14
- 317
- 0
Báo cáo hóa học: " Effects of pegylated G-CSF on immune cell number and function in patients with gynecological malignancies" doc
... neutropenia The investigations were approved by the Institutional Review Board A retrospective analysis of registrational clinical trials that examined the safety and efficacy of pegfilgrastim indicated ... input and advice SR participated in the design of the study, carried out the experiments, performed the statistical analysis and drafted the manuscript All authors read and approved the final manuscript ... years (median age = 68 years) All patients received a conventional chemotherapeutic regimen, consisting of carboplatin (AUC5) and paclitaxel (175 mg/square meter) The patients’ clinical characteristics...
- 15
- 796
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25