2 the binary deposit insurance dummy is replaced by a dummy variable taking the value of zero for observations with no deposit insurance the value of one for observations with deposit insurance but interest rat
... 29 , 365–377 Biswas, G., Adebanjo, O .A. , Freedman, B.D., Anandatheerthavarada, H.K., Vijayasarathy, C., Zaidi, M., Kotlikoff, M & Avadhani, N.G (1999) Retrograde Ca2+ signaling in C2C 12 skeletal ... indicate the a- F1-ATPase GAF/Adf-1 binding cassette has enhancer properties (A) The basal promoter activity of b-F1-ATPase is greatly increased when the a- F1-ATPase GAF/Adf-1 binding cassette is ... the a- F1-ATPase mRNA (A) Northern blots of mRNA from different stages of D melanogaster embryogenesis and in adults using the a- F1-ATPase cDNA as a probe Two different types of mRNAs are seen albeit...
... bacterial and mammalian templates P falciparum Glu295 aligns with an Asp in mammals (human arginase II: Asp 223 ; rat arginase I: Asp204), fungi and bacteria (B caldovelox arginase: Asp199) In the other ... falciparum are His193, Asp216, Asp 220 and Asp 323 The second metal, Mn2+B is co-ordinated by His 126 , Asp 124 , Asp2 32, Asp234 and the bridging solvent in a distorted octahedral geometry in rat I arginase ... monomer via partner residues that not align in sequence in the mammalian and bacterial templates In mammalian arginases, the Asp 223 ⁄ 20 4x (rat arginase I ⁄ human arginase II) cognate forms an...
... Ala-Pro-pNA Suc-Ala-Pro-pNA Gly-Pro-pNA Cbz-Gly-Pro-pNA Ala-Ala-pNA Ala-Phe-pNA Gly-Glu-pNA Gly-Arg-pNA Ala-Ala-Pro-pNA Ala-Phe-Pro-pNA Ala-Ala-Ala-pNA Pro-Leu-Gly-pNA Ala-Ala-Phe-pNA Suc-Ala-Ala-Phe-pNA ... inability ofthe peptidase to hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reasonable rates clearly indicates exclusive cleavage ofthe anilide bond of Ala-Ala-Val-Ala-pNA ... enhanced bythe addition of small amounts of CaCl2 For instance, Ala-Pro-pNA was hydrolysed in the presence of 50 lM Ca2+ at double the normal rate Further increasing the Ca2+ concentration had...
... classical concepts came from a critical reappraisal ofthe lung morphology characterizing experimental models of ARDS [10], and from the analysis of data from computed tomography examination of ... reaeration of nonaerated parts ofthe lung (recruitment), but also simultaneous end-expiratory hyperinflation of aerated pulmonary areas [22 -24 ] Recruitment and hyperinflation also occur simultaneously ... HJ, Halter JM, Gatto LA, Dasilva M, Amato M, McCann UG, Nieman GF: Tidal volume increases not affect alveolar mechanics in normal lung but cause alveolar overdistension and exacerbate alveolar...
... medium, and DNA was isolated at 24 , 48 and 72 h following serum stimulation and analyzed by agarose gel electrophoresis Preparation of cytoplasmic and nuclear extracts Cytoplasmic and nuclear extracts ... period of days (C) Confluent monolayers of HaCaT Neo and HaCaT c-fos cells were cultured for 24 , 48 and 72 h in the presence of serum, and DNA isolated from floating and attached cells was analyzed by ... cell clones [29 ,30] HaCaT NeoT, HaCaT sCLU and HaCaT Bcl -2 cells were treated with increasing concentrations of VOSO4 for 24 h HaCaT NeoT and HaCaT sCLU cells displayed marked morphological changes...
... due to the specific amino acid change is show as DDa (D) A graphic representation ofthe data incorporating results from analyses ofthe propeptide of V5-tagged wild-type PCSK9 The ratio of unmodified ... spectra isthe observed and calculated (in parentheses) molecular masses for each mutant in its SO 42) and SO 42) + PO 42) forms, as well as the major molecular form observed Mutations E4 8A and E48D ... 14000 SO 42 ACS 10 120 00 120 00 14000 14000 Mass/charge (m/z) 11000 125 00 120 00 14000 SO 42 137 82. 9 Da (137 92. 5 Da) 13 822 .2 Da (13 821 .5 Da) 13 822 .3 Da (13 821 .5 Da) 13853.3 Da (13849.5 Da) PO 42 13864.0...
... arthritis patients witha high degree of accuracy These data suggest that the pathological mechanisms operating at the onset of clinically apparent RA are distinct from those in other early inflammatory ... inflammatory arthritis and (panel d) established RA In other studies comparing early RA (defined as a symptom duration of
... The practical limit of detection for plasma samples was approximately ng/mL (100 pg/injection) Statistical analysis Data were analyzed witha two-way analysis of variance (ANOVA) with group and ... final approval ofthe article SRM was responsible forthe analysis and interpretation ofthe data, and critical revision ofthe article HHA was responsible forthe collection and assembly of data, ... was responsible forthe study design, collection and assembly of data, analysis and interpretation ofthe data, drafting ofthe article, critical revision ofthe article, final approval of the...
... were not affected by HCD (Figure 8B and 8C) However, HCD increased plasma SAA as seen by others [20 ], and plasma CD14 was induced (Figure 8A) L-alanine :2- oxoglutarate aminotransferase, ALT Although ... Plasma cholesterol was measured with Infinity Cholesterol Reagents (Sigma-Aldrich, Inc., St Louis, MO) Plasma alanine :2- oxoglutarate aminotransferase (ALT), aspartate aminotransferase (AST) were ... was assessed from digital images with analysis software (UVP-Labworks Analysis), normalized to β-actin expression in each sample The densitometric ratio of target mRNA signal to β-actin signal...
... Brady et al degradation ofthe autophagosomes and cargo by lysosomal proteases [2, 3] The autophagic pathway is crucial for maintaining cell homeostasis and disruption to the pathway can be a ... fusion with lysosomes rather than an upregulation of autophagic activity [21 ] Lysosomal degradation of LC3-II is regarded as a more accurate reflection of autophagic activity, and therefore the accumulation ... luminal Ca2+ suggests that transient S ⁄ ER Ca2+ release may be a necessary cofactor for activation of autophagy In this scenario, depending on the nature of amplitude and duration of Ca2+ release...
... by immunohistochemistry in brains of rats injected intrastriatally with KA Two days after unilateral injection of KA, BNIP3-immunopositive neurons were present in striatal areas adjacent to the ... immunoblotting for BNIP3 was completely blocked bythe BNIP3–GST protein A nonspecific 62 kDa band was detected in all ofthe striatal samples Quantification ofthe bands withthe b-actin bands as ... decreased cell death caused by glutamate toxicity by 42% (P < 0.01), whereas actinomycin D alone did not affect cell death rates FEBS Journal 27 8 (20 11) 134–1 42 ª 20 10 The Authors Journal compilation...
... followed bya breeching ofthe blood-brain barrier that is especially severe after administration of MIP -2[ 21] and may further contribute to inflammation by causing indiscriminate entry of leukocytes ... of MIP -2 witha monoclonal antibody attenuated infiltration ofthe CNS with PMNs[11] The origin of MIP -2 in inflammatory CNS disorders has not been fully defined, but in EAE astrocytes, appear ... pGL3-MIP -2: A 537 base pair MIP -2 fragment was prepared by amplifying rat genomic (kidney) DNA using the primers: 5'GCCCACCGAGTCTCTGTTTC3' (forward) and 5'GTTGGTGGCCAGCAGGAGGA3' (backward), then...
... expressed as the mean values ± standard deviation ofthe mean (SD) Statistical significance of differences between groups was analyzed by using ANOVA analysis P < 0.05 was considered statistically ... proliferation, apoptosis and differentiation of human neuroblastoma cells Cancer Lett 20 07, 24 6(1 -2) : 122 - 128 14 Izdebska M, Grzanka A, Szczepanski MA, Litwiniec A: Selected mechanisms ofthe therapeutic ... Waxman S: Mechanisms of action of arsenic trioxide Cancer Res 20 02, 62( 14):3893-3903 Evens AM, Tallman MS, Gartenhaus RB: The potential of arsenic trioxide in the treatment of malignant disease:...
... sites One patient had a history of an esophagus carcinoma, a basal cell carcinoma, and a melanoma; another one suffered from a prostate and a bladder carcinoma, and one patient experienced a colon ... apoptosis in both an ataxia telangiectasia mutated (ATM)dependent and an ATM-independent manner Mol Cell Biol 20 02, 22 (18):6 521 - 32 Takai H, Naka K, Okada Y, Watanabe M, Harada N, Saito S, Anderson ... of CHK2 in the carcinogenesis of SCCHN remain to be an interesting matter for future investigations Abbreviations ATM: ataxia telangiectasia-mutated protein kinase; ATR: ataxia telangiectasia...
... obtain the Plancherel formula for this unitary representation Dinakar Ramakrishnan first studied the case for GL (2) in [Ram2] obtaining a Plancherel formula forthe archimedean and non-archimedean ... Whittaker functions 2.2The Harish-Chandra transform 13 14 17 Chapter 3.1 The Plancherel measure of L2 (G) 3 .2 The discrete spectrum of L2 (N0 \ G; ψ) 3.3 The proof of Lemma 3 .2. 1 .2 21 22 24 25 ... , there exists an exponent such −1 that |δP (a) ν (a) | = In this case, using Lemma 2. 1 .2. 1 and arguing as in Theorem 2. 2.1.5 we obtain the result 2.2The Harish-Chandra transform ¯ 2. 2.1 If P is...
... Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1 323 to - 129 9) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429 -bp ... 5’- AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1 323 to - 129 9 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part ... Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic peptide, a novel cardiac hormone Lancet 1990; 335: 801 -2 Ogawa Y, Itoh H, Tamura N, et al Molecular cloning ofthe complementary DNA and...
... islands ofthe Taino The “little war” is played bythe Ani’ Yun’-wiya, the Pansfalaya, the Southeastern Cities, and had spread to their neighbors the Taunika, Timacua, Tsoyaha, and others It was also ... to learn their game “little war,” the stick ball game so popular in this part ofthe land My grandfather mentioned it in his narrative as well as the ball game ofthe south They are nothing alike ... rugged face and the clear eyes of an honest man He served as the shaman forthe town and had the highest regard for my father His wife was Ghigooie, a small pleasant woman with piercing eyes and a...