83 31 0
  • Loading ...
1/83 trang

Thông tin tài liệu

Ngày đăng: 27/07/2019, 03:22

ĐẠI HỌC THÁI NGUYÊN TRƢỜNG ĐẠI HỌC SƯ PHẠM VÕ VĂN NGỌC ĐÁNH GIÁ MỘT SỐ DÒNG LÚA CHỌN LỌC THẾ HỆ R3, R4 CĨ NGUỒN GỐC TỪ MƠ SẸO CHỊU MẤT NƯỚC LUẬN VĂN THẠC SĨ SINH HỌC THÁI NGUYÊN - 2009 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên ĐẠI HỌC THÁI NGUYÊN TRƢỜNG ĐẠI HỌC SƢ PHẠM - VÕ VĂN NGỌC ĐÁNH GIÁ MỘT SỐ DÒNG LÚA CHỌN LỌC THỂ HỆ R3, R4 CÓ NGUỒN GỐC TỪ MÔ SẸO CHỊU MẤT NƯỚC Chuyên ngành : Di truyền học Mã số: 60.42.70 LUẬN VĂN THẠC SĨ SINH HỌC Người hướng dẫn khoa học: TS Nguyễn Thị Tâm Thái Nguyên – 2009 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu riêng Các số liệu, kết nghiên cứu luận văn trung thực chƣa đƣợc công bố Tác giả Võ Văn Ngọc Số hóa Trung tâm Học liệu – Đại học Thái Nguyên LỜI CẢM ƠN Tơi xin bày tỏ lòng biết ơn sâu sắc tới TS Nguyễn Thị Tâm tận tình hƣớng dẫn, bảo tạo điều kiện giúp đỡ tơi hồn thành cơng trình nghiên cứu Tơi xin cảm ơn KTV Đào Thu Thủy (phòng thí nghiệm Cơng nghệ tế bào), CN Nguyễn Ích Chiến, Ths Phạm Thị Thanh Nhàn (phòng thí nghiệm Di truyền học Cơng nghệ gen, Khoa Sinh-KTNN, Trƣờng Đại học Sƣ phạm Thái Ngun) giúp đỡ tơi q trình hồn thành luận văn Tôi xin chân thành cảm ơn Lãnh đạo Trƣờng Đại học Sƣ phạm - Đại học Thái Nguyên, Ban chủ nhiệm thầy cô giáo, cán khoa Sinh - KTNN, Ban giám hiệu trƣờng THPT Thạch Thành - Tỉnh Thanh Hoá tạo điều kiện giúp đỡ tơi q trình học tập hồn thành luận văn Tôi xin cảm ơn động viên, khích lệ gia đình, bạn bè đồng nghiệp suốt thời gian làm luận văn Tác giả luận văn Võ Văn Ngọc Số hóa Trung tâm Học liệu – Đại học Thái Nguyên MỤC LỤC Trang MỞ ĐẦU Chƣơng TỔNG QUAN TÀI LIỆU 11 1.1 Giới thiệu lúa 11 1.1.1 Nguồn gốc phân loại 11 1.1.2 Đặc điểm nông sinh học lúa 11 1.1.3 Giá trị kinh tế………………………………………………………………… 12 1.1.4 Tình hình sản xuất lúa giới Việt Nam………………………… 13 1.2 Hạn chế chịu hạn 13 1.2.1 Khái niệm hạn…………………………………………………………… 13 1.2.2 Tác hại hạn lúa……………………………………………… 14 1.2.3 Cơ sở sinh lý, sinh hoá phân tử tính chịu hạn lúa……………… 14 1.3 Ứng dụng kỹ thuật nuôi cấy mô tế bào thực vật chọn dòng tế bào 19 1.3.1 Cơ sở khoa học chọn dòng tế bào thực vật……………………………… 19 1.3.2 Hệ thống nuôi cấy sử dụng chọn dòng tế bào soma…………………… 19 1.3.3 Các phƣơng pháp chọn dòng tế bào………………………………………… 20 1.3.4 Thành tựu ni cấy mơ tế bào chọn dòng chống chịu ngoại cảnh bất lợi…… 21 1.3.5 Đánh giá tiêu sinh lý, hóa sinh sinh học phân tử dòng đƣợc hình thành qua ni cấy mơ tế bào………………………………………………… 22 1.4 Một số nghiên cứu gen ức chế sinh tổng hợp giberellin lúa …… 23 Chƣơng VẬT LIỆU VÀ PHƢƠNG PHÁP 26 2.1 Vật liệu, thiết bị, hóa chất địa điểm nghiên cứu 26 2.2 Phƣơng pháp nghiên cứu 27 2.2.1 Phƣơng pháp trồng theo dõi đồng ruộng…………………… 28 2.2.2 Phƣơng pháp hóa sinh……………………………………………………… 28 2.2.3 Phƣơng pháp nuôi cấy in vitro ……………………………………… 30 2.2.4 Đánh giá nhanh khả chịu hạn giai đoạn mạ …………………… 32 2.2.4 Phƣơng pháp sinh học phân tử……………………………………………… 33 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 2.2.5 Phƣơng pháp xử lý kết tính tốn số liệu 37 Chƣơng KẾT QUẢ VÀ THẢO LUẬN………………………………………… 38 3.1 Đặc điểm nơng học dòng lúa chọn lọc hệ R3, R4 giống gốc có nguồn gốc từ mơ sẹo chịu nƣớc 39 3.2 Phân tích hóa sinh dòng chọn lọc 45 3.2.1 Hàm lƣợng protein, lipit đƣờng tan hạt dòng chọn lọc ……… 45 3.2.2 Đánh giá phổ điện di protein dự trữ hạt …………………………………… 46 3.2.3 Hàm lƣợng axit amin liên kết hạt……………………………………… 47 3.3 Đánh giá khả chịu hạn dòng chọn lọc hệ R4 51 3.4 Phân lập giải trình tự gen GA2ox1 ức chế sinh tổng hợp gibberellin 60 3.4.1 Kết tách chiết ADN tổng số dòng chọn lọc R4.05………………… 60 3.4.2 Nhân gen GA2ox1 kỹ thuật PCR……………………………………… 61 3.4.3 Biến nạp vector tái tổ hợp vào tế bào khả biến chọn dòng plasmit tái tổ hợp mang gen GA2ox1…………………………………………………………… 62 3.4.4 Tách chiết plasmit tái tổ hợp………………………………………………… 63 3.4.5 Kết đọc trình tự nucleotit đoạn gen GA2ox1…………………………… 66 3.4.6 So sánh trình tự nucleotit gen GA2ox1 dòng R4.05 với giống cơng bố………………………………………………………………………… 66 3.4.7 So sánh trình tự axit amin dòng R4.05 với giống cơng bố …… 68 KẾT LUẬN VÀ KIẾN NGHỊ …………………………………………………… 72 CƠNG TRÌNH ĐÃ CƠNG BỐ LIÊN QUAN ĐẾN LUẬN VĂN………………… 74 TÀI LIỆU THAM KHẢO………………………………………………………… 75 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên DANH MỤC CÁC BẢNG Trang Bảng 2.1 Hạt dòng chọn lọc hệ R2 giống gốc …………………… 26 Bảng 3.1 Đặc điểm nông học mức độ biến dị dòng lúa hệ R3 43 Bảng 3.2 Đặc điểm nơng học dòng R4.04, R4.05 giống KD……… 44 Bảng 3.3 Hàm lƣợng protein, lipit đƣờng tan hạt dòng chọn lọc giống gốc………………………………………………… 45 Bảng 3.4 Hàm lƣợng axit amin liên kết hạt số dòng chọn lọc hệ R4 giống gốc………………………………………… 48 Bảng 3.5 Hàm lƣợng axit amin liên kết protein hạt dòng chọn lọc hệ R4 giống gốc…………………… …………… 49 Bảng 3.6 Thăm dò khả tạo mơ sẹo tái sinh dòng chọn lọc giống gốc……………………………………………………… 52 Bảng 3.7 Tỷ lệ thiệt hại giai đoạn mạ điều kiện gây hạn nhân tạo 56 Bảng 3.8 Chỉ số chịu hạn dòng chọn lọc hệ R4 58 Bảng 3.9 Thống kê nucleotit sai khác dòng R4.05 với giống cơng bố Genbank…………………………………………… Bảng 3.10 So sánh mức độ tƣơng đồng gen GA2ox1 dòng R4.05 với giống công bố Genbank…………………………………… Bảng 3.11 So sánh sai khác axit amin số vị tri dòng R4.05 với giống cơng bố Genbank……………………… … Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 66 67 69 DANH MỤC CÁC HÌNH Trang Hình 2.1 Sơ đồ thí nghiệm tổng quát 27 Hình 3.1 Các dòng chọn lọc giống gốc hệ R3 (vụ mùa 2008)…………… 38 Hình 3.2 Các dòng R3.04, R3.05 Khang dân gốc (vụ mùa 2008)…………… 39 Hình 3.3 Hình ảnh điện di protein dự trữ hạt dòng chọn lọc giống gốc 47 Hình 3.4 Biểu đồ so sánh hàm lƣợng loại axit amin khơng thay hạt dòng chọn lọc, giống gốc FAO………… 50 Hình 3.5 Khả tạo mơ sẹo tái sinh dòng chọn lọc giống gốc…………………………………………………………………… 52 Hình 3.6 Tốc độ nