1 75 the cross section of the post shown in figure p1 73 is an equilateral triangle with each side of dimension a if the averag
báo cáo khoa học: " Does dissemination extend beyond publication: a survey of a cross section of public funded research in the UK" potx
... research dissemination does enhance the uptake of research findings in policy and practice Summary Researchers recognise the importance of, and appear committed to, disseminating the findings of ... deduplicated resulting in a total survey sample of 536 potential participants Page of Table Reasons for disseminating the findings of research Reason Raise awareness of findings N (%) 216 (93) Influence ... researchers working across the UK are disseminating the findings of their research Although we are aware of studies that explore the nature of dissemination activity in other countries [13 ,14 ],...
- 8
- 323
- 0
Idiosyncratic risk and the cross section of REIT returns
... variance of the regression residuals as idiosyncratic variance Also, they find there is a dramatic increase over time in the idiosyncratic variance in 19 90s that is not explained by any of the ... ARCH models are attractive because the mean and variance equations are estimated jointly and it implicitly assumes that investors update their estimates of the mean and variance of returns each ... can be explained by the interaction of two reinforcing factors: a dramatic increase in the number of new listings and a simultaneous decline in the age of the firm at IPO; since the equity of...
- 113
- 471
- 0
Thuyết trình hồi QUI CHÉO tỷ SUẤT SINH lợi kỳ VỌNG của CHỨNG KHOÁN the cross section of expected stock returns
... dung Black, Jensen Scholes (19 72); Fama MacBeth (19 73) Giai đoạn 19 48 -19 68 Tương quan dương TSSL tb chứng khoán β Reinganum (19 81) Giai đoạn Lakonishok Shapiro 19 63 -19 90 (19 86) Tương quan dương ... Chan, Hamao, Lakonishok (19 91) Nhật Bản BE/ME, có vai trò quan trọng Mĩ Tỷ số E/P giúp giải thích hồi qui chéo TSSL trung bình Basu (19 83) LÝ DO NGHIÊN CỨU Nghiên cứu Ball (19 81) Chan Chen (19 91) ... danh mục theo quy mô tương quan cao (-0.988 liệu), kết ý ngh a Sau đó, chia nhỏ danh mục quy mô d a hệ số β pre-ranking, tìm mối quan hệ mạnh mẽ tỷ suất sinh lợi trung bình quy mô, mối quan hệ tỷ...
- 44
- 603
- 7
Bài dịch hồi QUI CHÉO tỷ SUẤT SINH lợi kỳ VỌNG của CHỨNG KHOÁN the cross section of expected stock returns
... hình thành 12 danh mục Qua phân vị quy mô β Bốn danh mục (cực) ( 1A, 1B, 10 A, 10 B) chia phân vị ph a ph a thành Bảng II cho thấy danh mục hình thành d a theo quy mô, quan sát mối liên quan âm quen ... 7 /19 63 đến 12 /19 90 Vào cuối năm t -1, 12 danh mục tạo lập d a phân vị giá trị BE/ME E/P Các danh mục từ 2-9 bao gồm phân vị biến xếp hạng Hai nhóm danh mục đầu cuối ( 1A, 1B, 10 A, 10 B) chia hai ... riêng lẻ A Danh mục quy mô Bảng AI: TSSL trung bình, Post- Ranking βs hồi quy Fama-MAcBeth hệ số góc danh mục quy mô sàn chứng khoán NYSE :19 41- 1990 Vào cuối năm t -1, cổ phiếu chia thành 12 danh mục...
- 44
- 599
- 10
Báo cáo hóa học: " Research Article Estimation of Radar Cross Section of a Target under Track" potx
... window at scan and stops in average around at scan 11 for SNR = 16 and at scan for SNR = 32 As discussed earlier, the stopping causes to lose the quality information and increase the estimation ... start to increase at scan and at scan This explains the reason that the “undershoot” occurs at scan and scan 9, respectively, for SNR = 16 and 32 The transient “dynamics” of ML(N = 10 ) in Figures ... This explains why the error starts to increase at scan and scan 9, and it increases until scan 11 and scan 10 to generate the “overshoot” for SNR = 16 and 32, respectively The transient “dynamics”...
- 6
- 292
- 0
Báo cáo y học: "Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation" pdf
... intracellularly in cells 1, 5, and 10 of each of the 20 parallel chains of the cardiac bundle The order of firing for panel A (cells and 10 of each chain) is given by the inset table at the lower ... gj-channels The first trace is the superimposition of the 20 APs from cell #1 of each chain The remaining traces are identified in the table inserted into this panel (A) The total propagation ... number of gap-junction (gj) channels inserted at the cell junctions in each chain This number was varied from to 1, 10 and 10 0, with each gj-channel assumed to be 10 0 pS Another variable was the value...
- 9
- 197
- 0
Báo cáo khoa học: Completing the hypusine pathway in Plasmodium Deoxyhypusine hydroxylase is an E-Z type HEAT repeat protein docx
... was digested with NdeI and BamHI, the amplification was performed with primers DOHH expressfor 5¢AAAAAACATATGGAGAAAATAAC-3¢ and DOHH expressrev 5¢-AAAAGGATCCCTAGTGAACCTCTATAG ATATT-3¢ The restriction ... chromatographically using a His6-tagged apoprotein and the resulting increase in absorption and band-shift can be followed spectroscopically Phycocyanin can also add to the acceptor protein spontaneously, ... antimalarials are limited by factors ranging from parasite resistance to safety, compliance and cost Innovations in medicinal chemistry are presently lacking Plasmodium falciparum and Plasmodium...
- 11
- 491
- 0
Báo cáo y học: " Intramuscular myxoid lipoma in the proximal forearm presenting as an olecranon mass with superficial radial nerve palsy: a case report" doc
... examination confirmed the diagnosis of a lipoma (Figure 1) with myxoid change (Figure 2) and no evidence of malignancy Post- operative examination confirmed a normal neurovascular examination with ... forearm fascia originating within the most proximal portion of the extensor group There was no invasion of the local muscle tissue and his elbow capsule was intact and uninvolved Histopathological ... Surg 19 97, 6 (1) :49-54 doi :10 .11 86 /17 52 -19 47-5-3 21 Cite this article as: Lewkonia et al.: Intramuscular myxoid lipoma in the proximal forearm presenting as an olecranon mass with superficial radial...
- 4
- 363
- 0
Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt
... CTTCAACAGACAAGTCC AGCAATACTAGTTTTATA CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG AGGAGATCTGCGACTAACTCATCAGAGG GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCG ... REPDEL -1 REPDEL-2 REPDEL-3 ALA-4 REP 4A REP4B ACMHIS AcmArevnru AcmAFsca AcmArep2F AcmArep3F AcmAreveco CGCGAATTCAGATTATGAAACAATAAG CGCGAATTCTTATGTCAGTACAAGTTTTTG CGCGAATTCCTTATGAAGAAGCTCCGTC CTTCAACAGACAAGTCC ... pGK13 D1 pGK13 D1 pGKAL1 D1 pGKAL3 D1 pGKAL4 D1 pGKAL5 D1 pGKAL6 D1 pGKAL7 A3 ) A3 A2 A1 A0 A1 .5 A4 32.6 15 .2 36.7 29.3 18 .8 15 .6 18 .6 21. 1 16 .9 0.3 19 .8 13 .3 0.4 0.3 1. 6 4.9 A C A A B C B A 3.1...
- 15
- 460
- 0
Báo cáo toán học: "Dense Packings of Equal Disks in an Equilateral Triangle: From 22 to 34 and Beyond" pptx
... 0. 211 32486540 518 7 10 15 11 t17b36 0.20 873 512 9 2757 50 15 17 12 13 12 10 t17b42ns 36 bonds 15 t1 7a4 3 14 16 43 bonds 16 14 13 13 11 0. 211 32486540 518 7 12 t1 7a4 2 0. 211 32486540 518 7 17 13 0.20 873 512 9 2757 50 16 14 10 ... journal of combinatorics (19 95), #A1 17 22 10 15 22 11 19 10 18 13 11 12 16 23 19 13 21 18 14 17 52 bonds 0 .17 4962364462008 21 16 19 15 20 14 19 23 13 10 17 13 11 14 23 18 52 bonds 16 22 11 23 12 ... the packing This labeling is nonessential; it is assigned in order to facilitate referencing 16 12 11 17 13 10 14 14 14 11 10 17 11 15 16 9 10 16 15 12 t1 7a4 0 40 bonds 15 12 17 42 bonds 0. 211 32486540 518 7...
- 39
- 280
- 0
Báo cáo toán học: "H-Decompositions of r-graphs when H is an r-graph with exactly 2 edges" ppt
... by pairing these edges, leaving exactly one single edge if and only if Kn has an odd number of edges Case II: Assume that Kn 1 has an odd number of edges Then F has an element that is a single ... column, leaving exactly one single edge if and only if Kn has an odd number of edges Case II: Assume that Kn 1 has an odd number of edges Then F has an element that is a single edge, say xyz with ... = and n = 5, we can see r 1 by inspection that G3 contains a perfect matching If r = and n ∈ {7, , 11 } then Theorem 2.5 holds so G3 has a Hamiltonian cycle Suppose that r = and n 12 or 1 ...
- 8
- 240
- 0
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc
... Untreated B HA HA-ASF WT HA-ASF ΔRS1 HA-ASF ΔRS2 HA-ASF FF-DD TIAR Arsenite D Merged HA TIAR Merged HA-ASF/SF2 HA-ASF ΔRS1 HA-ASF ΔRS2 HA-ASF FF-DD HA-ASF W13 4A HA-ASF W13 4A HA-ASF FF-DD W13 4A HA-ASF ... (HA)-tagged candidates in 293T cells and Flag-IP products were analyzed by western blot analysis with anti-Flag and anti-HA sera The specificity of the interactions was evaluated by IP of the unrelated ... transfected with the DNA constructs encoding the HA-tagged interacting candidates and were treated with arsenite (1 mM for 30 min) Cells were fixed and stained with mouse anti-HA and goat anti-TIAR sera...
- 19
- 666
- 0
Báo cáo khoa học: End-damage-specific proteins facilitate recruitment or stability of X-ray cross-complementing protein 1 at the sites of DNA single-strand break repair docx
... 39 81 32 Lan L, Nakajima S, Oohata Y, Takao M, Okano S, Masutani M, Wilson SH & Yasui A (2004) In situ analysis of repair processes for oxidative DNA damage in mammalian cells Proc Natl Acad Sci ... USA) XRCC1 (ab144) and DNA ligase III (ab587) antibodies were purchased from Abcam Ltd (Cambridge, UK) Antibodies against rat Pol b, human APE1 and human PNK were raised in rabbit and affinity ... complexes (although we can see simultaneous crosslinking of several repair proteins on damaged DNA) Fig A model for mammalian DNA SSB repair Repair of frank strand breaks containing 3¢-hydroxyl and...
- 11
- 299
- 0
Báo cáo y học: "The effect of exogenous glucagon-like peptide-1 on the glycaemic response to small intestinal nutrient in the critically ill: a randomised double-blind placebo-controlled cross over study" pot
... radioimmunoassay, with a CV of 9.2% and 12 %, respectively Statistical analysis Data are presented as mean ± standard error of the mean Area under the curve (AUC) was calculated using the trapezoidal rule The ... for data acquisition and analysis and contributed to revision of manuscript MH was the main contributor to study conception and participated in drafting the manuscript All authors read and approved ... placebo 2568 ± 208 mmol/l min; P = 0.02) Plasma insulin Plasma insulin and insulin:glucose ratio is shown in Figures 2a and 2b There was no difference in plasma insulin concentration at baseline...
- 6
- 269
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
... topologies and both electron and muon channels added in a single hisogram The Z ′ signal with invariant mass of 1. 6TeV and the Kaluza-Klein gluon with an invariant mass of 2.0TeV are overlayed in this ... 2 .1 The Standard Model propagation mechanism The interaction of the Higgs field with the quarks and leptons is done by the Yukawa interaction terms of the Lagrangian, which provides a dynamical ... matter fields with the W and B fields in the kinetic term of the Lagrangian The gauge fields have their kinetic terms added in the gauge part of the Lagrangian as a − Wµν W µν ,a − Bµν B µν , with: i...
- 251
- 712
- 0
A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY
... completing these units Particularly, vocabulary and grammar section making up of 10 0 items are aimed at examining the amount of vocabulary and grammar that students have been instructed Reading section ... without acceptable discrimination acceptable discrimination value value Vocabulary 21 29 Grammar 29 21 Reading 25 Functional Language 19 Table 12 : Discrimination value of items in sections Table ... Language testing 2 .1. 1 What is a language test? There are a wide variety of definitions of a language test which have one point of similarity That is to say, a language test is considered as a device...
- 64
- 1,112
- 1
Getting to Know the Writing Section of the New SAT
... The best way to study the material in this book is to get active; instead of being a passive reader, interact with what you read by asking questions, taking notes, marking up passages, and making ... Did you make a careless mistake? Careless mistakes include transference errors (marking the wrong oval on the answer sheet) and simple misreading, such as mistaking one word for another When ... of paragraphs, sentence order, word choice, and grammar issues Strategies for Test Taking One of the factors cited in the coachability argument is the fact that there are methods of approaching...
- 10
- 440
- 0
Tài liệu An Introduction to the Analytical Writing Section of the GRE General Test docx
... makes this response a 14 Analyze an Argument Task Understanding the Argument Task The "Analyze an Argument" task assesses your ability to understand, analyze, and evaluate arguments and to clearly ... Examinations® Analytical Writing ANALYZE AN ARGUMENT 30 minutes You will have 30 minutes to plan and write a critique of an argument presented in the form of a short passage A critique of any other ... critique of the argument and conveys meaning adequately A typical paper in this category • identifies and analyzes important features of the argument • develops and organizes ideas satisfactorily...
- 30
- 742
- 1
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is ... cerebrospinal fluid of Malawian children with malaria J Infect Dis 18 8, 844–849 Sanni LA, Rae C, Maitland A, Stocker R & Hunt NH (20 01) Is ischemia involved in the pathogenesis of murine cerebral malaria? ... 14 -48 form the small insertion domain that comprises a short a- helix and a three-stranded anti-parallel b-sheet; the remaining protein residues form the (a ⁄ b)8 barrel domain and a C-terminal...
- 9
- 796
- 0
Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx
... 5¢-CAATGAACTCTAGAGC-3¢ 5¢-GATACTAAGTGAGCTTAAGGAGG-3¢ 5¢-CCCGACGCCGGACGAGCCCGC-3¢ 5¢-AGAAAGATCTATCTAGTGGGTTGAATTGCGGACGTTGG-3¢ 5¢-AGAAGCATGCGATCACAATTTGCTCAAATCAGTGGGCGTCGCC-3¢ This This This This This This study ... Mls1p is indeed a peroxisomal protein, electron microscopy was performed using an antiMls1p antibody that was generated against a recombinant protein comprising the C-terminal 308 amino acids of ... molecular mass of 62 000 in the lane with the wild-type extract that was absent from the lane corresponding to the mls1D mutant (arrow; Fig 1A) , thereby con®rming the speci®city of the antibody Application...
- 8
- 444
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu