5 12 clusters of variables found in 83 corporate codes of business ethics

The 12 factors of business success

... Success in business I Lakhani, Dave, 19 65 II Marti, Mollie Weighner III Title IV Title: Twelve factors of business success HF5386.H 653 2008 650 .1—dc22 2008 0122 36 Printed in the United States of America ... know when you are in the ballpark Setting a goal of $131,400 and earning $117,000 is an indication of high performance Setting a goal of $ 150 ,000 and earning only $1 05, 000 indicates that you ... thinkers use mind maps in brainstorming sessions and find them useful for thinking through ideas Mind mapping is also a very efficient note taking modality You can learn about mind mapping with a...

240
209
0

the blackwell dictionary of business ethics (werhane and freeman)

Danh mục: Tài chính doanh nghiệp

... dictionary of business ethics V Title: Business ethics VI Series HD30. 15 B 455 20 05 vol [HF5387] 658 ’.003 s dc22 [174’.4’03] 2004007693 ISBN for the 12- volume set 631 23317 Set in 9 .5 on 11pt Ehrhardt ... dissemination of business ethics Corruption and business ethics are two terms people tend to place together, one being 16 Africa, business ethics in conceived as the negation of the other In inde ... School of Business Adminis tration, University of Virginia Peggy A Cloninger Victoria School of Business, University of Houston Dana R Clyman (deceased) Darden Graduate School of Business Adminis...

601
566
0

Accounting ethics foundation of business ethics duska and brenda

Danh mục: Quản trị kinh doanh

... Foundations of Business Ethics Series editors: W Michael Hoffman and Robert E Frederick Written by an assembly of the most distinguished figures in business ethics, the Foundations of Business Ethics ... Co.’s Business Ethics Program: Minicase Indexes, 1992 Introduction It was a project that brought together leading thinkers of the business ethics community to develop teaching tools for use in ... major areas of concern for the ethics of accounting Determining, examining, and evaluating the purposes of activities or practices is one of the major tasks of ethics This approach to ethics is...

247
572
0

Association studies of genetic polymorphisms found in interleukins 12, 13 and CD14 gene with asthma and allergic diseases

Danh mục: Tổng hợp

... Allergy Clin Immunol IL-13 Promoter - 151 2 50 012, A704C AÆC 2000 Mar; 1 05 (3) :50 6 – 51 3 [1] IL-13 Promoter -1 112 -1 055 , -1111, C1103T J Allergy Clin Immunol CÆ T 2000 Mar; 1 05 (3) :50 6 – 51 3 [1] ... 58 oC 643bp 58 oC 619bp 58 oC 57 2bp 55 oC 649bp 55 oC 385bp 50 oC 441bp 5 – CTTCCCAGCCGCACACTTC– 3’ IL -12 Promoter 5 – GGATGGGAGGAGGCGCTC– 3’ 5 – ACACAAATCTATGGCCCTAGG – 3’ IL -12 Promoter 5 – TACATGTTCCTGTTCACGTGC ... + 252 5 GÆA 2000 Mar; 1 05 (3) :50 6 – 51 3 [1] J Allergy Clin Immunol IL-13 3’UTR 4793 + 258 0 CÆA 2000 Mar; 1 05 (3) :50 6 – 51 3 [1] J Allergy Clin Immunol IL-13 3’UTR 4962 +2749 CÆT 2000 Mar; 1 05 (3) :50 6...

118
709
0

Journal of Business Case Studies – November/December 2009 Volume 5, Number 6 13 An Apparel Brand‘s Channel Strategy: The Case of Oliver in Korea

Danh mục: Kế hoạch kinh doanh

... publications in Journal of Business- to -Business Marketing, Dr Sungmin Ryu is an associate professor of school of business at Sungkyunkwan University He specializes in the areas of channels of distribution, ... distribution, business- to -business marketing, and global supply chain management He has publications in Industrial Marketing Management, Journal of Business Research, Organization Science, Journal of Business ... commissions Taking into account sales commissions of 25% , intermediate management commissions of 15% , manufacturing costs of 30% and constant discount rates of 5% , brand suppliers‘ profitability...

10
729
1

CHAPTER 5 The Logic of Group Behavior In Business and Elsewhere

Danh mục: Chuyên ngành kinh tế

... abuse, both in terms of the number of meetings held and in terms of what business people think of most meetings Indeed, business people often chafe when the subject of committee meetings is aired, ... Airline workers took an average pay cut of 15 percent for 55 percent interest in the company and of its 12 seats on the airlines board of directors According to Business Week, worker ownership of ... During the winter of 1973-74, the United States was in the midst of an “energy crisis.” Prices of gasoline and other fuels were being held down in spite of the limited imports of fuel coming into...

50
647
0

Tài liệu Báo cáo Y học: Interallelic recombination is probably responsible for the occurrence of a new as1-casein variant found in the goat species potx

Danh mục: Báo cáo khoa học

... before the main as1-Cas peak gave a molecular mass of Ó FEBS 2002 Interallelic recombination at the as1-casein locus (Eur J Biochem 269) 129 7 18 7 15/ 18 7 95/ 18 8 75 Da (18 55 5 Da after alkaline phosphatase ... 30 s (or min) at 94 °C, annealing for 30 s (or min) at 47–60 °C, and extension for 30–60 s (or min) at 72 °C, Fig Disc-PAGE at pH 8.6 of individual whole caprine casein samples containing diﬀerent ... indicated at the top of each lane Staining was with (A) Coomassie Brilliant Blue and (B) polyclonal antibodies against as1-Cas a–e identify as1-Cas bands of the MF sample in order of increasing...

11
568
0

Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

Danh mục: Báo cáo khoa học

... p.Ala226ProfsX28 p.Glu 250 Asp Deletion of exon 12 c.76C>T c.77G>A c .51 8G>A c.610C>A c.675delA c. 750 A>T c.771 + 1G>T Exon Exon Exon 10 Exon 10 Exon 12 Exon 12 Intron 12 0.3 0.2 0. 15 46 0. 05 0 .5 – Kauppinen ... measured in urine hospital (values not available) b m.i.b 206 8 35 906 919 250 5 < 80 m.i.b 494 53 4 3488 1 050 1 754 < 200 Data collected in local county segment is connected to the rest of the protein ... Elder GH (1993) Acute intermittent porphyria caused by an arginine to histidine substitution (R26H) in the cofactor binding cleft of porphobilinogen deaminase Hum Mol Genet 2, 13 15 1316 22 Delfau...

10
587
0

– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to ﬁnding the pptx

Danh mục: Kỹ năng nói tiếng Anh

... 40% of 60 is 24 Example: Finding what percentage one number is of another: What percentage of 75 is 15? # 15 75 = % x _ 100 Cross multiply: 15( 100) ϭ ( 75) (x) 1 ,50 0 ϭ 75x 1 ,50 0 75x ᎏᎏ ϭ ᎏᎏ 75 ... distribution of the following data set that represents the number of students enrolled in 15 classes at Middleton Technical Institute: 12, 10, 15, 10, 7, 13, 15, 12, 7, 13, 10, 10, 12, 7, 12 x f 10 12 ... SECTION – M IDPOINT To ﬁnd the midpoint of a segment, use the following formula: x +x y +y Midpoint x = ᎏᎏ 2 Midpoint y = ᎏᎏ Example: Find the midpoint of the segment AB B (5, 10) Midpoint (1,2) A...

25
410
0

Báo cáo sinh học: "Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" potx

Danh mục: Hóa học - Dầu khí

... metalloproteinases, neuroepinephrine, renin, galectin-3 [16-18], some of which are also important tools in the diagnosis and pathogenesis of heart failure, in the identification of subjects at risk of heart failure, ... 100 * 60 50 25 45 * 30 * IL-6 (pg/ml l) * 75 IL-8 (pg/ml) ) IL-9 (pg/ml) ) C NIDCM * 270 15 ICM NIDCM 30 15 0 C * 45 C ICM NIDCM C ICM NIDCM Figure Cytokine plasma levels increased in ICM and ... NIDCM groups Interestingly, the cytokines that were identified in the present study are part of a gene network of expression/ function regulation that link them to Norepinephrine, Endothelin-1, IL-1A,...

7
424
0

Báo cáo hóa học: " Inhibition of G1P3 expression found in the differential display study on respiratory syncytial virus infection" docx

Danh mục: Hóa học - Dầu khí

... infection dbEST_Id Clone_Id GenBank_Accn Homolog definition Description of the best hit/UniGene ID 169 3833 7 169 3832 6 No 169 3833 3 169 3833 6 169 3833 4 No 169 3833 2 169 3833 8 169 3832 9 169 383 35 169 3832 7 ... 3 857 640/metabolism flavop protein Hs.3 7126 4 Hs.187416 Hs.198273 Hs.3631 Hs.1043 15 SUR-8 mRNA Phospholipase C, gamma (Plcg1) Hs.10 458 TATA box binding protein Hs.2 052 9 Hs.426977 Hs. 3833 74 HSPC129 ... replication induces potent expression of chemokines, so the epithelium is postulated to be a primary initiator of pulmonary inflammation in RSV infections [3] The presence of eosinophil cationic protein...

7
360
0

báo cáo hóa học:" Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" pptx

Danh mục: Hóa học - Dầu khí

... metalloproteinases, neuroepinephrine, renin, galectin-3 [16-18], some of which are also important tools in the diagnosis and pathogenesis of heart failure, in the identification of subjects at risk of heart failure, ... 100 * 60 50 25 45 * 30 * IL-6 (pg/ml l) * 75 IL-8 (pg/ml) ) IL-9 (pg/ml) ) C NIDCM * 270 15 ICM NIDCM 30 15 0 C * 45 C ICM NIDCM C ICM NIDCM Figure Cytokine plasma levels increased in ICM and ... NIDCM groups Interestingly, the cytokines that were identified in the present study are part of a gene network of expression/ function regulation that link them to Norepinephrine, Endothelin-1, IL-1A,...

7
333
0

Horsley et al. Journal of Orthopaedic Surgery and Research 2010, 5:12 doc

Danh mục: Hóa học - Dầu khí

... Science in Sports and Exercise 1999, 31 (5) :50 7 25 Herrington L, Payton CJ: Effects of corrective taping of the patella on patients with patellofemoral pain Physiotherapy 1997, 83( 11) :56 6 -57 2 26 ... maintain the correct humeral-glenoid alignment could then be responsible for causing a SLAP lesion within the glenohumeral joint [52 ] Interestingly, the findings of this study would appear to indicate ... Conley , et al: Non invasive Analysis of Human Neck Muscle function Spine 19 95, 20: 250 5- 251 2 23 Powers CM: Patellar Kinematics, Part 1: The influence of vastus muscle activity in subjects with and...

10
401
0

báo cáo hóa học:" Reliability and validity of Thai versions of the MOS-HIV and SF-12 quality of life questionnaires in people living with HIV/AIDS" pot

Danh mục: Hóa học - Dầu khí

... - 50 0 17 .5% 16.7% 14 17.1% > 50 0 CD4 cell count Median 2 .5% 9 .5% 6.1% 26 - 64 Median 209.0 174 .5 189. 25 ± 138.80 246.00 ± 177 .50 218.32 ± 161.36 Min - Max -55 0 17 - 700 - 700 Median 15. 0 10 .50 ... Number of items Mean Median SD a 25% 75% % Floor % Ceiling Physical Health Summary Score (PHS) n/a 53 .1 54 .6 7.2 0 .54 50 .28 58 .91 0 Mental Health Summary Score (MHS n/a 53 .4 54 .9 0 .51 48.31 58 .01 ... educational attainment with 60.0% of those completing each QOL battery having finished at least primary education The majority of individuals - 58 .0% of those completing the MOS-HIV and 56 .0% of those...

9
426
0

Báo cáo hóa học: " Evaluation of the diagnostic indices and clinical utility of qualitative cardiodetect® test kit in diagnosis of ami within 12 hours of onset of chest pain in the emergency department" pptx

Danh mục: Hóa học - Dầu khí

... http://www.intjem.com/content/4/1/67 Page of Figure Flow chart of the study 24 h of onset of chest pain Figure shows the initial ECG findings in the ED The majority of patients (72 .5% ) in this study ... chest pain (categorical) as in the inclusion criteria, including the timing of onset (numerical) of chest pain The dependent variables included the qualitative (positive or negative) outcome of the ... Specificity (%) ≤4h 85. 7 (58 .3-97.6) > but ≤ 12 h 50 .0 (31.6-68.3) 63.6 (40.8-81.9) 52 .0 (33.7-72.8) > 12 but ≤ 24 h - 25. 0 (3.9 -59 .8) > 24 h - 66.6 (12 .5- 98.2) PPV (%) Figure The ECG findings recorded...

9
463
0

In Search of Consistency: Ethics and Animals [Human–Animal Studies] Part 5 pptx

Danh mục: Tâm lý - Nghệ thuật sống

... church doctrines contain his teachings In the thirteenth century Thomas Aquinas revisited Augustine’s point concerning anymals, inserting ancient Greek philosophy into Christian theology Drawing heavily ... thesis, including the practices of anymal sacriﬁce and eating ﬂesh, and the biblical concept of dominion Finally, Linzey examines the New Testament, focusing on the life of Christ as a model of exemplary ... creatures of every kind: cattle and creeping things and wild animals of the earth of every kind.” And it was so God made the wild animals of the earth of every kind, and the cattle of every kind,...

56
189
0

Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx

Danh mục: Báo cáo khoa học

... Cytotoxicity and induction of proinflammatory cytokines from human monocytes exposed to fine(PM2 .5) and coarse particles(PM10-2 .5) in outdoor and indoor air Toxicol Appl Pharmacol 1999, 155 , 2 45- 252 20 ... PM10treated DNA (P

8
442
1

Báo cáo khoa học: "The combination effect of sodium butyrate and 5-Aza-2''''-deoxycytidine on radiosensitivity in RKO colorectal cancer and MCF-7 breast cancer cell lines" pot

Danh mục: Báo cáo khoa học

... Cycles Temp (°C) Time(min) p14ARF 95 62/62 30 40 72 p16INK4a 95 63/63 30 40 72 E-cadherin 95 55/ 57 30 40 72 MINT1(M1) 95 52 /52 30 37 72 MINT2(M2) 95 59 /59 30 40 72 MINT31(M31) 95 62/60 30 38 72 Statistical ... addition of sodium butyrate and 5- Aza2'-deoxycytidine In the MCF-7 cell line, 87% of the cells survived after radiation alone, 73% after adding 5- aza-DC, and 55 .7% after adding SB Thus both 5- aza-DC ... 5' -aza-2'-deoxycytidine (5- aza-DC) treatment In the control group, most of the genes were methylated, but cell lines treated with 5- aza-DC showed profound increase of demethylated bands Page of...

7
327
0

Báo cáo y học: " Replication of the genetic effects of IFN regulatory factor 5 (IRF5) on systemic lupus erythematosus in a Korean population" doc

Danh mục: Báo cáo khoa học

... 1,467 0 .51 1401 480 59 5 0.62 3 65 0.38 256 266 0 .52 246 137 0.63 81 0.37 Controls 121 116 0.48 126 Cases 2 ,839 3,193 0 .56 2,4 85 1. 85 × 10-23 0.44 3,8 35 3 ,57 7 0.47 4,093 0.0002 0 .52 Controls Combined ... 309 0 .54 259 0.46 1 .52 (1.20–1.93) 0.000 35 279 2 45 0.44 313 0 .56 Cases 444 55 9 0.63 329 0.37 1.42 (1.18–1.71) 0.00016 54 1 58 9 0 .54 493 0.46 156 0.38 254 284 0 .56 224 Cases 7 25 879 0.61 57 1 0.39 ... No Shin et al Table Case-control association analysis of the IRF5 rs2004640 (G > T) T allele with SLE n OR ( 95% CI) Pa Cases 58 9 454 0.3 85 724 0.6 15 1.32 (1.14–1 .54 ) 0.0003 950 610 0.321 129 0...

5
244
0

ADAM10 is expressed in human podocytes and found in urinary vesicles of patients with glomerular kidney diseases pptx

Danh mục: Báo cáo khoa học

... the involvement of the Notch pathway in the development of glomerular disease [ 15] In summary our finding that ADAM10 is expressed in podocytes and found in elevated levels in the urine of patients ... occur in many glomerular diseases [21] To injure podocytes we treated the cells with different concentrations of puromycin Interestingly, increasing amounts of puromycin induced L1-32 in podocytes ... profiling of ADAM12 in human bladder cancer Clin Cancer Res 2006, 12: 7 359 -7368 doi: 10.1186/1423- 0127 -17-3 Cite this article as: Gutwein et al., ADAM10 is expressed in human podocytes and found...

9
216
0