Phân lập nấm mốc chịu nhiệt, chịu ph thấp

91 1 0
  • Loading ...
1/91 trang

Thông tin tài liệu

Ngày đăng: 07/05/2020, 23:24

VIỆN ĐẠI HỌC MỞ HÀ NỘI KHOA CÔNG NGHỆ SINH HỌC - KHÓA LUẬN TỐT NGHIỆP Đề tài: Phân lập nấm mốc chịu nhiệt, chịu pH thấp Người hướng dẫn: PGS.TS.Vũ Nguyên Thành Sinh viên: Hoàng Văn Năm Niên khóa: K20 – Lớp 1301-CNSH Hà Nội-2017 Viện đại học Mở Hà Nội Khoa Công nghệ sinh học LỜI CẢM ƠN Tôi xin trân thành cảm ơn sâu sắc tới PGS.TS Vũ Nguyên Thành Giám đốc Trung tâm vi sinh vật công nghiệp – Viện Công nghiệp thực phẩm dành thời gian tâm huyết tạo điều kiên hướng dẫntơi hồn thành khóa luậnnày Tơi xin trân trọng cảm ơn Th.S Nguyễn Thị Thanh Thủy, Cử nhân Bùi Ngọc Anh anh,chị Trung tâm Vi Sinh Vật Công nghiệp, Viện Công nghiệp Thực phẩm hướng dẫn, giúp đỡ bảo suốt thời gian làm thí nghiệm trung tâm Tơi xin trân thành cảm ơn thầy, cô, giáokhoa côngnghệ sinh học Viện Đại học Mở Hà Nội giảng dạy truyền đạt cho tơi kiến thức chun nghành bổ ích trongsuốt q trình học tập Cuối tơi xin trân thành gửi lời cảm ơn tới gia đình, người thân bạn bè quan tâm, ủng hộ động viên tạo điều kiện giúp tơi hồn thành khóa luận Hồng Văn Năm Pagei Viện đại học Mở Hà Nội Khoa Công nghệ sinh học DANH MỤC HÌNH Hình 1.1 Cấu trúc thành phần lignoecllulose ngô Error! Bookmark not defined Hình 1.2 Cấu trúc phân tử cellulose [3] Error! Bookmark not defined Hình 1.3 Arabino-4-O-methylglucuronoxylan từ hạt trần (theo Dekker 1985) Error! Bookmark not defined Hình 1.4.Hoạt động xúc tác cellulase chất cellulose [1].Error! Bookmark not defined Hình 3.1 Đĩa phân lập mẫutrên môi trường giấy-glucose rơm pH 2.0, nuôi 50 Error! Bookmark not defined Hình 3.2 Đĩa phân lập mẫutrên môi trường giấy-glucose rơm pH 2.0, nuôi 50 sau ngày Error! Bookmark not defined Hình 3.3 Khuẩn lạc Talaromyces atroroseusLPH 263-1 mặt trước mặt sau đĩa thạch PDAtrong ngàyở 30 Error! Bookmark not defined Hình 3.4 Hình thái tế bào chủng Talaromyces atroroseus LPH 263-1, kích thước vật kính 40xnuôi ngày môi trường PDA Error! Bookmark not defined Hình 3.5.Khuẩn lạc Rhizomucor pusillusLPH 239 mặt trước mặt sau, sau ngày nuôi môi trường PDA Error! Bookmark not defined Hình 3.6 Hình thái tế bào chủng Rhizomucor pusillus LPH 239 ni ngày PDAsoi vật kính 40x,kích thước trèn tương ứng 10um Error! Bookmark not defined Hình 3.7 Khuẩn lạc Penicillium simplicissimum LPH 260 mặt trước mặt sau, sau ngày nuôi mơi trường PDA Error! Bookmark not defined Hình 3.8 Hình tháitế bào Penicillium simplicissimum LPH 260 ni ngày môi môi trường PDA, soi vật kính 40x, kích thước chèn tương ứng 10µm Error! Bookmark not defined Hình 3.9 Biểu đồ hoạt tính CMCase chủng chịu nhiệt (50 °C) pH khác Error! Bookmark not defined Hình 3.10 Biểu đồ hoạt tính CMCase chủngnấm mốc (30 °C) pH khác Error! Bookmark not defined Hoàng Văn Năm Pageii Viện đại học Mở Hà Nội Khoa Cơng nghệ sinh học Hình 3.11 Hoạt tính xylanase nấm mốc chịu nhiêt (pH 2.0,50 ) phân tích pH 3.0, pH 5.0, pH 7.0 Error! Bookmark not defined Hình 3.12 Hoạt tính xylanase chủng nấm mốc chịu pH thấp (pH 1.0, 30 °C) phân tích pH 3.0, pH 5.0, pH 7.0 Error! Bookmark not defined Hình 3.13 Khả bền nhiệt CMCase chủng nấm mốc chịu nhiệt chịu nhiệt (pH 2.0, 50 °C) Error! Bookmark not defined Hình 3.14 Biểu đồ khả bền nhiệt CMCase chủng chịu pH thấp ( pH 1.0.0, 30 °C) Error! Bookmark not defined Hình 3.15 Biểu đồkhả bền nhiệt xylanase chủng nấm mốc chịu nhiệt (pH 2.0, 50°C) Error! Bookmark not defined Hình 3.16.Biểu đồ khả bền nhiệt xylannase chủng nấm mốc chịu pH thấp (30 °C, pH 1.0) Error! Bookmark not defined Hình 3.17 Điện di SDS-PAGE 40 chủng nấm mốc chịu nhiệt Error! Bookmark not defined Hình 3.18 Phổ fingerprinting chủng nấm mốc phân lập Error! Bookmark not defined Hoàng Văn Năm Pageiii Viện đại học Mở Hà Nội Khoa Công nghệ sinh học DANH MỤC BẢNG Bảng 1.1 Thành phần lignocellulose số nguồn có tự nhiên [8] Error! Bookmark not defined Bảng 1.2 Phân nhóm dựa vào phổ fingerprinting 52 chủng nấm mốc Error! Bookmark not defined Bảng 1.3 Danh sách tên chủng đọc trình tự Error! Bookmark not defined Hồng Văn Năm Pageiv Viện đại học Mở Hà Nội Khoa Công nghệ sinh học DANH MỤC BẢNG PHỤ LỤC Bảng phụ lục 1.1 Bảngnguồn gốc phân lập chủng nấm mốc Error! Bookmark not defined Bảng phụ lục 1.2 Ký hiệu nguồn gốc mẫu Error! Bookmark not defined Bảng phụ lục 1.3 Hoạt tính CMCasecủa chủng chịu nhiệt (pH 2.0, 50°Cở pH 3.0, pH 5.0, pH 7.0 Error! Bookmark not defined Bảng phụ lục 1.4 hoạt tính CMC chủng nấm mốc chịu pH thấp (pH 1.0, 30°C) Error! Bookmark not defined Bảng phụ lục 1.5 hoạt tính xylannase chủng nấm mốc chịu nhiệt(pH 2.0, 50°C)ở pH 3.0, pH 5.0, pH 1.0 Error! Bookmark not defined Bảng phụ lục 1.7 Khả bền nhiệt CMCase chủng nấm mốc chịu nhiệt (pH 2.0, 50℃) Error! Bookmark not defined Bảng phụ lục 1.8 khả bền nhiệt CMCase chủng nấm mốc chịu pH thấp ( pH 1.0, 30℃) Error! Bookmark not defined Bảng phụ lục 1.9 Khả bền nhiệt xylannase chủng chịu nhiệt(pH 2.0, 50℃), pH 5.0 Error! Bookmark not defined Bảng phụ lục 1.10 Khả bền nhiệtxylannase chủng chịu pH thấp ( pH 1.0, 30℃) pH 5.0 Error! Bookmark not defined Mã trình tự gen chủng nấm mốc phân lập Error! Bookmark not defined Hoàng Văn Năm Pagev Viện đại học Mở Hà Nội Khoa Công nghệ sinh học DANH MỤC CHỮ VIẾT TẮT APS CMC DNA DNS dNTPs GH ITS IU kDa OD PCR PDA rDNA SDS-PAGE Hoàng Văn Năm Ammonium persulfate Carboxylmethyl cellulose Deoxyribonucleic Acid 3,5 Dinitrosalicylic acid Deoxyribonucleotide triphosphates Glycoside hydrolase Internal transcribed spacer International unit KiloDalton Opical Density Polymerase Chain Reaction Potato dextrose agar Ribosomal Deoxyribonucleic Acid Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophorosis Pagevi Viện đại học Mở Hà Nội Khoa Công nghệ sinh học MỤC LỤC LỜI CẢM ƠN Error! Bookmark not defined DANH MỤC HÌNH Error! Bookmark not defined DANH MỤC BẢNG Error! Bookmark not defined DANH MỤC BẢNG PHỤ LỤC Error! Bookmark not defined DANH MỤC CHỮ VIẾT TẮT Error! Bookmark not defined MỤC LỤC Error! Bookmark not defined MỞ ĐẦU Error! Bookmark not defined PHẦN TỔNG QUAN Error! Bookmark not defined 1.1.Giới thiệu lignocellulose Error! Bookmark not defined 1.1.1.Cellulose Error! Bookmark not defined 1.1.2.Hemicellulose Error! Bookmark not defined 1.2.Enzyme thủy phân Lignocellulose Error! Bookmark not defined 1.2.1.Enzyme thủy phân cellulose Error! Bookmark not defined 1.2.2.Enzyme thủy phân hemicellulose Error! Bookmark not defined 1.3.Ứng dụng enzyme thủy phân lignocellulose Error! Bookmark not defined 1.4.Những nghiên cứu enzyme thủy phân lignocenlulose Error! Bookmark not defined PHẦN 2: PHƯƠNG PHÁP NGHIÊN CỨU Error! Bookmark not defined 2.1.