Xây dựng cây phát sinh chủng loại của loài tảo Pseudonitzschia sp. G3 được phân lập ở thành phố Hải Phòng dựa trên trình tự Nucleotit của đoạn gien ITS1-5,8 S-ITS2

6 31 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 14/01/2020, 15:31

Bài viết trình bày xây dựng cây phát sinh chủng loại của loài tảo Pseudonitzschia sp. G3 được phân lập ở thành phố Hải Phòng dựa tren tình tự Nucleotit của đoạn gien ITS1-5,8 S-ITS2 góp phần khẳng định vai trò của sinh học phân tử trong việc hỗ trợ phương pháp phân loại tảo truyền thống dựa vào hình thái. 28(4): 68-73 12-2006 Tạp chí Sinh học Xây dựng phát sinh chủng loại loài tảo Pseudonitzschia sp.G3 đợc phân lập thành phố Hải phòng dựa trình tự nucleotit đoạn gien ITS1- 5,8 S-ITS2 Hoàng Thị Lan Anh, Đặng Diễm Hồng Viện Công nghệ sinh học Chu Văn Thuộc Viện Tài nguyên Môi trờng biển Hiện nay, tảo độc mối quan tâm hàng đầu ngành nuôi trồng thủy hải sản thiệt hại chúng gây ớc tính lên tới hàng triệu đô la Mỹ năm [3] Nhiều loài tảo đợc khẳng định nguồn gốc sinh độc tố đe doạ tàn phá khu hệ động thực vật ảnh hởng nghiêm trọng tới sức khỏe ngời Để giảm thiểu tác hại tảo độc gây ra, vấn đề giám sát cần đợc tiến hành thờng xuyên rộng khắp nớc ta, việc nghiên cứu tảo độc đợc tiến hành vài năm gần Theo thống kê Lasen cs (2004), số 70 loài tảo có khả gây độc đợc xác định phân bố vùng ven biển Việt Nam, có 11 loài tảo silic thuộc chi Pseudonitzschia đợc mô tả, loài Pseudonitzschia pungens P calliantha đợc xem loµi chiÕm −u thÕ, cã sù tÝch tơ tiỊm tµng ®éc tè axit domoic g©y héi chøng ngé ®éc mÊt trí nhớ tạm thời (ASP-amnesic shellfish poisoning) loài động vật thân mềm hai mảnh vỏ [7] Chi Pseudonitzschia bắt đầu đợc quan tâm nhiều kể từ phát axit domoic loài P multiseries sinh làm 153 ngời đảo Hoàng tử Edward (Canada) bị ngộ độc theo số thống kê gần đây, phát giới có 10 loài thuộc chi có khả sinh axit domoic, gây ảnh hởng tới hệ tiêu hóa, hệ thần kinh gây tử vong cho ngời [2, 4, 7] Do vậy, việc phát có mặt loài chi tảo thủy vực, để đa biện pháp nhằm giảm thiểu tác hại chúng quan trọng Hiện giới, phân loại tảo, kỹ thuật sinh học phân tử nh đọc so 68 sánh trình tự nucleotit đoạn gien ITS1-5,8SITS2 đợc sử dụng rộng rãi việc nghiên cứu phát sinh chủng loại tảo nói chung chi Pseudonitzschia nói riêng, vùng xảy nhiều biến đổi đặc trng cho loài trình tiến hóa [1, 3, 5, 6, 8] Với mẫu nghiên cứu loài Pseudonitzschia sp.G3 đợc phân lập Đồ Sơn thuộc thành phố Hải Phòng, tiến hành định tên phơng pháp quan sát hình thái phân tích trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 Những kết thu đợc góp phần khẳng định vai trò sinh học phân tử việc hỗ trợ phơng pháp phân loại tảo truyền thống dựa vào hình thái I Phơng pháp nghiên cứu Vật liệu - Vật mẫu loài tảo Pseudonitzschia sp.G3 Viện Tài nguyên Môi trờng biển Hải Phòng phân lập cung cấp, đợc nuôi cấy môi trờng K có nồng độ muối 24‰, ë nhiƯt ®é 25oC ®Ĩ thu sinh khèi cho bớc tách chiết ADN - Trình tự nucleotit đoạn gien ITS15,8S-ITS2 cđa 12 loµi thc chi Pseudonitzschia bao gåm: Pseudonitzschia pungens (Grunow ex P T Cleve) Hasle 1993 cã số đăng ký Ngân hàng gien quốc tế AY544769, Pseudonitzschia sp Hobart5 (AY257851), P australis Frenguelli (ay452528), P calliantha Lundholm, Moestrup et Hasle 2003 (AY257857), P cf australis Frenguelli (AY559850), P cf subpacifica (Hasle) Hasle (AY257860), P cuspidata (Hasle) Hasle 1993 (AY257853), P delicatissima (P T Cleve) Heiden 1928 (AY257849), P fraudulenta (P T Cleve) Hasle (AY257840), P galaxiae Lundholm et Moestrup (AY257850), P micropora Priisholm et Moestrup 2002 (AY257847) P multiseries (Hasle) Hasle (AY257844) đợc sử dụng để xây dựng phát sinh chủng loại II Kết thảo luận Mô tả hình thái loài tảo Pseudonitzschia sp.G3 đợc phân lập Hải Phßng - TOPO Kit h·ng Invitrogen (Mỹ) dïng để tách dòng gien Phơng pháp - ADN tổng số loài Pseudonitzschia sp.G3 đợc tách chiết theo phơng pháp Y K Hong có cải tiến cho phù hợp với điều kiện Việt Nam [5] - Đoạn gien ITS1-5,8S-ITS2 đợc nhân kỹ thuật PCR từ ADN tổng sè víi cỈp måi: Pseu F: 5’-GGATCATTACCACACCGATCCAAG -3’ PseuR: 5’-CGCAGATTCACATCCTGAGCTAGT- - Phản ứng PCR đợc thực với 20 àl hỗn hợp phản ứng chứa àl ADN khuôn; àl đệm 10X; 1,5 àl dNTP với nồng độ 2,5 mM loại; 0,3 àl Taq polymeraza Chu trình nhiệt đợc tiến hành nh sau: 94oC-3 phút (94oC-30 giây, 55oC-1 phút, 72oC-1 phút), lặp lại 35 chu kỳ; 72oC-5 phút; giữ sản phẩm 4oC Sau chạy điện di để kiểm tra gel agaroza 0,8%, sản phẩm PCR đợc gắn vào vectơ pCR2.1 TOPO đợc biến nạp vào chủng vi khuẩn Esherichia coli DH5T1; cuối đợc nuôi môi trờng chọn lọc LB có bổ sung ampixilin, X-gal (5-bromo-4-chloro-3-indolyl D-galactopyranosit) ADN plasmit đợc tách chiết kiểm tra có mặt đoạn gien ITS15,8S-ITS2 [9] - Trình tự nucleotit mẫu nghiên cứu đợc thực máy đọc trình tự tự động ABI PRISM (R) 3100-Avant Genetic Analyzer (USA) cđa ViƯn C«ng nghƯ sinh học Dựa chơng trình Clustal X Multiple Sequence Alignment Program (version 1.81, June 2000) DNASTAR, xây dựng phát sinh chủng loại loài Pseudonitzschia sp.G3 thu Đồ Sơn, với trình tự nucleotit 12 loài Pseudonitzschia đợc công bố Ngân hàng gien quốc tế Hình Chuỗi hai tế bo lồi Pseudonizschia sp.G3 d−íi kÝnh hiĨn vi quang häc D−íi kÝnh hiĨn vi quang häc, vá cã cÊu tróc ®èi xứng Hai mép vỏ thuôn hai đỉnh tế bào, từ khoảng 1/4 chiều dài tế bào; hai đỉnh tế bào tròn Chiều dài mặt vá: 80 ± 4,32, chiỊu réng ± 0,36 µm Trong chuỗi tế bào gối lên đoạn 1/4 chiều dài tế bào Dựa đặc điểm hình thái, mẫu Pseudonizschia sp.G3 loài P pungens [7] Nhân đoạn gien ITS1-5,8S-ITS2 từ ADN tổng số ADN tổng số đợc tách chiết từ sinh khối loài Pseudonitzschia sp.G3 đợc đảm bảo độ tinh nồng độ cần thiết để dùng cho thí nghiệm Kết đợc hình Đoạn gien ITS1-5,8S-ITS2 đợc nhân lên phản ứng PCR với cặp mồi đặc hiệu đợc ký hiệu Pseu F-Pseu R (cặp mồi đợc thiết kế dựa trình tự nucleotit loài thuộc chi Pseudonitzschia công bố Ngân hàng gien quốc tế) Theo tính toán lý thuyết, sản phẩm PCR cã kÝch th−íc kho¶ng 825 bp S¶n phÈm PCR thu đợc đặc hiệu với kích thớc nh tính toán lý thuyết (hình 3) 69 2 10 11 12 13 14 15 M 21 kb 825 bp H×nh ảnh điện di kiểm tra ADN loài Pseudonitzschia sp.G3 Cét 1: thang chn cđa ADN cã kÝch th−íc Kb Cét 2: ADN tỉng sè cđa loµi Pseudonitzschia sp.G3 Hình Kết PCR-checking dòng tế bào mang vectơ tái tổ hợp Cột 1-15: dòng tế bào có mang đoạn gien ITS15,8S-ITS2 Cột 16: thang chuÈn ADN cã kÝch th−íc kb 825 bp 825 bp Hình Kết điện di s¶n phÈm PCR Cét 1: thang chn cđa ADN cã kÝch th−íc Kb Cét 2, 3: s¶n phÈm PCR với cặp mồi Pseu F-Pseu R Hình Kết cắt kiểm tra ADN plasmit tái tổ hợp enzim EcoR I Tách dòng đoạn gien ITS1-5,8S-ITS2 Cột 1-2: vectơ pCR(R) gắn sản phẩm PCR đoạn gien ITS1-5,8S-ITS2 Cét 3: thang chuÈn ADN cã kÝch th−íc kb Sản phẩm PCR đặc hiệu đợc gắn vào vectơ tách dòng pCR2.1 biến nạp vào chủng vi khuẩn E coli DH5 T1 Những khuẩn lạc trắng mọc môi trờng nuôi cấy có bổ sung ampixilin X-gal đợc chọn làm ADN khuôn cho phản ứng PCR-checking với cặp mồi đặc hiệu Pseu F Pseu R (hình 4) Sau phản ứng PCR-checking, khuẩn lạc trắng đợc nghi ngờ có mang đoạn gien mong muốn, đợc nuôi cấy tách chiết ADN plasmit Các ADN plasmit đợc chọn cắt kiểm tra enzim cắt giới hạn EcoRI Kết sau cắt thu đợc băng: băng có kích thớc khoảng 3,9 kb (kích thớc vectơ gốc) băng có kích thớc khoảng 825 bp chứng tỏ đoạn gien mong muốn đợc gắn thành công vào vectơ tách dòng pCR2.1 (hình 5) Cuối cùng, dòng plasmit tái tổ hợp đợc tách chiết tinh lợng đủ lớn ®Ĩ dïng cho viƯc ®äc tr×nh tù nucleotit 70 So sánh trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài Pseudonitzschia Sau xác định đợc trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài Pseudonitzschia sp.G3, tiến hành so sánh trình tự thu đợc với trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 12 loài Pseudonitzschia đợc công bố Ngân hàng gien quốc tế với hỗ trợ phần mềm DNASTAR Clustal X nhằm định tên mẫu vật Trên hình 6, đa kết so sánh trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài Pseudonitzschia sp.G3 với trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài P pungens (kết so sánh với 11 loài Pseudonitzschia khác không đây) Tỷ lệ phần trăm tơng đồng cặp trình tự nucleotit loài Pseudonitzschia đợc thống kê dới dạng ma trận bảng Kết bảng cho thấy độ tơng đồng đoạn gien ITS1-5,8S-ITS2 loài thuộc chi Pseudonitzschia nằm khoảng 53,1-99,6% loài Pseudonitzschia sp.G3 có độ tơng đồng cao (98,8%) với loài P pungens (AY544769) vµ thÊp nhÊt víi loµi P calliantha (AY257857 ) (53,1%) P sp.G3 GGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCACTGGTCTA P.pungens GGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCACTGGTCTA ************************************************************ Måi Pseu F P.sp.G3 GTATTTTTACTAAACCGCTGCCGTCAAACTTAAACTTGCAACGCGATGATTAATTCCGCC P.pungens GTATTTTTACTAAACCGCTGCCGTCAAACTTAAACTTGCAACGCGATGATTAATTCCGCC ************************************************************ P.sp.G3 TTGCTGCCATTCTTCACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGA P.pungens TTGCCGCCATTCTTCACGATTGGTAACTGGAAAAAACCAAATGACCTAAAGCAAAAATGA **** **************************** ************************** P.sp.G3 TGCAGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACCGACTC P.pungens TGCGGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACCGACTC *** ******************************************************** P.sp.G3 TATTGCTGGCACTGCACATTACACCTAATACATTACAACTTTCAGCGGTGGATGTCTAGG P.pungens TATTGCTGGCACTGCACATTACACCTAATACATTACAACTTTCAGCGGTGGATGTCTAGG ************************************************************ P.sp.G3 TTCCC-ACAACGATGAAGAACGCAGCGAAATGCGATACGTAATGCGAATTGCAAGACCTC P.pungens TTCCCCACAATGA AAGAACGCAGCGAAATGCGATACGTAATGCGAATTGCAAGACCTC ***** **** ** ********************************************* P.sp.G3 GTGAATCATCAAGATTTTGAACGCACATTGCGCTTTCGGGTATTCCCGGTAGCATGCTTG P.pungens GTGAATCATCAAGATTTTGAACGCACATTGCGCTTTCGGGTATTCCCGGTAGCATGCTTG ************************************************************ P.sp.G3 TCTGAGTGTCTGTGGATCCCACTCAGCGCTGGCTTCGTGCTGGCTGCTGGTATTTTGGCC P.pungens TCTGAGT CTGTGGATCCCACTCAGCGCTGGCTTCGTGCTGGCTGCTGGTATTTTGGCC ******* *************************************************** P.sp.G3 GTGACTGAATTTGTTTAGTCTCGGCTTAAGTTTTACGTTAAGTACGTGCATAGATCTAGA P.pungens GTGACTGAATTTGTTTAGTCTCGGCTTAAGTTTTACGTTAAGTACGTGCATAGATCTAGA ************************************************************ P.sp.G3 AAGCTCTGCCCGTTTAGTTAAAAACACGGCGTTGACACTCTTGTCTATCTCTGGTAGGTT P.pungens AAGCTCTGCCCGTTTAGTTAAAAACACGGCGTTGTCACTCTTGTCTATCTCTGGTAGGTT ********************************** ************************* P.sp.G3 TATTCGACTGGAGTTTGCTACGAGTTGTCTATAGCTGTTTTGAAACTACTGGAATGAGCG P.pungens TATTCAACTGGAGTTTGCTACGAGTTGTCTATAGCTGTTTTGAAACTACTGGAATGAGCG ***** ****************************************************** P.sp.G3 CTTGTAGATCTAACTAGCTGGAAACAGTTAGTTATACAATTCCGGATCTCAGATCAAGCA P.pungens CTTGTAGATCTAACTAGCTGGAAACAGTTAGTTATACAATTCCGGATCTCAGATCAAGCA ************************************************************ P.sp.G3 AGAGGACCCGCCGAATTTAAGCATATAATTAAGCGGAGGAAAAGAAACTAACTAGGATTC P.pungens AGAGGACACGCCGAATTTAAGCATATAATTAAGCGGAGGAAAAGAAACTAACTAGGATTC ******* **************************************************** P.sp.G3 CCTCAGTAACGGCGAGTGAAGCGGGACTAGCTCAGGATGTGAATCTGCG P.pungens CCTCAGTAACGGCGAGTGAAGCGGGACTAGCTCAGGATGTGAATCTGCG ************************************************* Måi PseuR Hình Kết so sánh trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài Pseudonitzschia sp.G3 với trình tự nucleotit đoạn giem ITS1-5,8S-ITS2 loài P pungens có mã số AY544769 Ngân hàng gien quốc tÕ Nh− vËy, cã thĨ thÊy 11 sù sai kh¸c trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài Pseudonitzschia sp.G3 so víi loµi P pungens nh− sau: C125T (đột biến thay C T vị trí nucleotit thø 125), A154G, G184A, C306Del (®ét biÕn mÊt C vị trí 306); đột biến thêm nucleotit T, G, G, T vị trí 314, 315, 428, 429, tơng ứng; T575A; A606G A728C 71 Bảng Bảng thống kê tỷ lệ phần trăm tơng đồng (ma trận tam giác trên) khoảng cách di truyền (ma trận tam giác dới) đoạn gien ITS1-5,8S-ITS2 loài chi Pseudonitzschia Tỷ lệ phần trăm tơng đồng Khoảng cách di truyÒn 1 10 11 12 13 29,1 0,1 33,4 28,7 22,7 29,5 29,4 22,0 24,4 22,4 30,6 21,4 79,5 29,2 30,9 33,8 22,4 29,2 32,8 19,8 33,7 36,4 36,1 34,7 99,6 79,0 33,5 28,8 22,8 29,6 29,5 22,1 24,5 22,5 30,9 21,6 76,3 76,8 76,8 35,6 30,6 31,0 29,8 27,9 36,4 36,0 36,7 35,0 77,4 74,0 77,7 74,2 25,4 32,4 18,3 23,5 33,1 30,4 3,6 28,8 80,5 82,7 81,2 81,6 84,3 26,2 21,5 7,6 30,4 32,7 27,6 31,1 80,3 74,3 81,1 76,2 76,7 82,3 27,8 23,9 29,4 32,6 34,5 31,4 77,9 81,0 78,4 79,2 82,5 84,2 81,0 19,5 34,0 33,6 21,4 32,2 8 84,8 84,8 85,2 83,5 74,6 94,0 86,1 85,5 28,8 29,6 26,3 28,0 10 81,0 74,5 81,4 75,8 61,3 76,6 80,3 75,8 77,8 16,4 35,5 15,8 10 11 77,7 52,3 78,0 73,4 75,0 75,1 74,9 72,5 76,0 82,4 33,3 1,0 11 12 76,6 74,1 76,6 73,7 95,1 82,3 76,7 80,4 71,2 61,3 73,4 31,9 12 13 79,1 53,1 79,4 74,0 60,9 76,5 63,7 73,7 77,3 83,2 98,8 73,9 10 11 12 13 13 Ghi chú: loài đợc đánh số theo thứ tự: P australis; P calliantha; P cf australis; P cf subpacifica; P cuspidata; P delicatissima; P fraudulenta; P galaxiae; P micropora; 10 P multiseries; 11 P pungens; 12 Pseudonitzschia sp Hobart5; 13 Pseudonitzschia sp G3 P cf subpacifica P calliantha P delicatissima P micropora P galaxiae Pseudonitzschia sp.Hobart5 P cuspidata P fraudulenta P australis P cf australis P multiseries Pseudonizschia sp.G3 P pungens Hình Cây phát sinh chủng loại 13 loài Pseudonitzschia dựa việc so sánh trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 Dựa vào khoảng cách di truyền tỷ lệ % tơng đồng trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài Pseudonitzschia chơng trình DNASTAR, xây dựng phát sinh chủng loại 13 loài Pseudonitzschia Cây phát sinh chủng loại đợc hình cho thấy 13 loài chi Pseudonitzschia chia thành nhóm chính: nhãm cã mét loµi lµ P cf subpacifica; nhãm cã loµi gåm: P calliantha, P delicatissima 72 vµ P micropora; nhãm chia thµnh hai nhãm nhá, bao gồm loài: P galaxiae, Pseudonitzschia sp.Hobart5, P cuspidata, P flaudulenta, P australis, P cf australis, P multiseries, P pungens Pseudonitzschia sp G3; đó, loài Pseudonitzschia sp.G3 cã mèi quan hƯ di trun rÊt gÇn gòi víi loài P pungens Trình tự nucleotit đoạn gien ITS15,8S-ITS2 thu đợc loài Pseudonitzschia sp.G3 đợc đăng ký Ngân hàng gien quốc tế với số đăng ký đợc cấp DQ166533 III Kết luận Việc phân tích trình tự nucleotit đoạn gien ITS1-5,8S-ITS2 loài Pseudonitzschia sp.G3 cho thấy loài có quan hệ di truyền gần gũi với loài Pseudonitzschia pungens (AY544769) với độ tơng đồng đạt đến 98,8% Kết thu đợc với kết nghiên cứu đặc điểm hình thái cho phép kết luận loài Pseudonitzschia sp.G3 đợc thu Đồ Sơn, thành phố Hải Phòng loài P pungens Trình tự nucleotit đoạn gien ITS15,8S-ITS2 loài Pseudonitzschia sp.G3 đợc đăng ký Ngân hàng gien quốc tế với số đăng ký DQ166533 Tài liệu tham khảo Nguyễn Đức Bách cs., 2003: Tạp chí Sinh học, 25(3): 1-4 Hµ Néi Bates S S., 2000: J Phycol., 36: 978- 985 Cagelost G A et al., 1997: Applied and Environmental Microbiology, 63(12): 48594865 Fehling J et al., 2004: J Phycol., 40: 622630 Đặng Diễm Hồng cs., 2003: Những vấn đề nghiên cứu khoa học sống: 913-916 Hội nghị Khoa học toàn quốc lần thứ nghiên cứu Sinh học, Nông nghiệp, Y học Huế Đặng Diễm Hồng cs., 2002: Tạp chí Khoa học Công nghệ, 40(số đặc biệt): 161-167 J Lasen and N L Nguyen, 2004: Opera Botanica 140 Nina Lundholm N et