... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysisofthe meanings expressed via the modal verbs can, may, must and the ... is the constraint of L1 or the borrowing ofa first language pattern or rule that leads to an error or inappropriate form in L2 As one ofthe goals of CA is the effective teaching and the learning...
... Corporation; Hialeah, FL, USA) at the ÔServeis Cientifico-TecnicsÕ ofthe University of Barcelona, using the 488 nm line of an argon laser and standard optical emission filters Percentages of cells at ... described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell gallery was ... contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence ofthe anthracycline as unique...
... long-term analysis we assume the structure ofthe agricultural economy in the United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... hence, putting them at significant market disadvantage The bill sets a maximum amount of allowances that can be rebated to EITE industries at, 2% for 2012 and 2013, 15% in 2014, and then declining ... energy-related expenses, other farm expenses, and the value of agricultural production stays the same.10 To assess the impacts of HR 2454 beyond 2018, we assume the underlying structure ofthe agricultural...
... PH17P(+) PA55G()) PA55G(+) PT69G()) PT69G(+) TTGTACGTTGCGAACAACCCCGGACAAT ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT ... GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA ... role as the catalytic base (c) D75E: aspartic and glutamic acids are dicarboxylic acids, but glutamic acid has an additional carbon in the lateral chain The clear effect of this change in the RNase...
... large package In this case, note that two small packages are equivalent to a large package.14 With this assumption, theanalysis with small packages is similar to the case when the firm only offers ... Note Small and large packages purchase small packages to reduce their total consumption and achieve a consumption pattern On the other hand, the introduction of small packages could also lead to ... requires that the per-unit margins from the small package are at least twice as large as the per-unit margins from the large package In this paper, we have assumed for simplicity that the marginal costs...
... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part ofthe budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part ofthe Equitable Share grant to provincial governments...
... same channel allocations as existing legacy narrowband analog FM two-way radios To facilitate a gradual transition to the system, P25-compliant radios must be capable of demodulating legacy analog ... 20ms of audio, for a total 180ms of encoded audio in each LDU frame), plus additional metadata and a small amount of piggybacked low speed data Each LDU, including headers, metadata, voice subframes, ... and the standard implementations of it admit practical, exploitable vulnerabilities that routinely leak sensitive traffic and that allow an active attacker remarkable leverage At the root of many...
... are capital gains tax breaks (Arizona, Arkansas, Hawaii, Montana, New Mexico, North Dakota, South Carolina, and Vermont) and deductions for federal income taxes paid (Alabama, Iowa, Louisiana, ... State lawmakers have enacted a wide variety of tax changes over the past three years since the last publication of Who Pays Many of these changes have dramatically reshaped state and local tax ... California, Hawaii, Kansas, and Nevada all temporarily increased the sales tax Other Notable Changes • A dozen states either adopted an “Amazon” law or reached an agreement with the online retailer...
... Freddie Mac and Fannie Mae, as well as advances made by the Federal Home Loan Banks) To further support the availability of mortgage financing, Treasury is initiating a temporary program to purchase ... Buildup and Meltdown ofthe Mortgage and Credit Markets The demand for residential real estate was seemingly insatiable After rising at an average annual rate of slightly less than percent duringthe ... ofthe appreciated value ofthe collateral property The share ofthe appreciated value is determined and due at the sale ofthe property or at the termination ofthe mortgage In addition to promoting...
... protocol, and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis ... gene signaling pathway analysis has identified gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also up-regulated in whole liver Therefore, the microarray analysis ... on the acegene microarray database (DNA Chip Research Inc and Hitachi Software Co., Yokohama, Japan) The significance of GO term appearance in the up- and downregulated genes (compared with all...
... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part ofthe budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part ofthe Equitable Share grant to provincial governments...
... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part ofthe budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part ofthe Equitable Share grant to provincial governments...
... Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without ... permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without ... permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without...
... with their careers and the career opportunities available to them is a further measure of demoralization of nurses and offers some substantiation ofthe disaffection associated with working in the ... estimated by assessing the internal consistency ofthe scales by means of Cronbach's alpha The ultimate score that each nurse received for each factor was based on the simple summation ofthe ... that encourages adequate use of their abilities The availability of protective materials and functional equipment to safeguard nurses from unnecessary accidents, as well the implementation of...
... studies Theanalysis revealed several characteristic features with respect to the individual amino acids in the Vpr Ofthe 96 amino acids, all the amino acids except the initiator methionine have the ... development of vaccines based on the auxiliary genes of HIV-1 Authors' contributions AS, VA, AK, AB, VS, RC and AC participated in theanalysisofthe predicted amino acid sequences of Vpr SM, DD and ... targeting these enzymes The viruses containing alterations may then be able to evade the inhibitory activities ofthe agents and are designated as drug-resistant variants Similarly, the mutations...
... increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave force on the cylinders not decrease linear to the wave ... on an isolated cylinder, however it oscillates around the wave force on an isolated cylinder The amplitude of oscillation is extremely large as the ratio 0.2 Due to the interaction ofthe ... in triangular array versus ratio a / D for ka 1.0 Effect of Incident Wave Angle incident wave Y X 2a D Wave force in x -direction acting on the cylinder at various incident wave angle...
... larval instar grows from a mass of about 1.2 g to about 11 g, so almost 90% ofthe final mass ofthe larva is gained during this single instar Because most ofthe body mass of Manduca accumulates ... instar, the size increment from instar to instar is constant That is, the final mass of each is a constant multiple ofthe final mass ofthe previous instar As a consequence, the mass ofa larva ... required is a measure or process that changes with the mass ofthe larva and for which the larva can measure the ratio between the current state and the state at the beginning ofthe instar Stretch...
... exception, an SIR of 1.68, was in a Japanese population and the authors state that they observed a generally higher risk of malignancies in Japanese women with RA than that reported in comparable Caucasian ... interpretation ofthe data and helped to draft the manuscript SS performed the meta -analysis, participated in the evaluation of studies for inclusion, and helped to draft the manuscript All authors read and ... cases, there was considerable variation in the calculated SIRs among the individual studies for site-specific malignancies Nevertheless, the random effects meta -analysis demonstrated an overall pattern...
... and meta -analysis of all randomised controlled trials (RCTs) of pharmacological and non-pharmacological treatments that are available in standard primary care settings and those that are administered ... fibromyalgia when comparing primary care and specialised care Our meta -analysis demonstrates that there are no differences in the overall outcome of fibromyalgia regardless ofthe level of care ... participants The studies evaluated the treatment or management of fibromyalgia as indicated by the use of recognised diagnostic criteria, such as American College of Rheumatology (ACR) [1] Page...
... HBM and MFG conceived the study HBM extracted, analysed and interpreted the data, and drafted the manuscript MFG and KBL assisted with data interpretation All authors read and approved the final ... clubfoot and tarsal coalition/congenital vertical talus procedures, and a steady decrease in the number of heel procedures (data not shown) Of particular note, there was a marked reduction in the ... surgical practice in response to: (i) research questioning the role of calcaneal spurs in the pathophysiology of heel pain [11]; or (ii) the recent availability of extracorporeal shock wave therapy...