... with national and international government ministers, local NHS commissioning agencies, National Institute of Health and Clinical Excellence (NICE) Appraisal Committees (and European equivalents), ... remains unclear Researchers need greater and clearer guidance on how best to plan, resource, and facilitate their dissemination activities Page of 8 10 11 12 13 Additional material Additional ... focus on the traditional academic mediums of journals and conference presentations and ad hoc use of other available communication channels was also found in our pilot of intramural MRC research...
... potential (AP) traces recorded intracellularly in cells 1, 5, and 10 of each ofthe 20 parallel chains ofthe cardiac bundle Figure Action potential (AP) traces recorded intracellularly in cells 1, ... were placed intracellularly only in cells 1, and 10 of each chain so as to limit the total number of traces to 60 The variables were: (a) the number of gj-channels placed across the longitudinal ... ms in duration, and stimulation was applied intracellularly Voltage recordings (markers placed intracellularly) were made only from cells 1, and 10 of each chain in order to limit the total number...
... capture the complexity of rationality in action.” Empirically, the CAPM meets great challenge in explaining the cross- sectionof expected stock returns In their influential paper in 19 92, Fama and ... cost of capital on individual stocks or assets The results also have practical applications for portfolio formation and performance evaluation As was shown, a portfolio manager could have realized ... securities, the “available” market portfolio that unconstrained investors can hold will be less diversified than the actual market portfolio When individual investors use the “available” market portfolio...
... Sharpe-Lintner-Black Black, Jensen, Scholes 19 72, Fama MacBeth 19 73, gần Chan Chen 19 88, kiểm định xa thích hợp Chúng kiểm tra vai trò quy mô β TSSL trung bình sàn chứng khoán NYSE n a kỷ 19 41- 1990, ... mối liên quan đơn giản tin cậy β tỷ suất sinh l i suốt giai đoạn 19 41- 1965 Có 25 năm chọn l m mẫu nghiên cứu trước mô hình SLB Black, Jensen, Scholes (19 72) Fama MacBeth (19 73) Ngay cho giai đoạn ... Nhưng bảng AIV khác biệt kết cho 19 41- 1965 19 6 619 90 la gạt Cân mạnh mẽ TSSL trung bình β hồi quy đơn khoảng thời gian 19 41- 1965 10 năm đầu, 19 41- 1950 Điều giai đoạn bảng AIV mà phát sinh l i trung...
... will assign the names phoenix and chimaera, all connected via a local area network (LAN) Let's also assume that hydra also hasa local inkjet printer connected to it, lp, and a disk share named ... NetBEUI was designed for small local area networks (LANs), and it let each machine claim a name (up to 15 characters) that wasn't already in use on the network By a "small LAN," we mean fewer than ... currently in use on a share on the server, including the read/write status and any locks on the files Finally, Samba reports the amount of memory it has currently allocated to the shares that it administers,...
... Cell culture Stock cultures of A2 058 melanoma cells were grown in 15 0 -mm culture plates in Dulbecco’s Modified Eagles Medium (DMEM) containing 10 % fetal bovine serum, L- glutamine, and penicillin/streptomycin ... N-terminal kinase, and nuclear factor kappaB: differential regulation of collagenase and collagenase Arthritis Rheum 43, 8 01 811 17 Buttice, G., Duterque-Coquillaud, M., Basuyaux, J.P., Carrere, ... promoter inthe presence of increasing amounts of Fra1 may be due to the effects of Fra -1 on the proximal AP -1 site The greater increase inthe induction ofthe 2G promoter may result from Fra -1 acting...
... Isolation and functional characterization of cDNA of serum amyloid A- activating factor that binds to the serum amyloid A promoter Mol Cell Biol 18 , 732 7 733 5 Bossone SA, Asselin C, Patel AJ & Marcu ... Isolation, cloning and sequencing ofthe SAF-3 splice variant A kgt -11 cDNA library was prepared using mRNAs isolated from IL-1b-induced human HTB-94 cells The library was screened using an SAF -1 ... gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 17 2 CAACAAAGgtacatgc 13 35 ctgtgcagGTACTGGTG 10 28 utilized for the primer extension reaction, and indicated several possible transcription start...
... Pellegrini-Giampietro DE, Luneia R & Pellicciari R (19 97) Pharmacological characterization of 1- aminoindan -1, 5dicarboxylic acid (AIDA), a potent mGluR1 antagonist J Pharmacol Exp Ther 2 81, 7 21 729 12 Pellegrini-Giampietro ... PARP -1 in endothelial cells Under conditions of chronic hypoxia, PARP -1 activation within endothelia triggers cell proliferation and slowly developing brain damage The molecular mechanisms of cell ... mitogen-activated protein kinase kinase ⁄ extracellular regulated protein kinase with cell cycle activation [34] Conversely, during ischemia, PARP -1 hyperactivation causes endothelial cell death The latter...
... ina number of animal models of organ transplantation, including kidney [10 ], liver [11 ], heart [12 ] and small bowel [13 ], by virtue ofthe products ofthe reaction it catalyzes [14 ] Bilirubin ... Harrison et al in DMEM-F12 with glutamax, penicillin (10 0 UÆmL )1) , streptomycin 10 0 lgÆmL )1) (all Gibco), 1 insulin ⁄ transferrin ⁄ selenium, dexamethasone (35.7 ngÆmL )1) and epidermal growth factor ... transcriptional activation of HO -1 ina rat model of hypoxia [45] and rat renal medullary cells [46] In addition, we have previously reported an associative increase in HIF -1 DNA binding and HO -1 induction...
... 23 aa 16 aa 38 aa 6 815 bp 19 59 bp 23 aa Exon 3262 bp 7629 bp 23 aa Intron 38 aa 16 aa 4 313 bp 38 aa 2925 bp 16 aa 4328 bp Fig Alignment ofthe amino acid sequences ofthe fish and mammalian CRABPIs ... R.-Z Liu et al Duplicated crabp1 genes in zebrafish A B Exon Intron 24 aa Exon Intron 60 aa Exon 5828 bp 23 aa 60 aa 60 aa 38 aa 60 aa 16 aa 12 22 bp 38 aa 2277 bp 60 aa 511 bp 16 aa 747 0 bp 3453 ... (25–35%) (data not shown) The crabp 1a and crabp1b genes arose from a fish-specific chromosomal duplication Phylogenetic analysis ofthe mammalian and fish cellular retinoid-binding proteins revealed two...
... structure reveals a number of close intermolecular contacts including interactions between the guanine amino groups and the terminal distamycin atoms Such amino-group interactions are often assumed ... No of nonsolvent atoms No of water molecules ˚ Average B values of DNA (A2 ) ˚ Average B values of distamycin (A2 ) ˚ Average B values of water molecules (A2 ) ˚ Rmsd of bond lengths (A) Rmsd of ... chemical calculations Ab initio quantum chemical calculations were used to investigate intrinsic molecular interactions ofa number of close intergroup contacts observed inthe crystal Special attention...
... adrenal glomerular cells, both intracellular calcium and receptor induced an increase in Ins (1, 4,5)P3 [18 ] In both MDCK and CHO cells, the apparently synchronized oscillation of intracellular calcium ... Biol 1, 11 – 21 Carafoli E (2002) Calcium signaling: a tale for all seasons Proc Natl Acad Sci USA 99, 11 15 11 22 Irvine RF & Schell MJ (20 01) Back inthe water: the return ofthe inositol phosphates ... Supplementary material The following supplementary material is available online: Fig S1 Effect of INPP 5A expression on the levels of calcium and Ins (1, 4,5)P3 in PC12h cells following mAChR activation...
... a COX IV NRF -1 b-actin a Antisense primer (5¢)3¢) GenBank acc no AGAAGGCGCTGAAGGAGAAGGA ATGGGCCAATGTCCGCAGTGATGTC GAACCCTAAGGCCAACCGTGAAAAGAT CCAGCATGCCGAGGGAGTGA GGTGGCCTCTGATGCTTGCGTCGTCT ACCGCTCGTTGCCAATAGTGATG ... the ratio between multilocular and unilocular cells in subcutaneous fat of young animals, neither induced multilocular cells in white fat depots of adult mice [16 ] The mean diameterofthe unilocular ... cells are weakly stained for UCP1 (arrows) (B) The depot is composed of unilocular and multilocular adipocytes Most ofthe multilocular and some ofthe unilocular cells (arrows) are intensely...
... various relationships, including trivial or hallucinated ones The therapist stimulates that preoccupation in hope of eliciting tangential associations to the relationship that matters Inthe earlier ... is in effect Statistical analysis plan The statistical analysis plan was developed to test the hypothesis for greater reduction of symptoms inthe experimental group than the control group Analysis ... old relationships or in new ones Laddis Annals of General Psychiatry 2 010 , 9 :19 http://www.annals-general-psychiatry.com/content/9 /1/ 19 until after in- therapy lessons accumulate They all promise...
... spectrophotometrically High-quality RNA for use inthe microarray analysis was confirmed by analysis inthe Agilent 210 0 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) Microarray analysis Total mRNA (10 ... Hapln1, and Col 2a1 , proteases Mmp-9 and Mmp -12 , as well as the inflammatory cytokine macrophage Csf -1 (Figure 3) TNF decreased Agc1 and Hapln1 (Figure 3a, b) and increased Mmp-9 and Mmp -12 (Figure ... Pretreatment of cells with U 012 6 attenuated the increase in complex formation of Available online http://arthritis-research.com/content /11 /1/ R8 Table Extracellular space genes regulated at least 1. 45-fold...
... products as a novel marker of oxidative stress in uremia Kidney Int 19 96, 49 :13 04 -13 13 21 Shahin AA, Anwar S, Elawar AH, Sharaf AE, Hamid MA, Eleinin AA, Eltablawy M: Circulating soluble adhesion molecules ... phosphate-buffered saline, 10 lof1. 16 M potassium iodide, and 20 lof acetic acid AOPP concentrations are expressed as micromoles/litre of chloramine-T equivalents Statistical analysis Data were analysed ... (Sigma, St Louis, MO, USA) ina well and then added 20 lof acetic acid The absorbance ofthe reaction mixture was immediately read at 340 nm against a blank consisting of 200 lof phosphate-buffered...
... Quantitative variables were summarized using mean and standard deviation Categorical variables were summarized as counts and percentages Baseline analysis included all enrolled patients Statistical ... using Valsalva’s maneuver which determines an increase ofthediameterofthe veins Under ultrasoundguide in real time, a 16 -gauge needle is introduced into the last portion of internal jugular ... Ducale di Piacenza e Parma, Pro Loco Gazzola, I Fantastici Author details Oncology-Hematology Department, Hospital of Piacenza, Piacenza, Italy Department of Medicine, AUSL Piacenza, Italy 3Teaching...
... (panel B) and active TGF 1 (panel A) was maintained across all groups The substantial levels of latent TGF- 1in female rats at baseline and after CYP was accompanied by only minor levels of active ... nearly 10 0-fold higher than levels of latent TGF- 1 (Panel B) measured in bladder tissue of all groups The substantial presence of latent TGF- 1in female rats at baseline (open bars) and after ... http://www.journal-inflammation.com/content/6 /1/ 23 Figure Co-localization of TGF- 1 and iNOS in rat bladder Co-localization of TGF- 1 and iNOS in rat bladder The confocal images show iNOS (red stain) and active...