al., 2003: Phycol., 39: 797-813 Sambrook J and Russell D W., 2001: A Laboratory manual Cold Spring Harbor Laboratory Press Construction of the phylogenetic tree of Pseudonitzschia sp.G3 isolated from HaiPhong city basing on the nucleotide sequence of the ITS1-5.8S-ITS2 gene fragment Hoang Thi Lan Anh, Dang Diem Hong, Chu Van Thuoc Summary Some species belonging to the marine diatom genus Pseudonitzschia were recognized to have capacity to produce domoic acid which caused amnesic shellfish poisoning (ASP) According to the traditional classification, researchers have relied on the morphological characters to identify the species of the genus Pseudonitzschia In addition, the morphological study of the species belonging to the genus Pseudonitzschia were supported by phylogenetic analyses of the nuclear- encoded internal transcribed spacer 1-5.8S and the internal transcibed rDNA (ITS1-5.8S-ITS2) In this study, the length of the ITS1-5.8S-ITS2 gene fragment of Pseudonitzschia sp.G3 was estimated about 825 bp After, this fragment was amplified from Pseudonitzschia sp.G3 by using genomic DNA; the PCR products have been cloned into the pCR2.1 vector and the recombinant plasmids were transformed into the E coli strain DH5α T1’ The result of the cloning was confirmed by PCR checking method and the restriction analysis by EcoRI enzyme By comparing the Pseudonitzschia sp.G3 nucleotide sequence with the published nucleotide sequences of the ITS1-5.8S-ITS2 gene fragments of Pseudonitzschia species in Gene Bank and constructing the phylogenetic tree, the phylogenetic relationships between Pseudonitzschia sp.G3 and 12 other Pseudonitzschia species were established Our results indicated that Pseudonitzschia sp.G3 collected in Haiphong city had close phylogenetic relationship with Pseudonitzschia pungens (with accession number AY544769) with homological coefficient of 98.8% The obtained results in this paper allowed us to conclude that may be the studied Pseudonitzschia sp.G3 species was Pseudonitzschia pungens Ngµy nhËn bµi: 30-8-2005 73 ... So sánh trình tự nucleotit đoạn gien ITS1-5, 8S-ITS2 loài Pseudonitzschia Sau xác định đợc trình tự nucleotit đoạn gien ITS1-5, 8S-ITS2 loài Pseudonitzschia sp .G3, tiến hành so sánh trình tự thu... nucleotit đoạn gien ITS1-5, 8S-ITS2 loài Pseudonitzschia chơng trình DNASTAR, xây dựng phát sinh chủng loại 13 loài Pseudonitzschia Cây phát sinh chủng loại đợc hình cho thấy 13 loài chi Pseudonitzschia. .. Pseudonizschia sp .G3 P pungens H×nh Cây phát sinh chủng loại 13 loài Pseudonitzschia dựa việc so sánh trình tự nucleotit đoạn gien ITS1-5, 8S-ITS2 Dựa vào khoảng cách di truyền tỷ lệ % tơng đồng trình tự nucleotit
- Xem thêm -

Xem thêm: Xây dựng cây phát sinh chủng loại của loài tảo Pseudonitzschia sp. G3 được phân lập ở thành phố Hải Phòng dựa trên trình tự Nucleotit của đoạn gien ITS1-5,8 S-ITS2, Xây dựng cây phát sinh chủng loại của loài tảo Pseudonitzschia sp. G3 được phân lập ở thành phố Hải Phòng dựa trên trình tự Nucleotit của đoạn gien ITS1-5,8 S-ITS2

Từ khóa liên quan