Đối tượng nghiên cứu Error! Bookmark not defined 2.2.Hóa chất thiết bị Error! Bookmark not defined 2.2.1 Hóa chất Error! Bookmark not defined 2.2.2 Thiết bị Error! Bookmark not defined 2.3 Môi trường nghiên cứu Error! Bookmark not defined 2.4.Phương pháp nghiên cứu: Error! Bookmark not defined 2.4.1 Phương pháp lấy mẫu Error! Bookmark not defined 2.4.2 Phương pháp phân lập, nuôi cấy, làm bảo quản chủng giống Error! Bookmark not defined Hoàng Văn Năm Pagevii Viện đại học Mở Hà Nội Khoa Công nghệ sinh học 2.4.3 Quan sát hình thái khuẩn lạc chụp ảnh Error! Bookmark not defined 2.4.4 Nuôi cấy tách chiết enzyme Error! Bookmark not defined 2.4.5 Xác định hoạt độ enzyme phương pháp DNS: Error! Bookmark not defined 2.4.6 Phương pháp điện di protein SDS-PAGE Error! Bookmark not defined 2.4.7 Tách chiết ADN tổng số Error! Bookmark not defined 2.4.8 Phương pháp PCR fingerprinting Error! Bookmark not defined 2.4.9 Định tên chủng nấm mốc dựa vào giải trình tự DNA Error! Bookmark not defined PHẦN 3: KẾT QUẢ Error! Bookmark not defined 3.1.Kết phân lập chủng nấm mốc pH thấp Error! Bookmark not defined 3.2.Hình ảnh khuẩn lạc tế bào Error! Bookmark not defined 3.3.Phân tích hoạt tính emzyme phương pháp DNS pHkhác Error! Bookmark not defined 3.3.1 Hoạt tính CMCase Error! Bookmark not defined 3.3.2 Hoạt tính xylanase Error! Bookmark not defined 3.3.3 Xác định khả bền nhiệt Error! Bookmark not defined 3.3.4.Khả bền nhiệt xylanase Error! Bookmark not defined 3.3.5 Điện di protein SDS-PAGE Error! Bookmark not defined 3.4.Phân nhóm định tên chủng Error! Bookmark not defined 3.5.Định tên chủng nấm mốc dựa vào việc đọc trình tự rDNA: Error! Bookmark not defined KẾT LUẬN VÀ KIẾN NGHỊ Error! Bookmark not defined TÀI LIỆU THAM KHẢO Error! Bookmark not defined PHẦN PHỤ LỤC Error! Bookmark not defined Hoàng Văn Năm Pageviii Viện đại học Mở Hà Nội Khoa Công nghệ sinh học MỞ ĐẦU Thế giới vi sinh vật xung quanh đa dạng phong phú, chúng tồn phát triển cách mạnh mẽ, có số hữu ích mơi trường người Vì vậy, việc nghiên cứu tìm chúng có ích đem lại lợi ích to lớn cho người xã hội Thực trạng đặc biệt nước nơng nghiệp có Việt Nam, tình trạng nhiễm mơi trường việc xả thải phụ phẩmtrong sản phẩm nông nghiệp ngày nghiêm trọng Sau đợt thu hoạch nông sản, cách phụ phẩm rơm,rạ,… bỏ lại đốt chỗ Việc gây ảnh hưởng lớn tới mơi trường làm tăng lượng khí CO2 gây hiệu ứng nhà kính, gây tượng sương mù, khói bụi ảnh hưởng tới sức khỏe người Khơng có vậy, xí nghiệp nhà máy chế biến lâm sản mọc lên ngày nhiềuđồng nghĩa với việc sản phẩm phụ vỏ, mùn cưa thải khơng tận dụng xử lý gây lãng phí ô nhiễm môi trường Thành phần phụ phẩm chứa hàm lượng lignocellulose lớn cấu trúc lại bền khó bị phân hủy vi sinh vật Vì lý mà việc sử dụng enzyme thủy phân lignocellulose để xử lý phụ phẩm nông nghiệp làm giảm ô nhiễm mơi trường đồng thời tận dụng chúng ủ làm thức ăn cho gia xúc (rơm rạ) hay làm phân bón cho trồng (gỗ) Đặc biệt để nâng cao q trình chuyển hóa thức ăn cho vật nuôi giúp vật nuôi sinh trưởng pháttriển mạnhta cần bổ xung enzyme thủy phân lignocellulose vào thức ăn song q trình sản xuất cơng đoạn ép viên cần nhiệt độ cao từ 70°C- 80 °Cvà dày động vật có độpH thấp enzyme sử dụng phải hoạt động nhiệt độ cao pH thấp Hoàng Văn Năm Page1 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC Bảng phụ lục khả bền nhiệt CMCase chủng nấm mốc chịu pH thấp ( pH 1.0, 30℃) STT Ký hiệu chủng Tên lồi Hoạt tính(IU/ml) pH 5.0 70°C Tỉ lệ % 70/25 25°C LPH 237 Curvularia eragrostidis LPH 238 Trichoderma koningiopsis 1.44 LPH 239 Rhizomucor pusillus 2.7 1.43 189.36 LPH 239-1 Talaromyces purpureogenus 0.99 2.49 39.63 LPH 239-2 Talaromyces solicola 2.55 LPH 240 Aspergillus niger 1.81 2.14 84.4 LPH 241-1 Talaromyces solicola 0.12 LPH 241-2 Talaromyces barcinensis 2.25 1.05 214.49 LPH 242-1 Aspergillus fumigatus 3.51 1.46 240.63 10 LPH 242-2 Talaromyces solicola 2.07 1.93 107.09 11 LPH 243 Rhizopus oryzae 0.11 12 LPH 244 0 13 LPH 245-1 Talaromyces solicola 0 14 LPH 245-2 Talaromyces solicola 0.62 15 LPH 256 Aspergillus flavus 1.72 0.97 176.56 16 LPH 257-1 Mortierella wolfii 17 LPH 257-2 Trichoderma asperellum 2.7 18 LPH 259 Penicillium oxalicum 0.49 2.31 21.05 19 LPH 260 Penicillium simplicissimum 0.09 0.46 20 20 LPH 262 Aspergillus terreus 1.25 2.92 42.71 21 LPH 263 Talaromyces helicus 0.4 1.43 27.66 22 LPH 263-1X Talaromyces atroroseus 1.55 1.49 104.08 23 LPH 263-2T Talaromyces barcinensis 0.71 2.61 27.33 24 LPH 264 Aspergillus niger 2.37 3.01 78.79 25 LPH 265 Acidomyces acidothermus 0 26 LPH 266 Aspergillus aculeatus 0 27 LPH 267 Aspergillus heteromorphus 1.28 1.98 64.62 Hoàng Văn Năm 1.32 Page68 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC Bảng phụ lục Khả bền nhiệt xylannase chủng chịu nhiệt(pH 2.0, 50℃), pH 5.0 STT Ký hiệu chủng Tên lồi Hoạt tính(IU/ml) pH 5.0 70℃ Tỉ lệ 70/25 25℃ LPHT 220 Thermomyces lanuginosus 58.87 92.94 63.34 LPHT 221 Thielavia terrestris 20.63 39.92 51.69 LPHT 222 Thielavia sp1 20.91 38.97 53.67 LPHT 223 Thermomyces lanuginosus 23.9 62.25 38.4 LPHT 224 16.14 LPHT 225 Thielavia sp4 43.85 196.03 22.37 LPHT 226 Thielavia sp1 15.4 43.13 35.69 LPHT 227 Rasamsonia emersonii 0 LPHT 228 Rhizomucor pusillus 10 LPHT 230 Thielavia sp11 11 LPHT 231 Scytalidium thermophilum 12 LPHT 232 13 0 43.25 181.35 23.85 0 Thielavia sp12 10.24 37.1 27.59 LPHT 233 Thielavia sp15 128.57 340.48 37.76 14 LPHT 234 Rasamsonia emersonii 15 LPHT 235 76.98 315.08 24.43 16 LPHT 236 Thielavia sp19 137.3 349.6 39.27 17 LPHT 246 Rasamsonia byssochlamydoides 16.59 64.13 25.87 18 LPHT 251 Aspergillus fumigatus 31.04 54.58 56.86 19 LPHT 252 157.14 402.78 39.01 20 LPHT 253 Thermomyces lanuginosus 28.27 30.06 94.07 21 LPHT 254 Aspergillus fumigatus 35.77 61.45 58.2 22 LPHT 258 20.6 94.9 21.71 23 LPHT 268 36.92 51.82 71.26 24 LPHT 269 36.66 40.22 91.13 Hoàng Văn Năm Thermomyces dupontii % Page69 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC Bảng phụ lục 10 Khả bền nhiệtxylannase chủng chịu pH thấp( pH 1.0, 30℃) pH 5.0 STT Ký hiệu chủng Tên lồi Hoạt tính(IU/ml) pH 5.0 70℃ LPH 237 Curvularia eragrostidis LPH 238 Trichoderma koningiopsis LPH 239 Rhizomucor pusillus LPH 239-1 Tỉ lệ 70/25 25℃ 6.33 67.07 9.44 85.44 37.01 93.2 39.71 Talaromyces purpureogenus 70.19 LPH 239-2 Talaromyces solicola 5.35 LPH 240 Aspergillus niger 71.89 LPH 241-1 Talaromyces solicola 2.59 LPH 241-2 Talaromyces barcinensis 32.64 91.6 35.64 LPH 242-1 Aspergillus fumigatus 32.64 91.6 35.64 10 LPH 242-2 Talaromyces solicola 37.91 91.24 41.54 11 LPH 243 Rhizopus oryzae 10.44 12 LPH 244 0.62 61.81 1.01 13 LPH 245-1 Talaromyces solicola 0 ##### 14 LPH 245-2 