1 73 the post shown in figure p1 73 has a rectangular cross section of 2 in ° 4 in the length l of the post buried in the grou
báo cáo khoa học: " Does dissemination extend beyond publication: a survey of a cross section of public funded research in the UK" potx
... remains unclear Researchers need greater and clearer guidance on how best to plan, resource, and facilitate their dissemination activities Page of 8 10 11 12 13 Additional material Additional ... with national and international government ministers, local NHS commissioning agencies, National Institute of Health and Clinical Excellence (NICE) Appraisal Committees (and European equivalents), ... sample of 536 potential participants Page of Table Reasons for disseminating the findings of research Reason Raise awareness of findings N (%) 21 6 (93) Influence policy 19 8 (85) Influence practice...
- 8
- 323
- 0
Báo cáo y học: "Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation" pdf
... potential (AP) traces recorded intracellularly in cells 1, 5, and 10 of each of the 20 parallel chains of the cardiac bundle Figure Action potential (AP) traces recorded intracellularly in cells 1, ... 32. 9 10 10 0 10 0 0 10 10 0 0 20 00 20 00 20 00 20 00 20 20 20 20 50 800 20 0 20 0 20 00 20 00 20 0 20 20 0 20 0 20 0 20 0 46 .6 397 62. 2 386 38 .1 13.0 46 .7 397 37 .4 35 .1 2 .15 1. 86 1. 04 1. 00 1. 13 1. 17 1. 04 1. 00 ... were placed intracellularly only in cells 1, and 10 of each chain so as to limit the total number of traces to 60 The variables were: (a) the number of gj-channels placed across the longitudinal...
- 9
- 197
- 0
Idiosyncratic risk and the cross section of REIT returns
... 0. 01 0. 01 0. 01 0 . 14 0 . 14 Panel C: Random walk test for idiosyncratic risk (Ang et al 20 06) AC 0.39 0.30 0 .26 0. 21 0 .18 Q-statistic 29 .33 49 .80 66.65 80 .16 92. 04 10 3.69 11 4 .27 12 3.66 15 1 . 24 15 9.39 ... value of only 3.03 42 , and the standard deviation of GARCH beta is about one time bigger than that of OLS beta The mean of logarithm value of market capitalization (in million) is 5.6 346 , and 42 ... volatility in asset pricing has been largely ignored in the literature This is hardly surprising, given that the traditional capital asset pricing model (CAPM; Sharp, 19 64; Lintner, 19 65; Black,...
- 113
- 471
- 0
Thuyết trình hồi QUI CHÉO tỷ SUẤT SINH lợi kỳ VỌNG của CHỨNG KHOÁN the cross section of expected stock returns
... Scholes (19 72) ; Fama MacBeth (19 73) Giai đoạn 19 48 -19 68 Tương quan dương TSSL tb chứng khoán β Reinganum (19 81) Giai đoạn Lakonishok Shapiro 19 63 -19 90 (19 86) Tương quan dương TSSL tb β biến L ... dương đòn 19 48 bẩy TSSL trung bình 19 79 L DO NGHIÊN CỨU Nghiên cứu Dữ liệu Nội dung Stattman (19 80); Rosenberg, Reid, Lanstein (19 85) Mĩ, giai đoạn 19 73 -19 84 TSSL tb tương quan dương với tỷ l BE/ME ... Chan, Hamao, Lakonishok (19 91) Nhật Bản BE/ME, có vai trò quan trọng Mĩ Tỷ số E/P giúp giải thích hồi qui chéo TSSL trung bình Basu (19 83) L DO NGHIÊN CỨU Nghiên cứu Ball (19 81) Chan Chen (19 91) ...
- 44
- 603
- 7
Bài dịch hồi QUI CHÉO tỷ SUẤT SINH lợi kỳ VỌNG của CHỨNG KHOÁN the cross section of expected stock returns
... mối liên quan đơn giản tin cậy β tỷ suất sinh l i suốt giai đoạn 19 41 - 1965 Có 25 năm chọn l m mẫu nghiên cứu trước mô hình SLB Black, Jensen, Scholes (19 72) Fama MacBeth (19 73) Ngay cho giai đoạn ... Sharpe-Lintner-Black Black, Jensen, Scholes 19 72, Fama MacBeth 19 73, gần Chan Chen 19 88, kiểm định xa thích hợp Chúng kiểm tra vai trò quy mô β TSSL trung bình sàn chứng khoán NYSE n a kỷ 19 41 - 1990, ... Nhưng bảng AIV khác biệt kết cho 19 41 - 1965 19 6 619 90 l a gạt Cân mạnh mẽ TSSL trung bình β hồi quy đơn khoảng thời gian 19 41 - 1965 10 năm đầu, 19 41 - 1950 Điều giai đoạn bảng AIV mà phát sinh l i trung...
- 44
- 599
- 10
Tài liệu Using Samba-1. Learning the Samba- P1 doc
... will assign the names phoenix and chimaera, all connected via a local area network (LAN) Let's also assume that hydra also has a local inkjet printer connected to it, lp, and a disk share named ... was designed for small local area networks (LANs), and it let each machine claim a name (up to 15 characters) that wasn't already in use on the network By a "small LAN," we mean fewer than 25 5 ... a single Samba properties file: smb.conf In addition, if you want to get an idea of what each of the daemons are doing, Samba has a program called smbstatus that will lay it all on the line Here...
- 25
- 237
- 0
Tài liệu Báo cáo khoa học: Fra-1 targets the AP-1 site/2G single nucleotide polymorphism (ETS site) in the MMP-1 promoter docx
... promoter via the bipartite EtsAP1 element Mol Endocrinol 11 , 11 29 11 44 40 Robinson, M.J & Cobb, M.H (19 97) Mitogen-activated protein kinase pathways Curr Opin Cell Biol 9, 18 0 18 6 41 Selvamurugan, N ... cells, c-Fos, Fra -1, and JunD of the AP -1 family and Ets -1, Ets -2 and Elf -1 of the Ets family are expressed constitutively (Fig 3A, and data not Fra -1 and the 2G SNP (Eur J Biochem 27 0) 4 21 9 shown) ... DNA has the AP -1 site at )16 02 bp and the sequence 5¢-GGAA-3¢ at )16 07 bp, conferring a consensus ETS site Fra -1 and the 2G SNP (Eur J Biochem 27 0) 4 21 7 Fra -1 has been implicated in the regulation...
- 10
- 406
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... genes in skeletal and cardiac myocytes Mol Cell Biol 28 , 65 21 6535 42 8 6 A Ray et al 23 Ray B K, Murphy R, Ray P & Ray A (20 02) SAF -2, a splice variant of SAF -1, acts as a negative regulator of transcription ... essential for cytokine-mediated transcriptional induction of the serum amyloid A gene in nonhepatic cells Mol Cell Biol 16 , 15 84 15 94 Ray BK, Shakya A & Ray A (20 07) Vascular endothelial growth factor ... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 8 51 CTTCTCCCGgtgtgcac 40 3 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 27 7 ctcctcagAAATGTGAG 17 2 CAACAAAGgtacatgc 13 35 ctgtgcagGTACTGGTG 10 28 utilized for the primer...
- 11
- 439
- 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx
... polymerase -1 Nat Cell Biol 3, 10 35 10 42 Kraus WL (20 08) Transcriptional control by PARP -1: chromatin modulation, enhancer-binding, coregulation, and insulation Curr Opin Cell Biol 20 , 29 4 3 02 ... increase of the cytosolic Ca2+ concentration and finally nuclear translocation of mitogen-activated protein kinase kinase ⁄ extracellular regulated protein kinase with cell cycle activation [ 34] ... effects of PARP -1 activation in endothelial, muscle and glial cells, as well as in infiltrating leukocytes, are different from those FEBS Journal 27 6 (20 09) 36 45 ª 20 08 The Authors Journal compilation...
- 10
- 417
- 0
Báo cáo khoa học: Insulin induces heme oxygenase-1 through the phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in renal cells pptx
... hypoxia-inducible factor 1alpha by insulin and interleukin-1beta involves the phosphatidylinositol 3-kinase pathway FEBS Lett 5 12 , 15 7 16 2 Fukuda R, Hirota K, Fan F, Jung YD, Ellis LM & Semenza GL (20 02) Insulin-like ... oxygenase -1 in a phosphatidylinositol 3-kinase-dependent manner J Biol Chem 27 8, 13 898 13 9 04 Martin D, Rojo AI, Salinas M, Diaz R, Gallardo G, Alam J, De Galarreta CM & Cuadrado A (20 04) Regulation of ... in a number of animal models of organ transplantation, including kidney [10 ], liver [11 ], heart [ 12 ] and small bowel [13 ], by virtue of the products of the reaction it catalyzes [ 14 ] Bilirubin...
- 12
- 377
- 0
Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression doc
... et al Duplicated crabp1 genes in zebrafish A B Exon Intron 24 aa Exon Intron 60 aa Exon 5 828 bp 23 aa 60 aa 60 aa 38 aa 60 aa 16 aa 12 22 bp 38 aa 22 77 bp 60 aa 511 bp 16 aa 747 0 bp 345 3 bp 5 54 ... bp 23 aa 16 aa 38 aa 6 815 bp 19 59 bp 23 aa Exon 326 2 bp 7 629 bp 23 aa Intron 38 aa 16 aa 4 313 bp 38 aa 29 25 bp 16 aa 4 328 bp Fig Alignment of the amino acid sequences of the fish and mammalian ... detected at relatively high levels in the CNS of adult rats Am J Physiol Endocrinol Metab 28 2, E6 72 E678 Haskell GT, Maynard TM, Shatzmiller RA & Lamantia AS (20 02) Retinoic acid signaling at sites of...
- 11
- 312
- 0
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx
... bond angles (°) Crystal P 21 2 1 21 a ¼ 26 . 011 , b ¼ 40 .8 61, c ¼ 53 .16 4 27 5 24 25 38 2. 38 5.5 1. 035 ˚ 4 .1 (10 0.0 2. 38 A) ˚ 25 .1 (2. 42 2. 38 A) ˚ 92. 7 (10 0.0 2. 38 A) ˚ 93 .4 (2. 42 2. 38 A) 22 .6 ˚ 80.3 (10 0.0 2. 38 ... (10 0.0 2. 38 A) ˚ 46 .3 (2. 42 2. 38 A) P 21 2 1 21 a ¼ 25 .28 9, b ¼ 36 .43 9, c ¼ 53. 047 4 322 3 42 2 3 1. 85 4. 3 1. 1 42 ˚ 4. 9 (10 0.0 1. 85 A) ˚ 19 .5 (1. 92 1. 85 A) ˚ 93.0 (10 0.0 1. 85 A) ˚ 96.9 (1. 92 1. 85 A) 21 . 1 ˚ ... O2 C1¢, C4¢, O4¢, C2, N3 C2, N3 d(CGCAAATTTGCG) + distamycin ( 12 -dista) A4 C2, N3 A5 C2, N3 A6 C1¢, C4¢, O4¢, C5¢, C2, N3, C4 T7 C4¢ T8 O2 T9 C4¢, O4¢, C5¢ T 21 T20 T19 A1 8 A1 7 A1 6 C4¢, O4¢, C5¢,...
- 10
- 411
- 0
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... b-actin a Antisense primer (5¢)3¢) GenBank acc no AGAAGGCGCTGAAGGAGAAGGA ATGGGCCAATGTCCGCAGTGATGTC GAACCCTAAGGCCAACCGTGAAAAGAT CCAGCATGCCGAGGGAGTGA GGTGGCCTCTGATGCTTGCGTCGTCT ACCGCTCGTTGCCAATAGTGATG ... fat these multilocular cells completely disappear as the animals age These results also indicated a higher content of transgenic UCP1 in unilocular adipocytes in subcutaneous than in epididymal ... Bouillaud, F & Ricquier, D (19 94) In vitro interactions between nuclear proteins and uncoupling protein gene Ó FEBS 20 02 10 11 12 13 14 15 16 17 18 19 20 21 promoter reveal several putative transactivating...
- 10
- 555
- 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
... (6 .2) 24 .7 (5.0) Mentally overloaded, overwhelmed 4. 5 (1. 1) 2. 3 (1. 3)* 4. 5 (0.9) 3 .2 (1. 2) Vigilance 3.7 (1. 5) 2. 0 (1. 3) 4. 3 (1. 1) 2. 7 (1. 2) Circular rumination 4. 3 (1. 4) 2. 7 (1. 5)* 4 .1 (1. 5) ... 3.0 (1. 3) Helplessness and depression 4. 5 (1. 1) 3.0 (1. 1) 4. 4 (1. 1) 3 .1 (1. 1) Irrational urges 3.7 (1. 9) 1. 9 (1. 6) 4. 0 (1. 0) 2. 3 (1. 1) Intrusive flashbacks 3 .1 (2 .1) 2. 2 (1. 8) 3.7 (1. 5) 2. 5 (1. 3) ... follow-up in a trauma program J Trauma Dissoc 20 04, 5 :10 3 -11 2 Laddis Annals of General Psychiatry 2 010 , 9 :19 http://www.annals-general-psychiatry.com/content/9 /1/ 19 69 Dubin SE, Ananth J, Bajwa-Goldsmith...
- 12
- 477
- 0
Báo cáo y học: " Egr-1 inhibits the expression of extracellular matrix genes in chondrocytes by TNF-induced MEK/ERK signalling" ppsx
... spectrophotometrically High-quality RNA for use in the microarray analysis was confirmed by analysis in the Agilent 21 0 0 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) Microarray analysis Total mRNA (10 ... collagen (Col 2a1 , Rn005 649 54_ m1), aggrecan (Agc1, Rn00 57 34 24 _m1), link protein (Hapln1, Rn005698 84_ m1), matrix metalloproteinase-9 (Mmp-9, Rn0057 916 2_ m1), matrix metalloproteinase - 12 (Mmp - 12 , ... [GenBank:NM_0 318 36] Vascular endothelial growth factor A 1. 11 1.80 1. 43 * ATPase activity Tap1, Cim, Abcb2 [GenBank:NM_0 320 55] Transporter 1, ATP-binding cassette, subfamily B (MDR/ TAP) 1. 22 1. 91 2. 24 Tap2,...
- 14
- 574
- 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx
... products as a novel marker of oxidative stress in uremia Kidney Int 19 96, 49 :13 04 -13 13 21 Shahin AA, Anwar S, Elawar AH, Sharaf AE, Hamid MA, Eleinin AA, Eltablawy M: Circulating soluble adhesion molecules ... (Sigma, St Louis, MO, USA) in a well and then added 20 l of acetic acid The absorbance of the reaction mixture was immediately read at 340 nm against a blank consisting of 20 0 l of phosphate-buffered ... patients (33 women and men), with a mean age of 57 ± 12 years and a mean disease duration of ± 4. 5 years ( 21 patients had a disease duration of less than years) The clinical and laboratory data...
- 6
- 518
- 0
Báo cáo khoa học: "Ultrasound-guided central venous catheterization in cancer patients improves the success rate of cannulation and reduces mechanical complications: A prospective observational study of 1,978 consecutive catheterizations" pps
... Lymphomas 21 6 10 . 82 Acute leukemia 19 6 9. 91 Multiple myeloma 12 6 6.37 Other hematologic malignancies 42 2 . 12 neutropenia and low platelet count; neutropenia: 25 4 patients (15 .3%) with neutrophils ... to the external landmark-guided technique Circulation 19 93, 87 :15 57 -15 62 Slama M, Novara A, Safavian A, Ossart M, Safar M, Fagon JY: Improvement of internal jugular vein cannulation using an ultrasound-guided ... hepatocellular carcinoma Gut 19 90, 31( 11) :13 03-5 24 Cavanna L, Civardi G, Fornari F, Di Stasi M, Sbolli G, Buscarini E, Vallisa D, Rossi S, Tansini P, Buscarini L: Ultrasonically guided percutaneous splenic...
- 7
- 422
- 0
Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx
... (panel B) and active TGF 1 (panel A) was maintained across all groups The substantial levels of latent TGF- 1 in female rats at baseline and after CYP was accompanied by only minor levels of active ... http://www.journal-inflammation.com/content/6 /1/ 23 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 Perrella MA, Jain MK, Lee ME: Role of TGF-beta in vascular development and vascular reactivity Miner Electrolyte Metab 19 98, 24 :13 6 - 14 3 ... (endothelial NOS and neuronal NOS) as well as potentially from the stress to the animal from handling and transport to metabolic cage from animal facility These results may indicate an interplay among...
- 13
- 244
- 0
Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx
... p-values 1- 6 11 53 ± 10 3.0 11 25 ± 79.0 11 52 ± 10 2. 0 0.38b, 0 .49 c 7 - 12 13 75 ± 80.5 12 82 ± 82. 5 13 32 ± 72. 5 0 .23 7d 13 -18 15 45 ± 10 0.0 13 09 ± 89.0 15 49 ± 95.5 0. 016 d 19 - 24 15 92 ± 94. 5 12 02 ± 10 2. 5 14 97 ... with a sensitive cell line on the basis of activation of an integrated β-galactosidase gene J Virol 19 92, 66 :22 32- 223 9 11 Sharma PL, Chatis PA, Dogon AL, Mayers DL, McCutchan FE, Page C, Crumpacker ... Atlanta VA Medical Center DR is involved in HIV clinical research since past 20 years CC is Professor of Medicine at Harvard Medical School and has published several key papers in the area of...
- 12
- 369
- 0
- determinants of the cross section of hedge funds performance
- shear stresses in beams of rectangular cross section
- 1 74 the post shown in figure p1 73 has a circular cross section of 100 mm diameter the length l of the post buried in the grou
- 1 75 the cross section of the post shown in figure p1 73 is an equilateral triangle with each side of dimension a if the averag
- lumbrical muscles tendons and cross section of the middle finger
- the carpal tunnel more distal cross section of the middle finger
- cross section of the thorax third thoracic vertebra level
- tomographic cross section of the thorax the diaphragm
- the back primary rami of spinal nerves cross section of back
- high cross section of the right thigh through the neck of the femur
- neck thyroid and parathyroid glands cross section of the anterior neck
- a comprehensive cross section study for the production of mo and tc radioisotopes via proton induced nuclear reactions on natmo
- 1 add the group profile to be defined
- 2 4 a mosaic expression pattern in a cross section of the intestinal villi b c and d mosaic expression patterns of either side of an intestinal villus that is located at the margin of the donor embryo s and host embryo s derivatives
- 3 3 a cross section of intervillus spaces stained by the label retention assay of zebrafish intestinal epithelium at 16 hpt the cells incorporating in mitotic division use the available edu molecule in the intestinal lumen to pair with deoxy
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008