(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng

198 4 0
  • Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 18/10/2020, 10:20

(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng(Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng HỌC VIỆN NÔNG NGHIỆP VIỆT NAM NGUYỄN DUY HƯNG NGHIÊN CỨU THÀNH PHẦN LỒI, TÍNH GÂY BỆNH VÀ KHẢ NĂNG PHÒNG CHỐNG NẤM Colletotrichum spp GÂY BỆNH THÁN THƯ ỚT TẠI ĐỒNG BẰNG SÔNG HỒNG LUẬN ÁN TIẾN SĨ NHÀ XUẤT BẢN HỌC VIỆN NÔNG NGHIỆP - 2020 HỌC VIỆN NÔNG NGHIỆP VIỆT NAM NGUYỄN DUY HƯNG NGHIÊN CỨU THÀNH PHẦN LỒI, TÍNH GÂY BỆNH VÀ KHẢ NĂNG PHỊNG CHỐNG NẤM Colletotrichum spp GÂY BỆNH THÁN THƯ ỚT TẠI ĐỒNG BẰNG SÔNG HỒNG Chuyên ngành : Bảo vệ thực vật Mã số : 9620112 Người hướng dẫn khoa học: PGS.TS Hà Viết Cường TS Hoàng Chúng Lằm HÀ NỘI - 2020 LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu riêng tơi, kết nghiên cứu trình bày luận án trung thực, khách quan chưa công bố hay dùng để bảo vệ lấy học vị Tôi xin cam đoan giúp đỡ cho việc thực luận án cám ơn, thơng tin trích dẫn luận văn rõ nguồn gốc Hà Nội, ngày tháng năm 2020 Tác giả luận án Nguyễn Duy Hưng i LỜI CẢM ƠN Trong thời gian học tập, nghiên cứu hồn thành luận án, tơi nhận hướng dẫn, bảo tận tình thầy giáo; giúp đỡ, động viên bạn bè, đồng nghiệp gia đình; tài trợ, giúp đỡ vật chất lẫn tinh thần tổ chức cá nhân Nhân dịp này, cho phép bày tỏ lịng kính trọng biết ơn sâu sắc thầy PGS.TS Hà Viết Cường, TS Hoàng Chúng Lằm tận tình hướng dẫn, dành nhiều cơng sức, thời gian tạo điều kiện cho suốt trình học tập thực đề tài Tơi xin bày tỏ lòng biết ơn chân thành tới Ban Giám đốc, Ban Quản lý đào tạo, Khoa Nông học, Bộ môn Bệnh cây, Trung tâm bệnh nhiệt đới, Học viện Nơng nghiệp Việt Nam tận tình giúp đỡ tơi q trình học tập, thực đề tài hồn thành luận án Tơi xin chân thành cảm ơn lãnh đạo Viện Nghiên cứu Rau giúp đỡ tạo điều kiện cho suốt trình thực đề tài Xin chân thành cảm ơn gia đình, người thân, bạn bè, đồng nghiệp tạo điều kiện thuận lợi giúp đỡ mặt, động viên khuyến khích tơi hồn thành luận án./ Hà Nội, ngày tháng năm 2020 Nghiên cứu sinh Nguyễn Duy Hưng ii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục từ viết tắt vi Danh mục bảng vii Danh mục hình x Trích yếu luận án xii Thesis abstract xiv PHẦN MỞ ĐẦU 1.1 Tính cấp thiết đề tài 1.2 Mục tiêu nghiên cứu đề tài 1.3 Đối tượng phạm vi nghiên cứu 1.4 Những đóng góp đề tài 1.5 Ý nghĩa khoa học thực tiễn đề tài PHẦN TỔNG QUAN TÀI LIỆU 2.1 Nguồn gốc, tình hình sản xuất ớt giới Việt Nam 2.1.1 Lược sử ớt 2.1.2 Tình hình sản xuất ớt giới 2.1.3 Tình hình sản xuất ớt Việt Nam 2.2 Nghiên cứu bệnh thán thư hại ớt giới 2.2.1 Tầm quan trọng bệnh thán thư 2.2.2 Phân loại nấm Colletotrichum 10 2.2.3 Thành phần nấm Colletotrichum gây hại ớt 13 2.2.4 Một số lồi nấm Colletotrichum gây hại ớt 15 2.2.5 Xâm nhiễm gây bệnh nấm Colletotrichum gây bệnh thán thư ớt 22 2.2.6 Khả truyền qua hạt ớt nấm Colletotrichum 24 2.2.7 Đặc điểm sinh thái nấm Colletotrichum gây bệnh ớt 25 2.3 Phòng chống nấm Colletotrichum ớt 26 2.3.1 Biện pháp canh tác 26 2.3.2 Biện pháp sử dụng giống chống chịu bệnh 26 2.3.3 Biện pháp hóa học 27 iii 2.3.4 Biện pháp sinh học 28 2.4 Những nghiên cứu bệnh thán thư hại ớt Việt Nam 30 PHẦN VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 33 3.1 Vật liệu, địa điểm thời gian nghiên cứu 33 3.1.1 Vật liệu nghiên cứu 33 3.1.2 Địa điểm thời gian nghiên cứu 34 3.2 Nội dung nghiên cứu 35 3.2.1 Điều tra đánh giá tác hại thu thập mẫu bệnh thán thư ớt 35 3.2.2 Xác định thành phần lồi nấm Colletotrichum hại ớt đồng sơng Hồng số tỉnh 3.2.3 35 Nghiên cứu số đặc điểm sinh học, tính gây bệnh lồi nấm Colletotrichum phát 3.2.4 35 Đánh giá hiệu lực số thuốc hóa học, vi khuẩn đối kháng Bacillus spp dịch chiết địa y với lồi nấm Colletotrichum phát điều kiện in vitro 36 3.3 Phương pháp nghiên cứu 36 3.3.1 Phương pháp điều tra, thu thập mẫu bệnh thán thư 36 3.3.2 Phương pháp xác định thành phần loài nấm Colletotrichum hại ớt 38 3.3.3 Phương pháp nghiên cứu đặc điểm hình thái, sinh học, tính gây bệnh loài Colletotrichum 3.3.4 41 Phương pháp đánh giá hiệu lực ức chế nấm Colletotrichum số loại thuốc hóa học, dịch chiết địa y vi khuẩn đối kháng điều kiện 3.5 in vitro 46 Phương pháp tính tốn xử lý số liệu 49 PHẦN KẾT QUẢ VÀ THẢO LUẬN 51 4.1 Điều tra đánh giá tác hại thu thập mẫu bệnh thán thư ớt 51 4.1.1 Mức độ phổ biến bệnh thán thư hại ớt đồng sông Hồng 51 4.1.2 Kết điều tra thực trạng bệnh thán thư hại ớt điểm thu thập mẫu 52 4.1.3 Kết thu thập mẫu bệnh thán thư ớt 56 4.1.4 Đặc điểm hình thái mẫu nấm gây bệnh thán thư ớt 57 4.2 Xác định thành phần loài nấm Colletotrichum hại ớt đồng sông Hồng số tỉnh 4.2.1 59 Định danh nấm dựa giải trình tự gen mẫu nấm đại diện thuộc nhóm hình thái xác định 59 iv 4.2.2 Tổng kết thành phần loài Colletotricum phát ớt đồng sông Hồng số tỉnh 4.2.3 70 Phát triển kỹ thuật PCR chẩn đoán nhanh loài nấm Colletotrichum gây hại ớt 4.2.4 72 Xác định thành phần, mức độ phân bố đa dạng loài Colletotrichum gây bệnh thán thư ớt đồng sông Hồng số tỉnh PCR 4.3 Đặc điểm sinh học, tính gây bệnh loài Colletotrichum gây bệnh thán thư ớt thu thập 4.3.1 89 Ảnh hưởng môi trường dinh dưỡng đến khả sinh trưởng loài nấm Colletotrichum 4.3.2 89 Ảnh hưởng nhiệt độ đến khả sinh trưởng lồi nấm Colletotrichum mơi trường PDA 4.3.3 93 Ảnh hưởng pH đến khả sinh trưởng lồi nấm Colletotrichum mơi trường PDA 4.3.4 Tính gây bệnh lồi Colletotrichum thu thập 4.3.5 Xác định khả tồn bào tử loài nấm C siamense C truncatum ớt 4.4 84 97 101 111 Đánh giá hiệu lực số loại thuốc hóa học, vi khuẩn đối kháng Bacillus spp dịch chiết địa y với loài nấm Colletotrichum phát điều kiện in vitro 4.4.1 114 Ảnh hưởng số thuốc hóa học đến khả sinh trưởng, phát triển loài nấm Colletotrichum phát điều kiện in vitro 4.4.2 Ảnh hưởng số mẫu vi khuẩn đối kháng Bacillus spp đến sinh trưởng loài nấm Colletotrichum môi trường PDA 4.4.3 115 136 Ảnh hưởng số dịch chiết địa y đến khả sinh trưởng nấm C siamense C truncatum môi trường PDA 140 PHẦN KẾT LUẬN VÀ ĐỀ NGHỊ 143 5.1 Kết luận 143 5.2 Kiến nghị 145 Danh mục cơng trình cơng bố 146 Tài liệu tham khảo 147 Phụ lục 162 v DANH MỤC TỪ VIẾT TẮT Chữ viết tắt Chữ viết đầy đủ bp Base pair (Cặp bazơ) BVTV Bảo vệ thực vật C Colletotrichum CBTB Cấp bệnh trung bình CRD Completely randomized design (Thiết kế hoàn toàn ngẫu nhiên) CSB Chỉ số bệnh CT Công thức CTAB cetyltrimethylammonium bromide ĐBSH Đồng sông Hồng DNA Deoxyrobonucleic acid FAO Food and agriculture organization (Tổ chức Nông nghiệp Lương thực Liên hiệp Quốc) Hecta ITS Internal transcribed spacer kb Kilo base PCA Potato Carrot Agar PCR Polymerase chain reaction (Phản ứng chuỗi trùng hợp) PDA Potato Glucose Agar QCVN Quy chuẩn kỹ thuật Quốc gia s.l sensu lato = phức hợp loài s.s sensu stricto = loài TT Số thứ tự TLB Tỷ lệ bệnh WA Water agar µl Microliter vi DANH MỤC BẢNG TT Tên bảng Trang 2.1 Diện tích, suất sản lượng ớt giới (năm 2009 - 2018) 2.2 Diện tích, suất sản lượng ớt Việt Nam (năm 2009 - 2017) 2.3 Thành phần loài Colletotrichum ớt số quốc gia 14 3.1 Các mồi sử dụng định danh phân tử nấm Colletotrichum 38 4.1 Mức độ phổ biến bệnh thán thư hại ớt đồng sông Hồng vụ xuân hè từ năm 2015 - 2017 4.2 52 Mức độ phổ biến bệnh thán thư hại ớt đồng sông Hồng vụ thu đông từ năm 2015 - 2017 52 4.3 Tình hình bệnh thán thư hại ớt số tỉnh năm 2015 54 4.4 Tình hình bệnh thán thư hại ớt số tỉnh năm 2016 55 4.5 Tình hình bệnh thán thư hại ớt số tỉnh năm 2017 55 4.6 Triệu chứng mẫu bệnh thán thư thu thập địa điểm 56 4.7 Đặc điểm hình thái mẫu nấm thán thư hại ớt thu thập 58 4.8 Kết tìm kiếm Ngân hàng gen 10 mẫu nấm Colletotrichum dựa trình tự vùng ITS 4.9 60 Mức đồng trình tự vùng ITS 10 mẫu Colletotrichum gây bệnh thán thư ớt thu Việt Nam với loài thuộc phức hợp lồi C gloeosporioides s.l lồi cơng bố gây bệnh thán thư ớt 61 4.10 Kết tìm kiếm GenBank mẫu nấm Colletotrichum gây bệnh thán thư ớt dựa trình tự vùng ApMat 65 4.11 Mức đồng trình tự vùng ApMat mẫu Colletotrichum gây bệnh thán thư ớt thu đồng sơng Hồng số tỉnh với lồi thuộc phức hợp loài C gloeosporioides s.l 67 4.12 Vùng thiết kế mồi phát loài C truncatum dựa trình tự ITS lồi Colletotrichum cơng bố gây bệnh thán thư ớt 73 4.13 Vùng thiết kế mồi phát loài C gloeosporioides s.s dựa trình tự ApMat phức hợp lồi C gloeosporioides s.l 74 4.14 Vùng thiết kế mồi phát loài C siamense dựa trình tự ApMat phức hợp lồi C gloeosporioides s.l vii 75 4.15 Vùng thiết kế mồi phát lồi C fructicola dựa trình tự ApMat phức hợp loài C gloeosporioides s.l 76 4.16 Đặc điểm cặp mồi thiết kế nhằm phát C truncatum, C fructicola, C siamense C gloeosporioides s.s 78 4.17 Xác định nhiệt độ gắn mồi phù hợp cặp mồi thiết kế 80 4.18 Kết PCR so sánh hai phương pháp chiết DNA mẫu nấm 83 4.19 Phát loài Colletetotrichum gây bệnh thán thư ớt thu thập PCR 85 4.20 Phân bố mẫu nấm Colletotrichum gây bệnh thán thư ớt thu thập đồng sông Hồng số tỉnh 87 4.21 Khả sinh trưởng loài nấm Colletotrichum môi trường dinh dưỡng 92 4.22 Ảnh hưởng nhiệt độ đến khả sinh trưởng lồi Colletotrichum 96 4.23 Ảnh hưởng pH mơi trường đến sinh trưởng loài nấm Colletotrichum 100 4.24 Kết lây nhiễm nhân tạo loài nấm Colletotrichum số giống ớt 106 4.25 Kết lây nhiễm loài nấm Colletotrichum số ký chủ hay nhiễm bệnh thán thư 109 4.26 Khả tồn nấm C siamense C truncatum ớt sau lây nhiễm nhân tạo phương pháp gây tổn thương 111 4.27 Ảnh hưởng thuốc Azony 25SC đến khả sinh trưởng loài nấm Colletotrichum môi trường PDA 118 4.28 Ảnh hưởng thuốc Azony 25SC đến khả nảy mầm bào tử loài nấm Colletotrichum 120 4.29 Ảnh hưởng thuốc Antracol 70WP đến khả sinh trưởng lồi nấm Colletotrichum mơi trường PDA 123 4.30 Ảnh hưởng thuốc Antracol 70WP đến khả nảy mầm bào tử loài nấm Colletotrichum 126 4.31 Ảnh hưởng thuốc Tiptop 250EC đến khả sinh trưởng lồi nấm Colletotrichum mơi trường PDA 128 4.32 Ảnh hưởng thuốc Tiptop 250EC đến khả nảy mầm bào tử loài nấm Colletotrichum 131 viii Hình thái Mẫu nấm Địa điểm thu thập 22 C23 23 C24 24 C25 25 C26 26 C27 27 C28 28 C29 29 C30 30 C31 31 C32 Nhân Hưng, Lý Nhân, Hà Nam Dạ Trạch, Khoái Châu, Hưng Yên Văn Đức, Gia Lâm, Hà Nội Hoàn Long, Yên Mỹ, Hưng Yên Nhân Hưng, Lý Nhân, Hà Nam Thanh Ninh, Phú Bình, Thái Nguyên Thanh Ninh, Phú Bình, Thái Nguyên Vân Nội, Đông Anh, Hà Nội Nhân Hưng, Lý Nhân, Hà Nam Thị trấn Nông trường, Mộc Châu, Sơn La TT Bào tử phân sinh Hình dạng Kích thước (dài x rộng, µm) 167 Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Lưỡi liềm 11,1 ± 1,0 × 4,5 ± 0,6 Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới trịn Lưỡi liềm 11,0 ± 1,1 × 4,3 ± 0,4 Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới trịn 10,7 ± 1,1 × 4,1 ± 0,7 12,6 ± 0,9 × 3,8 ± 0,5 21,5 ± 1,2 ×3,5 ± 0,6 11,6 ± 1,2 × 4,7 ± 0,5 10,7 ± 0,9 × 4,5 ± 0,6 11,9 ± 1,1 × 4,6 ± 0,4 21,9 ± 1,0 × 3,7 ± 0,4 11,8 ± 1,3 × 4,7 ± 0,5 Đĩa áp Màu sắc, hình dạng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số chẻ thùy Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Kớch thc (àm) Nhúm hỡnh thỏi 7,4 0,9 ì 4,8 ± 0,4 I 8,8 ± 1,2 × 4,9 ± 0,4 I 11,7 ± 1,4 × 6,3 ± 1,0 7,3 ± 1,0 × 4,8 ± 0,8 III 8,6 ± 1,1 × 5,1 ± 0,7 I 8,3 ± 1,2 × 4,7 ± 0,5 I 9,7 ± 1,4 × 5,7 ± 0,6 II 8,1 ± 1,3 × 5,3 ± 0,7 III 6,9 ± 0,8 × 5,2 ± 0,5 I 8,0 ± 1,2 × 5,8 ± 0,6 I I Hình thái TT Mẫu nấm Địa điểm thu thập Bào tử phân sinh Hình dạng Kích thước (dài x rộng, µm) Đĩa áp Màu sắc, hình dạng Kích thước (µm) Nhóm hình thái 168 32 C33 Đông Sang, Mộc Châu, Sơn La Trụ, hai đầu tù tới trịn 11,9 ± 1,0 × 4,5 ± 0,7 Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng 8,2 ± 1,0 × 5,3 ± 0,6 I 33 C34 I 8,3 ± 1,2 × 5,2 ± 0,6 III 35 C36 11,5 ± 1,1 × 4,8 ± 0,5 8,6 ± 1,2 × 4,9 ± 0,7 I 36 C37 8,8 ± 1,3 × 5,4 ± 0,5 I 37 C38 8,4 ± 1,1 × 5,1 ± 0,6 I 38 C39 8,6 ± 1,1 × 5,3 ± 0,4 I 39 C40 8,8 ± 1,2 × 4,8 ± 0,4 I 40 C41 7,7 ± 0,9 × 4,6 ± 0,5 I 41 C42 7,0 ± 0,6 × 4,7 ± 0,6 I 42 C43 Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng 7,6 ± 0,9 × 6,2 ± 0,5 C35 Trụ, hai đầu tù tới trịn Lưỡi liềm 12,2 ± 1,1 × 4,7 ± 0,5 34 Đông Sang, Mộc Châu, Sơn La Long Thành, Long Định, Tiền Giang Long Thành, Long Định, Tiền Giang Nhân Hưng, Lý Nhân, Hà Nam Mỹ Tiến, Mỹ Lộc, Nam Định Mỹ Tân, Mỹ Lộc, Nam Định Hợp Đức, Tân Yên, Bắc Giang Hợp Đức, Tân Yên, Bắc Giang Song Vân, Tân Yên, Bắc Giang Song Vân, Tân Yên, Bắc Giang 7,7 ± 1,1 × 5,6 ± 0,7 I 22,4 ± 1,4 × 3,9 ± 0,5 10,8 ± 0,9 × 4,6 ± 0,4 10,4 ± 1,1 × 4,8 ± 0,6 11,4 ± 1,2 × 3,8 ± 0,5 10,7 ± 1,1 × 4,9 ± 0,5 11,2 ± 1,1 × 4,7 ± 0,5 12,6 ± 1,2 × 3,6 ± 0,5 11,9 ± 1,1 × 4,1 ± 0,4 Hình thái Mẫu nấm Địa điểm thu thập 43 C44 C45 45 C46 46 C47 47 C48 Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Lưỡi liềm 11,0 ± 1,1 × 3,4 ± 0,2 44 48 C50 C51 50 C52 Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn Trụ, hai đầu tù tới tròn 10,8 ± 0,8 × 4,8 ± 0,4 49 Cổ Bi, Gia Lâm, Hà Nội Cổ Bi, Gia Lâm, Hà Nội Khánh Vân, Yên Khánh, Ninh Bình Khánh Vân, Yên Khánh, Ninh Bình Văn Đức, Gia Lâm, Hà Nội Việt Hồng, Thanh Hà, Hải Dương Thanh Hải, Thanh Hà, Hải Dương Kim Tân, Kim Thành, Hải Dương 51 C53 Lưỡi liềm 21,7 ± 1,2 × 4,1 ± 0,3 52 C54 Kim Tân, Kim Thành, Hải Dương Hoàng Hanh, Ninh Giang, Hải Dương TT Bào tử phân sinh Hình dạng 169 Trụ, hai đầu tù tới trịn Đĩa áp Kích thước (µm) Nhóm hình thái Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng 7,3 ± 1,0 × 4,8 ± 0,8 I 6,6 ± 0,6 × 5,4 ± 1,3 I 7,1 ± 0,9 × 5,1 ± 0,8 I 7,9 ± 1,2 × 5,6 ± 0,5 I 11,7 ± 2,2 × 6,3 ± 1,0 8,3 ± 1,1 × 5,8 ± 0,6 III 7,9 ± 0,8 × 5,5 ± 0,7 I 7,4 ± 0,6 × 5,7 ± 0,5 I Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng 12,1 ± 1,3 × 4,4 ± 0,5 Màu nâu đến nâu đậm; hình trứng, tày, elip tới gần hình thoi, số có hình dạng khơng 9,7 ± 0,8 × 5,6 ± 0,4 III 8,1 ± 1,2 × 5,1 ± 0,7 I Kích thước (di x rng, àm) 12,3 1,3 ì 3,6 0,4 11,9 ± 1,2 × 3,9 ± 0,6 11,2 ± 1,1 × 4,6 ± 0,5 22,4 ± 1,2 × 3,6 ± 0,6 11,3 ± 1,2 × 4,5 ± 0,4 11,9 ± 1,1 × 4,1 ± 0,6 Màu sắc, hình dạng I PHỤ LỤC HÌNH ẢNH CÁC SẢN PHẨM PCR Sản phẩm PCR 10 mẫu nấm Colletotrichum cặp mồi ITS Sản phẩm PCR mẫu nấm Colletotrichum cặp mồi ApMat Sản phẩm PCR tối ưu phương pháp chiết DNA mẫu nấm Colletotrichum 170 Sản phẩm PCR tối ưu nhiệt độ gắn mồi cho cặp mồi tự thiết kế phục vụ chẩn đoán loài nấm Colletotrichum 171 Sản phẩm PCR xác định thành phần loài Colletotrichum cặp mồi đặc hiệu tự thiết kế 172 173 PHỤ LỤC TRÌNH TỰ ĐOẠN ĐỌC ĐƯỢC CỦA CÁC MẪU NẤM Giải trình tự vùng gen ITS 10 mẫu nấm  C1-17B4ZAB008 - (548 nts) TTGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGAT CATTACTGAGTTTACGCTCTATAACCCTTTGTGAACATACCTATAACTGTTG CTTCGGCGGGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGG TCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGA GTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGG CCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCC TCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTGC CGTAAAACCCCCCAATTTCCAAAGGTGACCT  C4-17B4ZAB009 - (529 nts) AAAAAAAAACAACAAACAACAAGACCAAATGGAAGTAAAAGTCGTAACAA GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACTGAGTTTACGCTATACA ACCCTTTGTGGACATACCTATAACTGTTGCTTCGGCGGGTAGGGTCTCCGTG ACCCTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCGGAGGATAAC CAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAA ACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAA ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA ACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCAT TTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACACGCTGATGTAGGCC CTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTTTAC GTCTCGCACTGGGA  C6-17B4ZAB010 - (548 nts) TTGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGAT CATTACTGAGTTTACGCTCTATAACCCTTTGTGAACATACCTATAACTGTTG CTTCGGCGGGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGG TCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGA GTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGG CCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCC TCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTGC CGTAAAACCCCCCAATTTCCAAAGGTGACCT 174  C9-17B4ZAB011 - (547 nts) TTGGAAGTAAAAATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGAT CATTACTGAGTTTACGCTCTATAACCCTTTGTGAACATACCTATAACTGTTG CTTCGGCGGGTAGGGTCTCCGTGACCCTCCCGGCCTCCCGCCTCCGGGCGGG TCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGA GTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGG CCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCC TCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTGC CGTAAAACCCCCAATTTCCAAAGGTGACCT  C14-17B4ZAB012 (549) TTGGAAGTAAAAATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGAT CATTACTGAGTTTACGCTCTATAACCCTTTGTGAACATACCTATAACTGTTG CTTCGGCGGGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGG TCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGA GTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGG CCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCC TCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTGC CGTAAAACCCCCCAATTTCCAAAGGTGACCTC  C25-17B4ZAB013 - (556 nts) TTGGAAGGTAAAAAGTGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGA TCATTACTGAGTTACCGCTCATCAACCCTTTGTGAACATACCTTAACTGTTG CTTCGGCGGGTAGGCGTCCCCTGAAAAGGACGTCTCCCGGCCCTCTCCCGTC CGCGGGTGGGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTT TCTTCTGAGTGACACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTG GTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTG CAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCAT TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGG TGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCT CGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGA CTCTAGCCGTAAAACCCCCAATTTTACTAAGGTGACCTC 175  C26-17B4ZAB014 - (560 nts) TTGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGAT CATTACTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTG CTTCGGCGGGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGG TCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGA GTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGG CCCTACAGCCGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCC TCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTGC CGTAAAACCCCCCAATTTCCAAAGGTTGACCTCGGATCAGGTA  C29-17B4ZAB015 - (563 nts) TTTGGAAGTAAAAATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGA TCATTACTGAGTTTACGCTCTATAACCCTTTGTGAACATACCTATAACTGTTG CTTCGGCGGGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGG TCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGA GTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGG CCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCC TCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTGC CGTAAAACCCCCCAATTTCCAAAGGTGACCTCGGATCAGGTAGAT  C30-17B4ZAB016 - (556 nts) TTGGAAGTAAAAAATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGA TCATTACTGAGTTACCGCTCATCAACCCTTTGTGAACATACCTTAACTGTTG CTTCGGCGGGTAGGCGTCCCCTAAAAAGGACGTCTCCCGGCCCTCTCCCGTC CGCGGGTGGGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTT TCTTCTGAGTGACACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTG GTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTG CAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCAT TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGG TGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCT CGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGA CTCTAGCCGTAAAACCCCCAATTTTACTAAGGTGACCTC 176  C33-17B4ZAB017 - (551 nts) TTTGGAAGTAAAAATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGA TCATTACTGAGTTTACGCTCTACAACCCTTTGTGGACATACCTATAACTGTT GCTTCGGCGGGTAGGGTCTCCGTGACCCTCCCGGCCTCCCGCCCCCGGGCGG GTCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTG AGTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGG CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCG GGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGG GCCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGC CTCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTG CCGTAAAACCCCCAATTTCCAAAGGTGACCTCGG Giải trình tự vùng gen ApMat  C1-19D5ZAA000/19D5ZAA001 - (915 nts) ACAAGAGCGCCTCTTGATGATGTATCCCGACTACCGTTACACCCCTCGCAAG CCGTCTGAGAAGCGCCATCGAAAGCCTAGTGGCCAAAGCAAGAAGACCAG CTTAGCAGCGTCGATGAGGTAGAGGCCGCCTCCTACCCGAGAGCGACAAAA CCATCAGCGCGCCCACTTGTCGGCTCCAGACGGAGGAGTATGAGTTATACC TACCGACTGCGACAAGTCGCTGTAGTATCAGTCATGGAACGGAATAGATAT CGGCGCTGCCAAACGACTTTAGGTCGTCCTTGTGTTCTAGACTGGCAGCATC AGCGACCAGAGGAGCCTCAGAACATGGCGCCTTTGGAGGCTGTCTTCGATC TCTATCCAGTCAGCGTGACCCAGGAGGCGACCACGCATCTGTTCGTCGATTC ACTTCCCGCATGCTGTGGCAAGAGTTACCTGCGCGAGAAACCAACAGACCT TTGTGCGGCGATACTTAGACGTACGAACGCTAGGAGATCACCGGATCTGAG GAACCAAGAATCATCCTGGACCATCTGCTTCGATGGCAACGCGAAGCAGAG ATCTTCGATTTGATGAACATATTGGTGCAAAAATGTACTCACAACCCATGTA TTCGCATGTCAAGCGAATACGAATCTTTTTCTGTAATTATAATCTGCAAGCC AGTAAATATCATCTTCATGGACCATCTATTCCAGCCCGATACCTAGAGTGTC TTTTGGCCCCCGCCGTGAGGACCATTGATTCGCCCACATGTTGCTCTTCGCC ACTGCAGACTGCCAACACCATCCATGATGCCCAGCCACTGTCTCGACTGCGC ATCACGGGAATAACTAGGTCTGATCTTTTTTCCAGTCGCTGCTCCAGATGAA CGTCCCGCACCTCCACTCCGTCCCCGATTCTTTGGCTCCC 177  C4-19D5ZAA002/19D5ZAA003 – (919 nts) GCACAAGGAGCGCCTCTTGATGATGTATCCCGACTACCGTTACACCCCACGC AAGCCGTCTGAGAAGCGCCATCGAAAGCCTAGTGGCCAAAGCAAGAAGGC CAGCTTAGCAGCGTCAATGAGGTAGAGGCCGCCTTCTACCCAAGAGCGACA ACACCATCAGCGCGCCGACTTGTCGGCTCCAGACGGAGGAGTATGAGTTAT ACCTACCGACTGCGATGAGTCGCTGTAGCATCTGCCACGAAATGGAACTGA TATCGGCGCTGCCAGACGACCTAAGGTTGTCTTTGTGTCCTAGAATGGCAGC ATTAGCGACCAGAGGAGCCTAAGAATGTGGCGCCTTTGGCGGCTGTCTTCG ATCTCCATCCAGTCAGCGTGACCCAGGAGGCGACCACACATCTGGCCATCG ATTCCCTTCCCGCATGCTGCAGCAAGAGTTACCCTGCGCCAGAAACCAACA GACCTTTGTGCGGCGATACTTAGGCGTACGAATGCAAGGAGATCGCCGGAT CTGAGGAACCAAGAATCATCCTGGCCCATCTGCTTCGCTGGCAACGCGAAC CAGAGATCTTCGATTTAATGAACATATTGGTGGTAAAATGTACTCACAACCC ATGTATTCGCATATTCAGAGCGAACCCGAGTCTTTTTCTGTAATTATAATCT GCAAGCCAGTAAATATTATCTTCATAGACCATCTATTCCAGCCCGATACCTA AAGTGTCTTTTTCCCCCACCATGGGGACTATTCATTCGCCCATATCATGCTCT TCGCCACTGCGGACTGCCAACACCATCCACGATACACAGCCGCTGTCACGA CTGCGCATCACGGGAGTAACTAGGTCTGATCTTTCTTCCAGTCGCTGCTCCA GATGAACGTCCCGCATCTCCACTCCGTCCCCGATTCTTTGACCCC  C6-19D5ZAA004/19D5ZAA005 – (910 nts) AGCGCCTCTTGATGATGTATCCCGACTACCGTTACACCCCTCGCAAGCCGTC TGAGAAGCGCCATCGAAAGCCTAGTGGCCAAAGCAAGAAGACCAGCTTAG CAGCGTCGATGAGGTAGAGGCCGCCTCCTACCCGAGAGCGACAAAACCATC AGCGCGCCCACTTGTCGGCTCCAGACGGAGGAGTATGAGTTATACCTACCG ACTGCGACAAGTCGCTGTAGTATCAGTCATGGAACGGAATAGATATCGGCG CTGCCAAACGACTTTAGGTCGTCCTTGTGTTCTCGACTGGCAGCATCAGCGA CCAGAGGAGCCTCAGAACATGGCGCCTTTGGAGGCTGTCTTCGATCTCTATC CAGTCAGCGTGACCCAGGAGGCGACCACGCATCTGTTCGTCGATTCACTTCC CGCATGCTGTGGCAAGAGTTACCTGCGCGAGAAACCAACAGACCTTTGTGC GGCGATACTTAGACGTACGAACGCTAGGAGATCACCGGATCTGAGGAACCA AGAATCATCCTGGACCATCTGCTTCGATGGCAACGCGAAGCAGAGATCTTC GATTTGATGAACATATTGGTGCAAAAATGTACTCACAACCCATGTATTCGCA TGTCAAGCGAATACGAATCTTTTTCTGTAATTATAATCTGCAAGCCAGTAAA TATCATCTTCATGGACCATCTATTCCAGCCCGATACCTAGAGTGTCTTTTGG CCCCCGCCGTGAGGACCATTGATTCGCCCACATGTTGCTCTTCGCCACTGCA GACTGCCAACACCATCCATGATGCCCAGCCACTGTCTCGACTGCGCATCACG GGAATAACTAGGTCTGATCTTTTTTCCAGTCGCTGCTCCAGATGAACGTCCC GCACCTCCACTCCGTCCCCGATTCTTTGGCTCCC 178  C9-19D5ZAA006/19D5ZAA007 - (894 nts) CACAAGGAGCGCCTCCTGATGATGTACCCCGACTACCGTTACACCCCACGC AAGCCGTCTGAGAAGCGTCATCGAAAGCCCAGTGGCCAAAGCAAGAAGGC CAGCTTAGCAGCGTCGATGAGGTAGAGGTCGTCTCCTACCCGAGAGCGACG ACACCATCAGCGCGCCGACTTGTCAGCTCAAGACGGAGGAGTATGAGTTAC ACCTACCGACTGCGACAAGTCGCTGTAGCATCAGCAACGAATTGGAACCGA TATCGGCGCTGCCAGACCACCTTAGGTTGTCTTTGTGCCCTTGACTGGCAGC ATCAGCGACCAGGGAAGCCTAAGAATATGGCGCCTTTGTGCAGCTGTCTTC GATCTCTATCCAGTCAGCGTGGCCAAGCAGGCACCCATGCATCTGGTCATA GATTCCCTTCTTATATGCTGCGGCAAGAGTTACCCTGCGCCGGAAACCAACA GACCTTTGTGCGGCGATACTTAGACGTACGAACGCTAGGAGATCACCGGAT CTGACGAACCAAGAATCATCCTGGCCCATCTGCTTCGATGGCTACGCGAAC CAGAGATCTTCGATTCGATGAACTTATTGGTAGAAAAATGTACTACTACTGT ACTCACAACCCATATATTCGCATGTTCAAAGCGAACACGTACCTTTTTCTGT AATTATAATCTGCAAGCCAGTAAATATCATCTTCATAGACCATCTATTCCAG ACCGATACCTAGAGTGTCATTTCTTTTCCTAGCATAAGAATAATGATCCGCC CATGTGATGCTCTTCGCCACTGTCACGACCGCGCATCACGGGAATACTAGGT CTGATCTTTTTTCCAGTCGCTGCTCCAGATGAAGGTCCCGCATCTCCACTCC GTCCCCGATTCTTTGACCCC  C14-19D5ZAA008/19D5ZAA009 - (915 nts) ACAAGAGCGCCTCTTGATGATGTATCCCGACTACCGTTACACCCCTCGCAAG CCGTCTGAGAAGCGCCATCGAAAGCCTAGTGGCCAAAGCAAGAAGACCAG CTTAGCAGCGTCGATGAGGTAGAGGCCGCCTCCTACCCGAGAGCGACAAAA CCATCAGCGCGCCCACTTGTCGGCTCCAGACGGAGGAGTATGAGTTATACC TACCGACTGCGACAAGTCGCTGTAGTATCAGTCATGGAACGGAATAGATAT CGGCGCTGCCAAACGACTTTAGGTCGTCCTTGTGTTCTAGACTGGCAGCATC AGCGACCAGAGGAGCCTCAGAACATGGCGCCTTTGGAGGCTGTCTTCGATC TCTATCCAGTCAGCGTGACCCAGGAGGCGACCACGCATCTGTTCGTCGATTC ACTTCCCGCATGCTGTGGCAAGAGTTACCTGCGCGAGAAACCAACAGACCT TTGTGCGGCGATACTTAGACGTACGAACGCTAGGAGATCACCGGATCTGAG GAACCAAGAATCATCCTGGACCATCTGCTTCGATGGCAACGCGAAGCAGAG ATCTTCGATTTGATGAACATATTGGTGCAAAAATGTACTCACAACCCATGTA TTCGCATGTCAAGCGAATACGAATCTTTTTCTGTAATTATAATCTGCAAGCC AGTAAATATCATCTTCATGGACCATCTATTCCAGCCCGATACCTAGAGTGTC TTTTGGCCCCCGCCGTGAGGACCATTGATTCGCCCACATGTTGCTCTTCGCC ACTGCAGACTGCCAACACCATCCATGATGCCCAGCCACTGTCTCGACTGCGC ATCACGGGAATAACTAGGTCTGATCTTTTTTCCAGTCGCTGCTCCAGATGAA CGTCCCGCACCTCCACTCCGTCCCCGATTCTTTGGCTCCC 179  C26-19D5ZAA010/19D5ZAA011 - (879 nts) CTGATGATGTACCCCGACTACCGTTACACCCCACGCAAGCCGTCTGAGAAG CGTCATCGAAAGCCCAGTGGCCAAAGCAAGAAGGCCAGCTTAGCAGCGTCG ATGAGGTAGAGGTCGTCTCCTACCCGAGAGCGACGACACCATCAGCGCGCC GACTTGTCAGCTCAAGACGGAGGAGTATGAGTTACACCTACCGACTGCGAC AAGTCGCTGTAGCATCAGCAACGAATTGGAACCGATATCGGCGCTGCCAGA CCACCTTAGGTTGTCTTTGTGCCCTTGACTGGCAGCATCAGCGACCAGGGAA GCCTAAGAATATGGCGCCTTTGTGCAGCTGTCTTCGATCTCTATCCAGTCAG CGTGGCCAAGCAGGCACCCATGCATCTGGTCATAGATTCCCTTCTTATATGC TGCGGCAAGAGTTACCCTGCGCCGGAAACCAACAGACCTTTGTGCGGCGATA CTTAGACGTACGAACGCTAGGAGATCACCGGATCTGACGAACCAAGAATCAT CCTGGCCCATCTGCTTCGATGGCTACGCGAACCAGAGATCTTCGATTCGATG AACTTATTGGTAGAAAAATGTACTACTACTGTACTCACAACCCATATATTCGC ATGTTCAAAGCGAACACGTACCTTTTTCTGTAATTATAATCTGCAAGCCAGTA AATATCATCTTCATAGACCATCTATTCCAGACCGATACCTAGAGTGTCATTTC TTTTCCTAGCATAAGAATAATGATCCGCCCATGTGATGCTCTTCGCCACTGTC ACGACCGCGCATCACGGGAATACTAGGTCTGATCTTTTTTCCAGTCGCTGCTC CAGATGAAGGTCCCGCATCTCCACTCCGTCCCCGATTCTTTGACCCC  C29-19D5ZAA012/19D5ZAA013 (930 nts) TGCAAGATGCACAAGGAGCGCCTCTTGATGATGTATCCCGACTACCGTTAC ACCCCACGCAAGCCGTCTGAGAAGCGCCATCGAAAGCCTAGTGGCCAAAGC AAGAAGGCCAGCTTAGCAGCGTCAATGAGGTAGAGGCTGCCTCCTACCCGA GAGCGACAACACCCTCAGCGCGCCGACTTGTCGGGTCCAGACGGAGGAGTA TGAGTACCTACCGACTGCGCCGAGTCGCTGTAGCAACAGCCACGAAACGGA ACCGATATCGGCGCTGCCAGACGACCTCAGGTTGTCTTTGTGTCCTAGACTG GCAGCATCAGCGATCAGATGAGCCTAAGAATGTGGCGCCTTTTGCGGCTGTC TTCGATCTCTACCCAGTCAGCGTGACCCAGGAGGCGACCACACATCTGGTCA TCGATTCTTTGCCGCATGCTGTAGCAAGAGTTGCCCTGCACCAGAAACCAAC AGACCTTTGTGCGGCGAAACTTAGGCGTGCGAACGCAAGGAGATCGCCGGA TCTGAGGAACCAAGAATCATCCTGGCCCATCTGCTTCGATGGCAACGCGAAC CAGGGATCTTCAATTTGATGAACATGTTGGTGGAAAAATGTACTCACAACCC ATGTATTCGCATGTCAAAGCGAACACGAATCTTTTTCTGTAATTATAATCTGC AAGCCAGTAAATATTATCTTCATGGACCATCTATTCCAGCCCGATACCTAGA GTGTCTTTTGCCCCCCGCCATGAGGACCATTGATTCGCCCACATGTTGCTCTT CGCCACTGCAGACTGCCAACACCATCCATGATGCCCAGCCACTGTCTCGACT GCGCATCACGGGAATAACTAGGTCTGATCTTTTTTCCAGTCGCTGCTCCAGAT GAACGTCCCGCATCTCCACTCCGTCCCCGATTCTTTGACCCCGACTCCC 180  C33-19D5ZAA014/19D5ZAA015 (919 nts) GCACAAGGAGCGCCTCTTGATGATGTATCCCGACTACCGTTACACCCCACGC AAGCCGTCTGAGAAGCGCCATCGAAAGCCTAGTGGCCAAAGCAAGAAGGC CAGCTTAGCAGCGTCAATGAGGTAGAGGCCGCCTTCTACCCAAGAGCGACA ACACCATCAGCGCGCCGACTTGTCGGCTCCAGACGGAGGAGTATGAGTTAT ACCTACCGACTGCGATGAGTCGCTGTAGCATCTGCCACGAAATGGAACTGA TATCGGCGCTGCCAGACGACCTAAGGTTGTCTTTGTGTCCTAGAATGGCAGC ATTAGCGACCAGAGGAGCCTAAGAATGTGGCGCCTTTGGCGGCTGTCTTCG ATCTCCATCCAGTCAGCGTGACCCAGGAGGCGACCACACATCTGGCCATCG ATTCCCTTCCCGCATGCTGCAGCAAGAGTTACCCTGCGCCAGAAACCAACA GACCTTTGTGCGGCGATACTTAGGCGTACGAATGCAAGGAGATCGCCGGAT CTGAGGAACCAAGAATCATCCTGGCCCATCTGCTTCGCTGGCAACGCGAAC CAGAGATCTTCGATTTAATGAACATATTGGTGGTAAAATGTACTCACAACCC ATGTATTCGCATATTCAGAGCGAACCCGAGTCTTTTTCTGTAATTATAATCT GCAAGCCAGTAAATATTATCTTCATAGACCATCTATTCCAGCCCGATACCTA AAGTGTCTTTTTCCCCCACCATGGGGACTATTCATTCGCCCATATCATGCTCT TCGCCACTGCGGACTGCCAACACCATCCACGATACACAGCCGCTGTCACGA CTGCGCATCACGGGAGTAACTAGGTCTGATCTTTCTTCCAGTCGCTGCTCCA GATGAACGTCCCGCATCTCCACTCCGTCCCCGATTCTTTGACCCC  C44-19D5ZAA016/19D5ZAA017 (894 nts) CACAAGGAGCGCCTCCTGATGATGTACCCCGACTACCGTTACACCCCACGCAA GCCGTCTGAGAAGCGTCATCGAAAGCCCAGTGGCCAAAGCAAGAAGGCCAGC TTAGCAGCGTCGATGAGGTAGAGGTCGTCTCCTACCCGAGAGCGACGACACCA TCAGCGCGCCGACTTGTCAGCTCAAGACGGAGGAGTATGAGTTACACCTACCG ACTGCGACAAGTCGCTGTAGCATCAGCAACGAATTGGAACCGATATCGGCGCT GCCAGACCACCTTAGGTTGTCTTTGTGCCCTTGACTGGCAGCATCAGCGACCAG GGAAGCCTAAGAATATGGCGCCTTTGTGCAGCTGTCTTCGATCTCTATCCAGTC AGCGTGGCCAAGCAGGCACCCATGCATCTGGTCATAGATTCCCTTCTTATATGC TGCGGCAAGAGTTACCCTGCGCCGGAAACCAACAGACCTTTGTGCGGCGATAC TTAGACGTACGAACGCTAGGAGATCACCGGATCTGACGAACCAAGAATCATCC TGGCCCATCTGCTTCGATGGCTACGCGAACCAGAGATCTTCGATTCGATGAACT TATTGGTAGAAAAATGTACTACTACTGTACTCACAACCCATATATTCGCATGTT CAAAGCGAACACGTACCTTTTTCTGTAATTATAATCTGCAAGCCAGTAAATATC ATCTTCATAGACCATCTATTCCAGACCGATACCTAGAGTGTCATTTCTTTTCCTA GCATAAGAATAATGATCCGCCCATGTGATGCTCTTCGCCACTGTCACGACCGCG CATCACGGGAATACTAGGTCTGATCTTTTTTCCAGTCGCTGCTCCAGATGAAGG TCCCGCATCTCCACTCCGTCCCCGATTCTTTGACCCC 181 ... NGHIỆP VIỆT NAM NGUYỄN DUY HƯNG NGHIÊN CỨU THÀNH PHẦN LỒI, TÍNH GÂY BỆNH VÀ KHẢ NĂNG PHÒNG CHỐNG NẤM Colletotrichum spp GÂY BỆNH THÁN THƯ ỚT TẠI ĐỒNG BẰNG SÔNG HỒNG Chuyên ngành : Bảo vệ thực... bệnh nấm Colletotrichum gây bệnh thán thư ớt Đến nay, chưa có cơng bố nghiên cứu đặc điểm mô học bệnh thán thư ớt nấm Colletotrichum gây Quá trình xâm nhiễm gây bệnh loài nấm Colletotrichum gây bệnh. .. nhiễm gây bệnh nấm Colletotrichum gây bệnh thán thư ớt 22 2.2.6 Khả truyền qua hạt ớt nấm Colletotrichum 24 2.2.7 Đặc điểm sinh thái nấm Colletotrichum gây bệnh ớt 25 2.3 Phòng chống nấm Colletotrichum
- Xem thêm -

Xem thêm: (Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng, (Luận án tiến sĩ) Nghiên cứu thành phần loài, tính gây bệnh và khả năng phòng chống nấm Colletotrichum spp. gây bệnh thán thư ớt tại đồng bằng sông Hồng

Từ khóa liên quan