Talaromyces solicola 0.36 21.32 1.67 15 LPH 256 Aspergillus flavus 32.02 100.78 31.77 16 LPH 257-1 Mortierella wolfii 17 LPH 257-2 Trichoderma asperellum 0.54 103.1 0.52 18 LPH 259 Penicillium oxalicum 0.54 93.92 0.57 19 LPH 260 Penicillium simplicissimum 58.42 20 LPH 262 Aspergillus terreus 2.5 101.23 2.47 21 LPH 263 Talaromyces helicus 11.15 80.72 13.81 22 LPH 263-1X Talaromyces atroroseus 4.19 85.62 4.9 23 LPH 263-2T Talaromyces barcinensis 13.56 71.26 19.02 24 LPH 264 Aspergillus niger 0.18 69.12 0.26 25 LPH 265 Acidomyces acidothermus 0.8 26 LPH 266 Aspergillus aculeatus 0.36 53.87 0.66 27 LPH 267 Aspergillus heteromorphus 0.89 64.75 1.38 Hoàng Văn Năm % Page70 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CƠNG NGHỆ SINH HỌC Mã trình tự gen chủng nấm mốc phân lập >LPH 237 1.5-4 ITS 5-ITS4 ITS 600 VT 1542 TGAGAAGAAGGTCTTGATGGATTGCTGGCCTCTTTAGCTGGTTGCAAGCGCAAAAATGTGCTGCGCTCCGAAACC AGTAGGCCGGCTGCCAATCGTTTTAAGGCGAGTCTTTGGGGCAAAAGCCAAAGACAAAACGCCCAACACCAAGCA AAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGA TTCGATGATTCACTGAATTCTGCAATTCACACTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCA AGAGATCCGTTGTTGAAAGTTGTAAATGATTTACATTTGTTATACTGACGCTGATTGCAACTGCATAAAAAAGGT TTATGGTGTGGTCCTGGTGGCGGGCGAACCCGCCCAGGAAACAACAAGTGCGCAAAAGACATGGGTGAAAAATAA TTCAGCTTCCCCGCCAAAACTGGCGGTTGCAGCCTTCATATTTTTTGTGTAATGATCCCTCCGCAGGTTCACCTA CGGAGACCTTGTTAC Cochliobolus eragrostidis Sequence ID: JN943412.1 Identities 531/531(100%) >LPH 238 ITS 600 2.5-4 ITS 5-ITS4 VT 1543 CAGAAGTTGGGTGTTTTACGGACGTGGACGCGCCGCGCTCCCGGTGCGAGTTGTGCAAACTACTGCGCAGGAGAG GCTGCGGCGAGACCGCCACTGTATTTCGGGGCCGGGATCCCGTCTTAGGGGTTCCCGATCCCCAACGCCGACCCC CCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTT CAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCA GAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTGAATTTTTGCTCAGAGCTGTAAGAAATAACGTCCGC GAGGGGACTACAGAAAGAGTTTGGTTGGTCCCTCCGGCGGGCGCCTGGTTCCGGGGCTGCGACGCACCCGGGGCG TGACCCCGCCGAGGCAACAGTTTGGTATGGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCG CTGGTTCACCAACGGAGACCTTGTTAC Trichoderma koningiopsis Sequence ID: KP340272.1Identities: 552/552(100%) >LPH 239 3.5-4 ITS 5-ITS4 ITS 600 VT 1544 TAGTTGAATTTATTTGTGGTTGATTGACCTTTATACTTGATCATCTCGAAGCACACTGGTAAAAAATTAGATACC AATGCAAACCCTCAAGGAAATATCAAGGGTCAACAACATACAAATTGTTCGGGTAGCTTGAACGGATGAAAATCC ATCAGCACCGCAAATCCAAAGATTTATCAAAAAATAAACCTTTAGGGGTTAATAAAGATACTGAACTAGACGTAC CCAATGGATGAACCAAAGGGTGCAAGGTGCGTTCGAGAATTCGATGATTCGCAAAGGCTGCAGATCGCATTACTT TTCGCAATTTGCTACGCTCTTCATCGATGCGAGAACCAAGTGATCCATTGCTTAAAGTTGTTTTGAAATTTTATC GTCTTGAATCATTTCTGATCCAAAACTTTCAATTTGTTAAACAACAGTCAATCAAATATGTAAAATAAAAGGTCG AGAGATCTGGAGCAATCCCTCAGAACATTTCACAAAAAGGAGAGAATCGCGGCTCACCAATAGAGGTCACCACGA TTTCCACAACTTTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Rhizomucor tauricus Sequence ID: KJ948646.1Identities: 552/552(100%) >LPH 239-1 4.5-4 ITS 5-ITS4 ITS 600 VT 1545 CACCGTGGAATAAATTCGTGAGGTGACCAACGCTCCGCGGGTCCATCCCGAGCGAGTGACAAAGCCCCATACGCT CGAGGACCTGGGCGGGAACGTCGCCGCTGCCTTTCGGGCAGGTCCCCCCGTTTCGGAGGGACCAGCGCCCAACAC ACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCTCCCCGGAATGCCAGGGAGCGCAATGTGCGT TCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCC GGAACCAAGAGATCCATTGTTGAAAGTTTTGATTATTATCAACGTTGCTCAGACAGTCCATCTTCACAAAGGGTT CAAGGGGCGCTCCGGCGGGCACGGGCCCGAGGACAGAGGCGTCCTCCGGCGACCGGGAGACCCGGTGGGCCCGCC AAAGCAACACGGTATTCAAATAGACACGGGTGGGAGGTTGGACCGCGAGGGGTCCGCACTCGGTAATGATCCTTC CGCAGGTTCACCTACGGAAACCTTGTTA Talaromyces purpureogenus Sequence ID: HQ608123.1 Identities: 505/554 (91%) >LPH 239-2 5.5-4 ITS 5-ITS4 ITS 600 VT 1546 ATGGAAGACCAACGCCCGTAGATCCTTCCCGAGCGGGTGACAGAGCCCCATACGCTCGAGGACCTAGGCGGGCGT CGCCACTGCCTTTCAGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACG CTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTG CAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTT Hoàng Văn Năm Page71 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC TGATTATTATCAATCATGCTCAGACAGTCCATCTTCATGAGGGTTCAAGGGCGCTCTGGCGGGCACGGGCCCAGG GGCACAGGGGCTCCTCGGCGACCGGGAGAGCCCAGTGGGCCCGCCAAAGCAACAGGGTGTACAAGAGACAAGGGT GGGAGGTTCGGTCCACGCGGGACCGGCACTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAACGGTTAGGTTT CACTTGGGGGGGTTTAGGCCCCAACAGTGTACTCGCCCCCCTGGTCTCCCAGGGAGCCCGACTATATCTTAAGCA GGACTCGACGTCCCACCCACTTCCACTTAGTCTGTGAACGTTCCCCATATCCCCCCTGAAACTACAGGGGACACT TAGGGGCTTCGATGCGGATTACCCATGGTCTCTGCCTGGAGCAGAACTATCCGAATCGTCTGTTACCGTCCCCCG TGGTGTGTCCACGGGCCCCTGCACGGTTTCCCGCGGCAGGTTGGTGCGATCGGCTTTAGGGCGTCCCCGTCAATT CAAAAGTGTCGCCCAGCCCGGGAGGGGCTGGACTTGCAACGGCACCAT Talaromyces solicola Sequence ID: KF114730.1Identities: 436/444 (98%) >LPH 240 6.5-4 ITS 5-ITS4 ITS 600 VT 1547 CGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGC CGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGCAGCAAT GACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAAT TCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAA GTTTTAACTGATTGCATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTTCGTGTTGGGGTCTCCGGCGGGC ACGGGCCCGGGGGGCAGAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTACAATAG ACACGGATGGGAGGTTGGGCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTT GTT Aspergillus niger Sequence ID: KP724986.1Identities: 528/528(100%) >LPH 241-1 7.5-4 ITS 5-ITS4 ITS 600 VT 1548 (cao) GATGGAAGACCAACGCCCGTAGATCCTTCCCGAGCGGGTGACAGAGCCCCATACGCTCGAGGACCTAG GCGGGCGTCGCCACTGCCTTTCAGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTG AGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGA TTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCC GGAACCAAGAGATCCATTGTTGAAAGTTTTGATTATTATCAATCATGCTCAGACAGTCCATCTTCATG AGGGTTCAAGGGCGCTCTGGCGGGCACGGGCCCAGGGGCACAGGGGCTCCTCGGCGACCGGGAGAGCC CAGTGGGCCCGCCAAAGCAACAGGGTGTACAAGAGACAAGGGTGGGAGGTTCGGTCCACGCGGGACCG GCACTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAACGGTTAGGTTTCACTTGGGGGGGTTTAGG CCCCAACAGTGTACTCGCCCCCCTGGTCTCCCAGGGAGCCCGACTATATCTTAAGCAGGACTCGACGT CCCACCCACTTCCACTTAGTCTGTGAACGTTCCCCATATCCCCCCTGAAACTACAGGGGACACTTAGG GGCTTCGATGCGGATTACCCATGGTCTCTGCCTGGAGCAGAACTATCCGAATCGTCTGTTACCGTCCC CCGTGGTGTGTCCACGGGCCCCTGCACGGTTTCCCGCGGCAGGTTGGTGCGATCGGCTTTAGGGCGTC CCCGTCAATTCAAAAGTGTCGCCCAGCCCGGGAGGGGCTGGACTTGCAACGGCACCATGTTCTTTAGA GTCGCCTGGACCTGCCACTTGCGTGGCTGCAAAGGCTTCGATAAGTGTA Talaromyces solicola Sequence ID: KF114730.1 Identities: 436/444(98%) >LPH 241-2 8.5-4 ITS 5-ITS4 ITS 600 VT 1549 GTAAAAAGATTTGGTGGTGACCAACCCCCGCAGGTCCCTCCCGAGCGAGTGACAAAGCCCCATGCGCTCGAGGAC CCGACGGGCGTCGCCGCTGCCTTTGGGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGG CAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTC ACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATT GTTGAAAGTTTTGACAATTTTCTAGGTACTCAGACAGCCCTATCTTCTTCAGAGTTCAGGGGGTGCTCCGGCGGG CGCGGGCCCGGGGACAAACGTCCCCCGGCGACCAGGTAACCCCGGTGGGCCCGCCAAAGCAACAGGTATTATAAC GGCACGGGTGGGAGGTTGAGCCCAGAGGGCTCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCT TGTTA Talaromyces helicus var major strain MH480 Sequence ID: FJ430765.1 Identities: 453/459(99%) ATTTGGTGGTGACCAACCCCCGCAGGTCCCTCCCGAGCGAGTGACAAAGCCCCATGCGCTCGAGGACCCGACGGG CGTCGCCGCTGCCTTTGGGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATG ACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATT CTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAG Hoàng Văn Năm Page72 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC TTTTGACAATTTTCTAGGTACTCAGACAGCCCTATCTTCTTCAGAGTTCAGGGGGTGCTCCGGCGGGCGCGGGCC CGGGGACAAACGTCCCCCGGCGACCAGGTAACCCCGGTGGGCCCGCCAAAGCAACAGGTATTATAACGGCACGGG TGGGAGGTTGAGCCCAGAGGGCTCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Talaromyces barcinensis Sequence ID: JN899349.1Identities: 502/513(98%) >LPH 242-1 9.5-4 ITS 5-ITS4 ITS 600 VT 1550 GTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGG TGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGC AGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCA CTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTG TTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTCG GCGGGCGCGGGCCCGGGGGCGCAAGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTAC GATAGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAA ACCTTGTTA Aspergillus fumigatus Sequence ID: KP131574.1 Identities: 534/534 (100%) >LPH 242-2 10.5-4 ITS 5-ITS4 ITS 600 VT 1551 ATGGAAGACCAACGCCCGTAGATCCTTCCCGAGCGGGTGACAGAGCCCCATACGCTCGAGGACCTAGGCGGGCGT CGCCACTGCCTTTCAGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACG CTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTG CAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTT TGATTATTATCAATCATGCTCAGACAGTCCATCTTCATGAGGGTTCAAGGGCGCTCTGGCGGGCACGGGCCCAGG GGCACAGGGGCTCCTCGGCGACCGGGAGAGCCCAGTGGGCCCGCCAAAGCAACAGGGTGTACAAGAGACAAGGGT GGGAGGTTCGGTCCACGCGGGACCGGCACTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAACGGTTAGGTTT CACTTGGGGGGGTTTAGGCCCCAACAGTGTACTCGCCCCCCTGGTCTCCCAGGGAGCCCGACTATATCTTAAGCA GGACTCGACGTCCCACCCACTTCCACTTAGTCTGTGAACGTTCCCCATATCCCCCCTGAAACTACAGGGGACACT TAGGGGCTTCGATGCGGATTACCCATGGTCTCTGCCTGGAGCAGAACTATCCGAATCGTCTGTTACCGTCCCCCG TGGTGTGTCCACGGGCCCCTGCACGGTTTCCCGCGGCAGGTTGGTGCGATCGGCTTTAGGGCGTCCCCGTCAATT CAAAAGT Talaromyces solicola Sequence ID: KF114730.1Identities: 436/444(98%) >LPH 243 11.5-4 ITS 5-ITS4 ITS 600 VT 1552 GTTGCTGGATTATACTCTTGTACTTTACTTCCTGGGCGAACCAAAGAAAAAGATCCTGAGACCAGCGTAATATTC CTGCCTAGCAAGCCAGACAGAAAATCACACACATTTTAGGTGCTCACTGTAATAAAACAGCGATGCGACCCATTA CCACATAAACAAATGTTATGTGTGGGTTTGTGATGATACTGAAGCAGGCGTACTCTATAGAAAAACCATAGAGTG CAAGCTGCGTTCAAAGACTCGATGATTCACTGAATATGCAATTCACACTAGTTATCGCACTTTGCTACGTTCTTC ATCGATGCGAGAACCAAGAGATCCATTGTTAAAAGTTGTTTTTTATTAAACTTTATAATACTGAATTTCTAGGTT TATTATGAAGGGTGCTCCTGAAACCAGGAGTGGCATCGATCAAACCCCAGATAGGTCTACCCATGACCAGTCTGA GTCTCTCAGCCAAATTTTCACAGTGTAGAAGCAATCACTTACCCCAGAGGAAACCCTAAGAGGTAAGGCGCTTTA ACATAATTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC Rhizopus oryzae Sequence ID: AB109754.1 Identities: 573/573(100%) >LPH 244 12.5-4 ITS 5-ITS4 ITS 600 VT 1553 Không có TT >LPH 245-1 13.5-4 ITS 5-ITS4 ITS 600 VT 1554 GATGGAAGACCAACGCCCGTAGATCCTTCCCGAGCGGGTGACAGAGCCCCATACGCTCGAGGACCTAGGCGGGCG TCGCCACTGCCTTTCAGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGAC GCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCT GCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTT TTGATTATTATCAATCATGCTCAGACAGTCCATCTTCATGAGGGTTCAAGGGCGCTCTGGCGGGCACGGGCCCAG GGGCACAGGGGCTCCTCGGCGACCGGGAGAGCCCAGTGGGCCCGCCAAAGCAACAGGGTGTACAAGAGACAAGGG Hoàng Văn Năm Page73 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC TGGGAGGTTCGGTCCACGCGGGACCGGCACTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAACGGTTAGGTT TCACTTGGGGGGGTTTAGGCCCCAACAGTGTACTCGCCCCCCTGGTCTCCCAGGGAGCCCGACTATATCTTAAGC AGGACTCGACGTCCCACCCACTTCCACTTAGTCTGTGAACGTTCCCCATATCCCCCCTGAAACTACAGGGGACAC TTAGGGGCTTCGATGCGGATTACCCATGGTCTCTGCCTGGAGCAGAACTATCCGAATCGTCTGTTACCGTCCCCC GTGGTGTGTCCACGGGCCCCTGCACGGTTTCCCGCGGCAGGTTGGTGCGATCGGCTTTAGGGCGTCCCCGTCAAT TCAAAAGTGTCGCCCAGCCCGGGAGGGGCTGGACTTGCAACGGCACCATGTTCTT Talaromyces solicola Sequence ID: KF114730.1Identities: 436/444 (98%) Talaromyces albobiverticillius Sequence ID: KF114738.1 Ident ities: 435/445 (98%) >LPH 245-2 14.5-4 ITS 5-ITS4 ITS 600 VT 1555 GATGGAAGACCAACGCCCGTAGATCCTTCCCGAGCGGGTGACAGAGCCCCATACGCTCGAGGACCTAGGCGGGCG TCGCCACTGCCTTTCAGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGAC GCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCT GCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTT TTGATTATTATCAATCATGCTCAGACAGTCCATCTTCATGAGGGTTCAAGGGCGCTCTGGCGGGCACGGGCCCAG GGGCACAGGGGCTCCTCGGCGACCGGGAGAGCCCAGTGGGCCCGCCAAAGCAACAGGGTGTACAAGAGACAAGGG TGGGAGGTTCGGTCCACGCGGGACCGGCACTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAACGGTTAGGTT TCACTTGGGGGGGTTTAGGCCCCAACAGTGTACTCGCCCCCCTGGTCTCCCAGGGAGCCCGACTATATCTTAAGC AGGACTCGACGTCCCACCCACTTCCACTTAGTCTGTGAACGTTCCCCATATCCCCCCTGAAACTACAGGGGACAC TTAGGGGCTTCGATGCGGATTACCCATGGTCTCTGCCTGGAGCAGAACTATCCGAATCGTCTGTTACCGTCCCCC GTGGTGTGTCCACGGGCCCCTGCACGGTTTCCCGCGGCAGGTTGGTGCGATCGGCTTTAGGGCGTCCCCGTCAAT TCAAAAGTGTCGCCCAGCCCGGGAGGGGCTGGACTTGCAACGGCACCATGTTCTTTAGAGTC Talaromyces solicola Sequence ID: KF114730.1Identities: 436/444 (98%) Talaromyces albobiverticillius Sequence ID: KF114738.1Identities: 435/445(98%) >LPH 256 15.5-4 ITS 5-ITS4 ITS 600 VT 1556 TTGATTTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACG CGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGAT GGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGA TTCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCC ATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTC CGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAG TAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGA AACCTTGTTAC Aspergillus flavus Sequence ID: KR611590.1Identities: 536/536 (100%) >LPH 257-1 16.5-4 ITS 5-ITS4 ITS 600 VT 1557 GACCAAGGCCTTCTAACAAAATCCTGCATCAGTCAGCTCACACAAGAGGACCTTAGAGTAGCTGCAGCAAATTAG AAATAATCCGCCGAAACGGACTAAATAGATATGCTTTTAGCTCAGTCTGTTCTTGTCACAGCTGCACCTGCATTT CAAGCAACCCGCCGCATTTGCTAGGCGCATTTGCCGTTGGGTTTGCTCAAATCCATCCAAAATTCAAAAAATAGA ATTTTGGTTGAGGTGTTTACTGATACTCAAACAAGCATGCTCTTCGGAATACCAAAGAGCGCAATATGCGTTCAA AGATTCGATGATTCACTGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAG CCAAGAGATCCGTTGTTGAAAGTTATGTTTTAGAATTTAGTCAATTCTCTAACATTTTCAGACAATCGTATTATA GAAAAGTGTATATTAAAATTGAAAAGAAGAAAGCAGAAAAAAAGCCTAAAAACGATTTGCATCGTTAGACTTTTT TTACACACTCTCTCTTTTTACATTGCACACAAGGTGGGTATGGATTTTTTGAAGAGTGCCATAAACACTCTTATT GTGAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTT Mortierella wolfii Sequence ID: HQ630304.1Identities: 611/611 (100%) >LPH 257-2 17.5-4 ITS 5-ITS4 ITS 600 VT 1558 TGTTTTACGGACGTGGACGCGCCGCGCTCCCGGTGCGAGTTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAG ACCGCCACTGTATTTCGGGGCCGGCACCCGTGTGAGGGGTCCCGATCCCCAACGCCGATCCCCCGGAGGGGTTCG AGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATG ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATC Hoàng Văn Năm Page74 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC CGTTGTTGAAAGTTTTGATTCATTTTGAATTTTTGCTCAGAGCTGTAAGAAATACGTCCGCGAGGGGACTACAGA AAGAGTTTGGTTGGTTCCTCCGGCGGGCGCCTGGTTCCGGGGCTGCGACGCACCCGGGGCGTGACCCCGCCGAGG CAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACG GAGACCTTGTTAC Trichoderma asperellum Sequence ID: KT824429.1Identities: 538/538 (100%) >LPH 259 19.5-4 ITS 5-ITS4 ITS 600 VT 1559 GATGGTGTTCGCCGGCGGGCGCCGGCCGGGCCTACAGAGCGGGTGACGAAGCCCCATACGCTCGAGGACCGGACG CGGTGCCGCCGCTGCCTTTCGGGCCCGCCCCCCGGAAGCGGGGGGCGAGAGCCCAACACACAAGCCGTGCTTGAG GGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGAT TCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCG TTGTTGAAAGTTTTAACTGATTTAGTCAAGTACTCAGACTGCAATCTTCAGACAAGAGTTCGTTTGTGTGTCTTC GGCGGGCGCGGGCCCGGGGGCGGATGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTACGATAA ACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTT GTTACG Penicillium oxalicum Sequence ID: KP132493.1Identities: 531/531 (100%) >LPH 260 20.5-4 ITS 5-ITS4 ITS 600 VT 1560 GATTGGGGTCGCCGGCGGGCGCCGGCCGGGCCTACAGAGCGGGTGACGAAGCCCCATACGCTCGAGGACCGGACG CGGTGCCGCCGCTGCCTTTCGGGCCCGCCCCCCGGGAGCCGGGGGGCGAAGCCCAACACACAAGCCGTGCTTGAG GGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGAT TCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCG TTGTTGAAAGTTTTAACTGATTTAGCTAATCTGCTCAGACTGCAATCTTCAGACAGAGTTCATTGGTGTCTTCGG CGGGCGCGGGCCCGGGGGCGAGTGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTAGAATAAAC ACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGT TAC Penicillium simplicissimum Sequence ID: GU981587.1 Identities: 495/496 (99%) >LPH 261 21.5-4 ITS 5-ITS4 ITS 600 VT 1561 TGTTTTACGGACGTGGACGCGCCGCGCTCCCGGTGCGAGTTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAG ACCGCCACTGTATTTCGGGGCCGGCACCCGTGTGAGGGGTCCCGATCCCCAACGCCGATCCCCCGGAGGGGTTCG AGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATG ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATC CGTTGTTGAAAGTTTTGATTCATTTTGAATTTTTGCTCAGAGCTGTAAGAAATACGTCCGCGAGGGGACTACAGA AAGAGTTTGGTTGGTTCCTCCGGCGGGCGCCTGGTTCCGGGGCTGCGACGCACCCGGGGCGTGACCCCGCCGAGG CAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACG GAGACCTTGTTAC Trichoderma asperellum Sequence ID: KM456217.1Identities: 538/538 (100%) >LPH 262 22.5-4 ITS 5-ITS4 ITS 600 VT 1562 GTTGCAAATAAATGCGTCGGCGGGCGCCGGCCGGGCCTACGGAGCGGAAGACGAAGCCCCATACGCTCGAGGACC GGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGCCGGGGGACGAGGGCCCAACACACAAGCCGGG CTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTC GATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGA GATCCATTGTTGAAAGTTTTAACTGATTGCAAAGAATCACACTCAGACTGCAAGCTTTCAGAACAGGGTTCATGT TGGGGTCTCCGGCGGGCACGGGCCCGGGGGCGAGTCGCCCCCCGGCGGCCAGCAACGCTGGCGGGCCCGCCGAAG CAACAAGGTACAATAGTCACGGGTGGGAGGTTGGGCCATAAAGACCCGCACTCGGTAATGATCCTTCCGCAGGTT CACCTACGGAAACCTTGTTAC Aspergillus terreus Sequence ID: KR610363.1Identities: 546/546 (100%) >LPH 263 23.5-4 ITS 5-ITS4 ITS 600 VT 1563 TTTGGTGGTGACCAACCCCCGCAGGTCCCTCCCGAGCGAGTGACAAAGCCCCATGCGCTCGAGGACCCGACGGGC GTCGCCGCTGCCTTTGGGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGA CGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTC Hoàng Văn Năm Page75 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC TGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGT TTTGACAATTTTCTAGGTACTCAGACAGCCCTATCTTCTTCAGAGTTCAGGGGGTGCTTCGGCGGGCGCGGGCCC GGGGACAGGCGTCCCCAAGCGACCAGGTGACCCCAGTGGGCCCGCCAAAGCAACAGGTATTATAACGGCACGGGT GGGAGGTTGAGCCCAGAGGGCTCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAACGGCTAGAGTTCA CAATGGGAAGTTTCAACAGAGTTTTGACTGGGGGACTCAACTAGAAAGCTGCGTCCTGAGGCAAGCGCACATCTC AACACCAGGAAGGGTACATATAAATACCACGTGACATATGCAATCCTCGAAACAACCCCTAGACAGCTCCCCCTC TGTAAAAATCCCAAACAGTGTACTTGTCTCTCCAGTTTCCTAGAGAGCCCGACTATATCTTAAGCAGGACCCCGG AACAGGGTGCCCACCCACTTCCACTTAGTCTGTGAACGTTCCCCATATCCCGGAGGACGTAGGGGCTTCGCTGCG GATTGCCCATCATCTCTGCCTGGGGCAGAACTATCCAAGTCGTCTATTACCTTCCCCCATGATGTGTTCAT Talaromyces helicus Sequence ID: KM066176.1Identities: 446/448 (99%) >LPH 263-1X 24.5-4 ITS 5-ITS4 ITS 600 VT 1564 ATCGTGGGTGGCCAACGCCCGCAGGCCCCTCCCGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCTAGACGGG ACGTCGCCGCTGCCTTTCGGGCAGGTCCCCCCAACACCGGGGGGACCACACCCAACACACAAGCCGCGCTTGAGG GCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATT CACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCAT TGTTGAAAGTTTTGATAATTCAAAATCACACTCAGACAGCCCATCTTCATTAGGGTTCACAGAGCGCTCTGGCGG GCGCAGGCCCGGGGGCGCAGTGCCCCCCGGCGACCGGGGCGACCCGGTGGGCCCGCCAAAGCAACAGGGTATTCA AGAGACACGGGTGGGAGGTTGGACCCGCGAGGGGTCCGCACTCAGTAATGATCCTTCCGCAGGTTCACCTACGGA AACCTTGTTACG Talaromyces atroroseus Sequence ID: NR_137815.1 Identities: 453/453 (100%) >LPH 263-2T 25.5-4 ITS 5-ITS4 ITS 600 VT 1565 GGTGGTGACCAACCCCCGCAGGTCCCTCCCGAGCGAGTGACAAAGCCCCATGCGCTCGAGGACCCGACGGGCGTC GCCGCTGCCTTTGGGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGC TCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGC AATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTT GACAATTTTCTAGGTACTCAGACAGCCCTATCTTCTTCAGAGTTCAGGGGGTGCTTCGGCGGGCGCGGGCCCGGG GACAGGCGTCCCCAAGCGACCAGGTGACCCCAGTGGGCCCGCCAAAGCAACAGGTATTATAACGGCACGGGTGGG AGGTTGAGCCCAGAGGGCTCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAACGGCTAGAGTTCACAA TGGGAAGTTTCAACAGAGTTTTGACTGGGGGACTCAACTAGAAAGCTGCGTCCTGAGGCAAGCGCACATCTCAAC ACCAGGAAGGGTACATATAAATACCACGTGACATATGCAATCCTCGAAACAACCCCTAGACAGCTCCCCCTCTGT AAAAATCCCAAACAGTGTACTTGTCTCTCCAGTTTCCTAGAGAGCCCGACTATATCTTAAGCAGGACCCCGGAAC AGGGTGCCCACCCACTTCCACTTAGTCTGTGAACGTTCCCCATATCCCGGAGGACGTAGGGGCTTCGCTGCGGAT TGCCCATCATCTCTGCCTGGGGCAGAACTATCCAAGTCGTCTATTACCTTCCCCCATGATGTGTTCAT Talaromyces barcinensis Sequence ID: NR_137078.1Identities: 504/509 (99%) >LPH 264 26.5-4 ITS 5-ITS4 ITS 600 VT 1566 GGAAAACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGG TGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGC AGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCA CTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTG TTGAAAGTTTTAACTGATTGCATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTTCGTGTTGGGGTCTCCG GCGGGCACGGGCCCGGGGGGCAGAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTA CAATAGACACGGATGGGAGGTTGGGCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGA AACCTTGTTA Aspergillus niger Sequence ID: KP724986.1Identities: 535/535 (100%) >LPH 265 27.5-4 ITS 5-ITS4 ITS 600 VT 1567 AACGGCACGCCGCCGTCCACACCCATCGAGCGACTGAACAAAGTCTCGCAACGCTCGGGGACGGACGGCCGGGCC GGACGGCGTTTGAGGCGCGCGGCGGCATCGCCGCGGCGCCCAATACCCAGCCGGGCTGGAGTGGTGCAATGACGC TCGAACAGGCATGCCCCCCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGC AATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTT GTTTGATTTCGCTTTACGCTCAGACGCTCAGCAAGACAGTGTTGGGAAGGTCCCGCGGGGGCCCCGGCGCGCGGC Hoàng Văn Năm Page76 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC CGGGTCACCCCCCAGGCATAAGGGGTTGAAGGTTTGGGGGTCGGAGGTCGGGCCGGAACCCTCACTCGGTAATGA TCCCTCCGCAGGTTCACCTACGGAGACCTTGTTAC Acidomyces acidothermus Sequence ID: JQ904606.1Identities: 484/485 (99%) >LPH 266 28.5-4 ITS 5-ITS4 ITS 600 VT 1568 CTGAGAAGATTGGGGGTCGAGGCAAGCCCCGGCCGGGCCCATAGAGCGGGTGACAGAGCCCCATACGCTCGAGGA CCGGACGGTGCCGCCGTTTCTCTCGAGGCCCGCCCCCGGGGGGGCGCGGCCCAACAACCAGCGGGGCTGGAGGGG AGAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCA CTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTG TTGAAAGTTTTGACTGATTGGTATCAATCGACTCAGACTGCACGCTTTCAGACAGTGTTCCATTGGGGTCTCCGG CGGGCGCGGTCCCGGGGGCAGGCCCCGGGCCGCCCGAAGGCGGGCCCGCCGAAGCAACAGGGTACGGTAAGCACG GGTGGGAGGTTGGGCCCCGAAGGACCCAGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTT A Aspergillus aculeatus Sequence ID: JX501384.1Identities: 517/517 (100%) >LPH 267 29.5-4 ITS 5-ITS4 ITS 600 VT 1569 TCACCTGGTAAGAAGAGGTTGCCAGGCTGGCGCCGGCCGGTCCTGCAGAGCGGGTGACAGAGCCCCATACGCTCG AGGATCGGACGCGGTACCGCCGCTGCCTTTCGGGCCCGTCCCCCCCCGGAGCGGGGGGACGGCGACCCAACACAC AAGCCGGGCTTGAGGGTAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTC AAAGACTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGCAGTTCGCTGCGTTCTTCATCGATGCCGG AACCAAGAGATCCGTTGTTGAAAGTTTTGACTGATTTTAGAAATCCACTCAGACGGCAGTCTTCAGACAGCGTTC GTGTGGTCCCCGGCGGGCGCTCGCACGGGGGCCGAAGCCCCATGGCGGCCCCCAAGGTTGGGGGCGGGCCCGCCG AAGCAACGTGGTACGGAGACACGGATGGGAGGTTGGCACCCCGAAGGGGCCGCACTCGGTAATGATCCTTCCGCA GGTTCACCTACGGAAACCTTGTTA Phialosimplex caninus Sequence ID: GQ169313.1Identities:491/537 (91%) >LPHT 220 220 5-4 ITS 5-ITS4 ITS 600 VT 1570 GACCTTCAGAGGCTATGGCCCCGGCCGGACCCCTCCTTGAGCGCGTGACAGAGCCCCATACGCTCGAGGACCGGA CGCGACGCCGCCGCTGCCTTTCAGGCCCGTCCCCTCCAAACGAGGGGACGGCGGCCCAACACACAAGCCGTGCTT GAGGGTTCGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGA TGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGA TCCATTGTTGAAAGTTTTGAACGATTGCATTTCGTCACTCAGACAATCCTCGCATTCACAAAAGCGTTCACAGTG AGTGCCTCTGGCGGGCACGGGCCCCGGGGGCACACCGCGCCCCGGGACGACCCCCCCGGCGGAACACCGGAGGAG TGGGCCCGCCAAAGCAACACTAGGTGTGGTAGACACGGGTGGGAGATTGGGACCCGACTGGGTTCCCGCACTCGG TAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Thermomyces lanuginosus Sequence ID: NR_121309.1Identities: 565/565 (100%) >LPHT 221 221 5-4 ITS 5-ITS4 ITS 600 VT 1571 TGCTTTCCGTTTAACGGCTAGGACCTAGAGCATGCCTTAAGCGAGGTAGTTGCTACTATGCTTAGGGTGATAGTG GGCACCGCCATTGGTTTTTAGGGCCTGCGGGTAGCTGTAGGTCCCTAACACAAGCCCGGGGCTTGATGGTCGAAA TGACGCTCGGACAGGTATACCCGCCGGAATGCCGGCGGGCGTAATGTGCGTTCAAAGATTCGATGATTTACGGAA TTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTTATCGATGCTAGAACCAAGAGATCCGTTGTTGAA AGTTTTGACTTATTCAGTATAGAAGACTTAGAGAGGCCTTGTGTATACGAGAATGGTTTGGAGCCTCCGGCGGGC GCCTCTGCGAGGGGGGCTAGGGGGCGCGCTGGCGGGCCCGTAGGGGCCCTGGCGCTGCCCGCCGAAGCAACGGTT AGGTAAGGTCCACAGTGGTTTGGGAGTCTTGCAACTCTGTAATGATTCCTCCGCTAGTTCACCAACGGAGACCTT GT Thielavia terrestris Sequence ID: CP003011.1 Identities: 488/527 (93%) >LPHT 222 222 5-4 ITS 5-ITS4 ITS 600 VT 1572 GCTTTCCGTTTAACGGCTGGGACCTGGAGTATACCCTGAGCGAGGTGGTTGCTACTACGCTTGGGGTGACAGTGG GTACCGCCACTGGTTTTCGGGGCCTGTGGGTAGTCGTAGGTCCCTAATACAAGCTTGGGGCTTGATGGTCGAAAT Sordariales Sequence ID: KU365891.1Identities: 134/150 (89%) Thielavia sp Hoàng Văn Năm Page77 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC Sequence ID: KJ813011.1Identities: 134/150 (89%) >LPHT 223 223 5-4 ITS 5-ITS4 ITS 600 VT 1573 ACCTTCAGAGGCTATGGCCCCGGCCGGACCCCTCCTTGAGCGCGTGACAGAGCCCCATACGCTCGAGGACCGGAC GCGACGCCGCCGCTGCCTTTCAGGCCCGTCCCCTCCAAACGAGGGGACGGCGGCCCAACACACAAGCCGTGCTTG AGGGTTCGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGAT GATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGAT CCATTGTTGAAAGTTTTGAACGATTGCATTTCGTCACTCAGACAATCCTCGCATTCACAAAAGCGTTCACAGTGA GTGCCTCTGGCGGGCACGGGCCCCGGGGGCACACCGCGCCCCGGGACGACCCCCCCGGCGGAACACCGGAGGAGT GGGCCCGCCAAAGCAACACTAGGTGTGGTAGACACGGGTGGGAGATTGGGACCCGACTGGGTTCCCGCACTCGGT AATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Thermomyces lanuginosus Sequence ID: NR_121309.1 Identities: 564/564 (100%) >LPHT 225 225 5-4 ITS 5-ITS4 ITS 600 VT 1574 CTTTCCCGTTTAACGGCCAGGACCTGGAGCACGCCCTGAGCAAGTGGTTGCTACTATGCTCGGGGTGACAGCGGG CTCCGCCACTGGTTTTCGGGCCTATAAGTAGCCGTAGGTCCCTAACATAAGCCTAGGGGCTTAATGGTCGAAATG ACGCTCGGACAGGCATGCCCGCCAGAATGCTAGCGGGCGCAATGTATATTTAAAGATTCGATGATTCACGGAATT CTGCAATTCACATTACTTATCGCATTTCGCTACGTTCTTCATCGATGCTAGAAC Thielavia sp Sequence ID: KJ813011.1Identities: 253/281 (90%) >LPHT 225 225 5-4 ITS5-ITS4 ITS5 600 VT 1660 TTGATTGGGGTCGCCGGCGGGCGCCGGCCGGGCCTACAGAGCGGGTGACGAAGCCCCATACGCTCGAGGACCGGA CGCGGTGCCGCCGCTGCCTTTCGGGCCCGCCCCCCGGGAGCCGGGGGGCGAAGCCCAACACACAAGCCGTGCTTG AGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATG ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATC CGTTGTTGAAAGTTTTAACTGATTTAGCTAATCTGCTCAGACTGCAATCTTCAGACAGAGTTCATTGGTGTCTTC GGCGGGCGCGGGCCCGGGGGCGAGTGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTAGAATAA ACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTT GTTA ACTGTGGACCTTACTTAACCGTTGCTTCGGCGGGCGGCGCTAGGGCCCCTATAGGCCCGCTAGCGCGCCCCCCGG CCCCCCTCGCGGGGGCGCCCGCCGGAGGCTCTAAACTATTCTCGTATATACAAGGCCTCTCTGAGTCTTCTATAC TGAATGAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTAGCATCGATGAAGAACGTAGCGAAATGCGATAAGT AATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAATATATATTGCGCCCGCTAGCATTCTGGCGGGTAT GCCTGTCCGAGCGTCATTTCGACTATCAAGCCCTAGGCTTGTGTTAGGGACCTGCGGCTACTCATAGGCTTCGAA AACCAGTGGCGGTGCCCGCTGTTACCCCGAGCATAGTAGCAACCACCTTGCTCAGGGCGTGCTCCAGGTCCTGGC CGTTAAACGGAAAGCAACCCCCTAAAGGTTGACCTCAGATTAGGTAGGAGGACCCACTAAACTTAAGCATATC Thielavia sp Sequence ID: KJ813011.1 Identities: 481/523(92%) >LPHT 227 227 5-4 ITS 5-ITS4 ITS 600 VT 1575 GTCTGACGGGTAGGCGGGCACCGGCCGGCACCTCCAGAGCGGGTGACAGAGCCCCATACGCTCAGGGACCGGAAA CGCGGCACCGCCGCTGCCTTTCGGGCCCGTCCCTCCCCGCGGGAAGGGACGGCGGCCCAACACACAAGCCGTGCT TGAGGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGAGGGCGCAATGTGCGTTCAAAGATTCG ATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAG ATCCGTTGTTGAAAGTTTTGACGATTGTGTTTTCCACTCAGACCGCAACCTTTGTTCAAGACAGCGTTCACGAGG GTCTCCGGCGGGCACGGGCCCGGAGGCACGGGAGATGGCCCCCCGGCGGCCAGGGACAGGAGCCCCCCTGGCGGG CCCGCCGAAGCAACACGGTACGGTAGACACGGGTGGGAGGTCGGGCCCGCAAAGGGGACCCTCACTCGGTAATGA TCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC Rasamsonia emersonii Sequence ID: JF417478.1Identities: 559/559 (100%) >LPHT 228 228 5-4 ITS 5-ITS4 ITS 600 VT 1576 AGTTGAATTTATTTGTGGTTGATTGACCTTTATACTTGATCATCTCGAAGCACACTGGTAAAAAATTAGATACCA ATGCAAGCCCTCAAGGAAATATCAAGGGTCAACAACATACAAATTGTTCGGGTAGCTTGAACGGATGAAAATCCA TCAGCACCGCAAATCCAAAGATTTATCAAAAAATAAACCTTTAGGGGTTAATAAAGATACTGAACTAGACGTACC CAATGGATGAACCAAAGGGTGCAAGGTGCGTTCGAGAATTCGATGATTCGCAAAGGCTGCAGATCGCATTACTTT Hoàng Văn Năm Page78 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC TCGCAATTTGCTACGCTCTTCATCGATGCGAGAACCAAGTGATCCATTGCTTAAAGTTGTTTTGAAATTTTATCG TCTTGAATCATTTCTGATCCAAAACTTTCAATTTGTTAAACAACAGTCAATCAAATATGTAAAATAAAAGGTCGA GAGATCTGGAGCAATCCCTCAGAACATTTCACAAAAAGGAGAGAATCGCGGCTCACCAATAGAGGTCACCACGAT TTCCACAACTTTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Rhizomucor pusillus Sequence ID: JN206313.1Identities: 540/540 (100%) >LPHT 230 230 5-4 ITS 5-ITS4 ITS 600 VT 1577 (xấu) AGCTAGGACCTAGAGCACGCCCTAAGCAAGGTGGTTGCTACTATACTCAGGGTAATAGTGGGCACCGCTACTGGT TTTCAGGGCCTATAGGTAGCTACAGGTCCCCAACACAAGCCTAGGGCTTGATAGTCGAAATGACGCTTGGACAGG TATACCTACTAGAATACCGGTAGGCGCAATGTACGTTCAAAGATTCGATGATTCATAGAATTCTACAATTCATAT TACTTATCGTATTTTGCTACGTTCTTTATCGATACTAGAACTAAGAGATCTATTGTTGAAAGTTTTAACTTATTT AGTATAGAAGACTCAGAGAGGCCTTGTATATACGAGAATAGTTTAGAGCCTCTAGTAGGCGCCTCTGCGAGGGGG GCCAGGGGGCGTGCTAGCAGGCCTATAGGGGCCCTAGCGCCGTCCGCCAAAGCAACGGTTAGGTAAGGTCTATAA TAGTTTAGGAGTCTTACAACTCTATAATAATCCCTCTGCTAGTTCATTAACGGAGACCTTGT Thielavia ovispora Sequence ID: AJ271593.1Identities: 431/491 (88%) >LPHT 230 230 5-4 ITS5-ITS4 ITS5 600 VT 1662 GAGTTGTAAGACTCCTAAACTATTATAGACCTTACCTAACCGTTGCTTTGGCGGACGGCGCTAGGGCCCCTATAG GCCTGCTAGCACGCCCCCTGGCCCCCCTCGCAGAGGCGCCTACTAGAGGCTCTAAACTATTCTCGTATATACAAG GCCTCTCTGAGTCTTCTATACTAAATAAGTTAAAACTTTCAACAATAGATCTCTTAGTTCTAGTATCGATAAAGA ACGTAGCAAAATACGATAAGTAATATGAATTGTAGAATTCTATGAATCATCGAATCTTTGAACGTACATTGCGCC TACTGGTATTCTAGTAAGTATACCTGTCCAAGCGTCATTTCGACTATTAAGCCCTAGGCTTGTGTTGGGGACCTG TAGCTACCTATAGGCCCTGAAAACCAGTAGCGGTGCCTACTATTACCCCGAGTATAGTAGCAACCACCTTGCTTA GGGCGTGCTCTAGGTCCTAGCTATTAAACAGAAAGTAACCCTCCAAAGGTTGACCTCGGATTAGATAGGAGGACC CACTAAACTTAAGCATATCAATAA Thielavia ovispora Sequence ID: AJ271593.1 Identities: 471/542(87%) >LPHT 231 231 5-4 ITS 5-ITS4 ITS 600 VT 1578 TAGTGCTAAAGACGCAAAGGTCGCTTTACGGCCAGCACCCGCAGCACTCCCAAAGCGAGGTTGTAAGCTACTACG CTCGGTGTGTCTTGCGAGCCCGCCACTGCATTTCAGGGCCTGCGGCAGCCGCAGGTCCCCAACACAAGCCCAGGG CTTGATGGTTGAAATGACGCTCGAACAGGCATGCCCGCCGGAATACCGGCGGGCGCAATGTGCGTTCAAAGATTC GATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGA GATCCGTTGTTGAAAGTTTTGACTTATTCAGTACATAAACTCAGAGAGGCCATGTGCTGCAAAGGGTTTGGGGTA TTCCTCCGGCGGGAGCCTCCCCCCACGCCGCGGGGGCGGGGGATCGGCCGAGGGGCGCCGAGGCGCCTCCCGCCG AAGCAACAGAAGGGTCGGTTCACAATGGTTTGGTGAGTTGTGTAACTCTGTAATGATCCCTCCGCTGGTTCACCA ACGGAGACCTTGTTA Scytalidium thermophilum Sequence ID: FJ548831.1 Identities: 540/540 (100%) >LPHT 232 232 5-4 ITS 5-ITS4 ITS 600 VT 1579 CACCTTTGGGGGGTTGCTTTCTGTTTAATGGCTAGGACCTGGAGTACGCCCTAAGTAAGGTGGTTGCTACTACGC TTAGGGTGATAGTGGGCATCGCCACTGGTTTTCGGGGCCTATAGATAGCCGTAGGTCCCTAATACAAGCCTAGGG CTTGATAGTCGAAATGACGCTCAGACAGATATATCTACTAGAATATTGGTAGGCGCAATATACGTTTAAAGATTC GATGATTCATAGAATTCTACAATTCACATTACTTATTGTATTTTGCTATATTCTTTATCGATGCTAGAACCAAGA GATCCATTGTTAAAAGTTTTGACTCATTTAGTATAGAAGACTCAGAGAGGCCTTGTATATACAAGAATAGTTTAG AGCCTCCGGTGGGCGCCCCCGCGAGGGGGGCCGGGGGGCGCGCTAGCGGGCCTGTAGGGGCCTTAGCGCCGCCCA CTGAAGCAACGGTTAAGTAAGGTCTATAGTGGTTTAGGAGTCTTGCAACTCTATAATAATCCCTCCGCTAGTTCA CTAATAGAGACCTTGTT Aspergillus sp Sequence ID: FJ571436.1 Identities: 110/128(86%) >LPHT 233 233 5-4 ITS 5-ITS4 ITS 600 VT 1580 GCGAGGTGGTTGCTACTACGTTTAGGGTGATAGTGGGCATTGCCATTGGTTTTTGGGGCCTATAAGTAGCTGTAG GTCCCTAATATAAGCCTAGGGCTTGATAGTCGAAATGACGCTCAGATAGGTATACCCACTAGAATGCTGGTGAGT GTAATGTACGTTTAAAGATTCGATGATTTATAGAATTCTGCAATTTACATTACTTATTGTATTTCGCTATGTTCT Hoàng Văn Năm Page79 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC TTATCGATACTAGAACTAAGAGATCCGTTATTAAAAGTTTTGACTTATTTAGTATAGAAGACTCAGAGAGGCCTT GTATATACGAGAATGGTTTAGAGCCTTTGGCAGGCGCCTTTGCAAAGGGGGCTAGGGGGCGCGCTAGTGAGCCTA TAGAGGCCCTAGCGCTACCTACTAAAACAACGGTTAGGTAAGGTCTATAGTGGTTTAGGAGTCTTACAACTCTGT AATGATCTCTCCGCTAGTTCACCAACGGAGACCTTGTTA Uncultured Cryptosporiopsis Sequence ID: FR774103.1Identities: 116/130 (89%) >LPHT 234 234 5-4 ITS 5-ITS4 ITS 600 VT 1581 CCTTGGAAGATGTCTGACGGGTAGGCGGGCACCGGCCGGCACCTCCAGAGCGGGTGACAGAGCCCCATACGCTCA GGGACCGGAAACGCGGCACCGCCGCTGCCTTTCGGGCCCGTCCCTCCCCGCGGGAAGGGACGGCGGCCCAACACA CAAGCCGTGCTTGAGGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGAGGGCGCAATGTGCGT TCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCC GGAACCAAGAGATCCGTTGTTGAAAGTTTTGACGATTGTGTTTTCCACTCAGACCGCAACCTTTGTTCAAGACAA GCGTTCACGAGGGTCTCCGGCGGGCACGGGCCCGGAGGCACGGGAGATGGCCCCCCGGCGGCCAGGGACAGGAGC CCCCCTGGCGGGCCCGCCGAAGCAACACGGTACGGTAGACACGGGTGGGAGGTCGGGCCCGCAAAGGGGACCCTC ACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC Rasamsonia emersonii Sequence ID: JF417478.1Identities: 570/571 (99%) >LPHT 246 246 5-4 ITS 5-ITS4 ITS 600 VT 1582 GATTGACGGGTGGGCAGGCACCGGCCGGACCTCCAGAGCGGGTGACAGAGCCCCATACGCTCAAGGACCGGAACG CGGCACCGCCGCTGCCTTTCGGGCCCGTCCCCGAGGGGGACGGCGGCCCAACACACAAGCCGTGCTTGAGGGGCA GAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCAC GGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGT TGAAAGTTTTGACGATTATGCTTTTCACTCAGACTGCAACCTTTGTTCAAGACAGCGTTCGCGAAGGTCTCCGGC GGGCGCGGGCCCGGGGGCGCGGTAGATGGCCCCCCGGCGGCCAGGGACAGAAGCCCCCGGCGGGCCCGCCGAAGC AACACGGTACAGTAGACACGGGTGGGAGGTCGGGCCCGCGAAGGGGACCCTCACTCAGTAATGATCCTTCCGCAG GTTCACCTACGGAAACCTTGTTAC Rasamsonia byssochlamydoides Sequence ID: JF417477.1Identities: 545/553 (99%) >LPHT 251 251 5-4 ITS 5-ITS4 ITS 600 VT 1583 GTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGG TGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGC AGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCA CTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTG TTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTCG GCGGGCGCGGGCCCGGGGGCGCAAGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTAC GATAGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAA ACCTTGTTACGA Aspergillus fumigatus Sequence ID: KP131574.1Identities: 537/537(100%) >LPHT 253 253 5-4 ITS 5-ITS4 ITS 600 VT 1584 GACCTTCAGAGGCTATGGCCCCGGCCGGACCCCTCCTTGAGCGCGTGACAGAGCCCCATACGCTCGAGGACCGGA CGCGACGCCGCCGCTGCCTTTCAGGCCCGTCCCCTCCAAACGAGGGGACGGCGGCCCAACACACAAGCCGTGCTT GAGGGTTCGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGA TGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGA TCCATTGTTGAAAGTTTTGAACGATTGCATTTCGTCACTCAGACAATCCTCGCATTCACAAAAGCGTTCACAGTG AGTGCCTCTGGCGGGCACGGGCCCCGGGGGCACACCGCGCCCCGGGACGACCCCCCCGGCGGAACACCGGAGGAG TGGGCCCGCCAAAGCAACACTAGGTGTGGTAGACACGGGTGGGAGATTGGGACCCGACTGGGTTCCCGCACTCGG TAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Thermomyces lanuginosus Sequence ID: NR_121309.1Identities: 565/565(100%) >LPHT 254 254 5-4 ITS 5-ITS4 ITS 600 VT 1585 GTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGG TGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGAG CAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACT Hoàng Văn Năm Page80 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC GAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTT GAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTCGGC GGGCGCGGGCCCGGGGGCGCAAGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTACGA TAGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAAC CTTGTTAC Aspergillus fumigatus Sequence ID: KP131574.1 Identities: 535/535(100%) >LPHT 269 269 5-4 ITS 5-ITS4 ITS 600 VT 1586 TCTGACCTTTGAGGCTATGGCCCCGGCCGGACCCCTCCTTGAGCGCGTGACAGAGCCCCATACGCTCGAGGACCG GACGCGACGCCGCCGCTGCCTTTCAGGCCCGTCCCCCCCCCCTGCAACGGGGGGACGGCGGCCCAACACACAAGC CGTGCTTGAGGGTTCGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAA GATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAAC CAAGAGATCCATTGTTGAAAGTTTTGAACGATTGCATTTCATCACTCAGACAATCCTCGCATTCACAACAAGCAT TCACAGTGAGTGCCTCTGGCGGGCACGCGCCCCGGCAAAACCGCGCCCCGGGACGACCCCCCCGGCGGAGACCGG AGGAGTGGGCCCGCCAAAGCAACACCAGGTGTGGTAGACACGGGTGGGAGATTGGGACCCGATGGGGGTTCCCGC ACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Thermomyces dupontii Sequence ID: FJ548825.1Identities: 570/572(99%) >LPHT 224 224 5-4 ITS 1F-ITS4 ITS 600 VT 1587 TTATAAAAGTTTTTGGTTTTAAATTGGGGTTTCCCCAAACAATGGAAACCCCAAATTTCAAAATTTTAAAATTCC AAATAAGCCCCTTCAAAAAGGTCCCCCATCCAAAAAGGGCCAAAACCCCAAAACCGGTCCAATAACTTGGAAGGG GGAACCCAAAAAAAATTGGTTTTGCCCCCCCCCCCTCCACCCCCCAAAACCCAAAAATCCACAACAAAATTTAAT CCTTTGGGGTTCCAAAAAAAACCGAACTAAACCTACCCCAGGGGAGAACCCAAGGGGGGAAAAAGGCTTCCAAAA TTT >LPHT 226 226 5-4 ITS 1F-ITS4 ITS 600 VT 1588 GTGTTCAAGAGTGGTTTGCACTTCAAACATAGCAAGTTTGGCAACATTGCTTCGAGATCAGCCTACTAAGTAAGC ACAGAAGCGATCCAAAGCACACAGGCGTGCCTTAGCATCGCTTACCAGTATTGCCGGAGCAACACCTAGAAGTCA AATGCAGTTGCAAAAGAAAAGAGAACTTTTCTTTCAAACTCAATGATACTCTCAATCAGATGAAACTAGTCTTGT AACGGACTAGCTGCATTGCGCATTAGAATAGTCGAGTGATGTTTTATGGACTATAGCATATAACACCGATTAACG TATCTAGCTACGTTCTTCATCGACCTGCGAGCCAAGTGATCCACCACTAATAGTTGTGAATTCGTTTTTCGTTTC AAAAGGCTAGAAATGGGTTTCGGTCGGCTGGAAACCATTCCAGGTCCGACCACGTTGCCCGGAGGCACCGTTCAT TTGGTTCATACATTAGTATGTATTTGGATTGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTA CTTC Arthrobotrys arcuata Sequence ID: AF106527.1Identities: 61/64 (95%) 236 -1 1F.4 ITS 1F-ITS4 ITS 600 VT 1589 >LPHT 236-1Đ GAGGTGGTTGCTACTACGCTTAGGGTAATAGCGGGCATCGCCACTGGTTTTCGGGGCCTATAGACAGCTATAGGT CCCTAATATAAGCCTAGGGCTTGATAGTCGAAATAACGCTTAGATAGGTATATCCATCGGAATGCTGGCGAGCGC AATGTACGTTCAAAGATTCGATGATTTATAGAATTCTGCAATTTATATTATTTATCGTATTTCGCTATGTTCTTT ATCGATACTAGAACCAAGAGATCTATTGTTGAAAGTTTTGACTTATTCAGTATAGAAGACTTAGAGCAGCCTTAT ATATATAAGAATGGTTTAGAGCCTCTAGCGGGCGCCCCTGCGAGGGGGGCCGGGGGACACGCTAGTAGGCCTATA GGGGCCCTAGCGCCGCCTACCGAAGCAACAGTTAAATAAAGTCTACAGTGGTTTAGGAGTCTTGCAACTCTATAA TGATCCCTCCACTAGTTC Thielavia terrestris Sequence ID: CP003011.1Identities: 429/508 (84%) >LPHT 236-2T 236 -2 1F.4 ITS 1F-ITS4 ITS 600 VT 1590 TGCTTTCCATTTAACGGCTAGGACCTAGAGTATACCTTAAGCGAGGTGGTTGCTACTACGCTTAGGGTA ATAGCGGGCATCGCCACTGGTTTTCGGGGCCTATAGACAGCTATAGGTCCCTAATATAAGCCTAGGGCTTGATAG TCGAAATAACGCTTAGATAGGTATATCCATCGGAATGCTGGCGAGCGCAATGTACGTTCAAAGATTCGATGATTT ATAGAATTCTGCAATTTATATTATTTATCGTATTTCGCTATGTTCTTTATCGATACTAGAACCAAGAGATCTATT GTTGAAAGTTTTGACTTATTCAGTATAGAAGACTTAGAGCAGCCTTATATATATAAGAATGGTTTAGAGCCTCTA GCGGGCGCCCCTGCGAGGGGGGCCGGGGGACACGCTAGTAGGCCTATAGGGGCCCTAGCGCCGCCTACCGAAGCA ACAGTTAAATAAAGTCTACAGTGGTTTAGGAGTCTTGCAACTCTATAATGATCCCTCCACTAGTTCACCAACGGA GACCTTGTTACGACTTTTACTTCCTCT Thielavia terrestris Hoàng Văn Năm Page81 VIỆN ĐẠI HỌC MỞ HÀ NỘIKHOA CÔNG NGHỆ SINH HỌC Sequence ID: CP003011.1Identities: 457/546 (84%) >LPHT 236 236 1F-4 ITS1F-ITS4 ITS1F 600 VT 1656 GCCCCTATAGGCCTACTAGCGTGTCCCCCGGCCCCCCTCGCAGGGGCGCCCGCTAGAGGCTCTAAACCATTCTTA TATATATAAGGCTGCTCTAAGTCTTCTATACTGAATAAGTCAAAACTTTCAACAATAGATCTCTTGGTTCTAGTA TCGATAAAGAACATAGCGAAATACGATAAATAATATAAATTGCAGAATTCTATAAATCATCGAATCTTTGAACGT ACATTGCGCTCGCCAGCATTCCGATGGATATACCTATCTAAGCGTTATTTCGACTATCAAGCCCTAGGCTTATAT TAGGGACCTATAGCTGTCTATAGGCCCCGAAAACCAGTGGCGATGCCCGCTATTACCCTAAGCGTAGTAGCAACC ACCTCGCTTAAGGTATACTCTAGGTCCTAGCCGTTAAATGGAAAGCAACCCCCTAAAGGTTGACCTTGGATTAGG TAGGAGGACCCACTAAACTTAAGCATAT >LPH 216 216 1F.4 ITS 1F-ITS4 ITS 600 VT 1591 CAAGGTGGTTGCTACTACGCTCGGGGTGACAGTGGGCACCGCCACTGGTTTTCAGGGCCTGTAGGTAGCCGCAGG TCCCTAATACAAGCCTAGGGCTTGATGGTCGAAATGACGTTCGGATAGGTATACCCGCCGGAATACCGGCGGGCG CAATGTGCGTTCAAAGATTCGATGATTCATAGAATTCTGCAATTCACATTACTTATCGCATTTCGCTACGTTCTT TATCGATACTAGAACTAAGAGATCCGTTGTTGAAAGTTTTGACTCATTCAGTATAGAAGACTTAGAGAGGCCTTA TATATACTAAAATAGTTTGAAGCCTCTGGCGGGCGCCCCTGCGAGGGGGGCCGGGGGGCGCGCTAGTAGGCCTGT GGGGGCCCTGGCGCCTCCCACCCAAACAACCGTTAAGTAAAGTCCATAGTGGTTTAGGAATCTTGCAACTCTATA ATGATCCCTTCCCTGGTTCACCAACGGAAACCTTGTTACCACTTTTAC Thielavia terrestris Sequence ID: CP003011.1Identitie: 444/496 (90%) >LPH 216 216 1F ITS1F-ITS4 ITS1F 600 VT 1665 CGGAGGATCATTATAGAGTTGCAAGACTCCCAAACCACTATAGACCTTACCTAACCGTTGCTTCGGCAGGCAGCG CCAGGGCCCCTACAGGCCCGCTAACGCGCCCCCCGGCCCCCCTCGCGAGGGCGCCCGCCAAAGGCTCTAAACCAT TCTCATATATACAAGGCCTCTCTAAGTCTTCTATACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTAGTTC TAGCATCGATAAAGAACGTAGCGAAATGCAATAAGTAATATAAATTGCAGAATTCTATAAATTATCGAATCTTTA AACGTACATTGCGCCTACTAGCATTCCAGTGGGCATACCTATCCAAACGTCATTTCGACTATCAAGCCCCGAGCT TGTATTAAGGACCTACGGCTACCTATAGGCCCCGAAAACCAATAGCGGTACCCACTATCACCCTGAGCGTAATAG CAACCACCTCGCTCAGGGCATACTCTAGGTCCTAGCCGTTAAACGGAAAGCAACCCCCCAAAGGTTGACCTTGGA TCAGGTAGGAGGACCCGCTAAACTTAAGCATA Thielavia terrestris Sequence ID: CP003011.1 Identities: 489/558(88%) Hoàng Văn Năm Page82 ... xylanase nấm mốc chịu nhiêt (pH 2.0,50 ) ph n tích pH 3.0, pH 5.0, pH 7.0 Error! Bookmark not defined Hình 3.12 Hoạt tính xylanase chủng nấm mốc chịu pH thấp (pH 1.0, 30 °C) ph n tích pH 3.0, pH. .. thuỷ ph n mạnh nguồn giàu lignocellulose từ môi trường khác nhằm đáp ứng nhu cầu thực tiễn đời sống với đề tài: Ph n lập nấm mốc chịu nhiệt, chịu pH thấp ’ Mục tiêu: Tìm kiếm, ph n lập chủng nấm. .. sinh học PH N 2: PH ƠNG PH P NGHIÊN CỨU 2.1 Đối tượng nghiên cứu Để tìm kiếm chủng nấm mốc có khả thủy ph n lignocellulose chịu nhiệt chịu pH thấp tiến hành thu thập mẫu: gỗ mục, mùn cưa, ph n trâu
- Xem thêm -

Xem thêm: Phân lập nấm mốc chịu nhiệt, chịu ph thấp , Phân lập nấm mốc chịu nhiệt, chịu ph thấp

Gợi ý tài liệu liên quan cho bạn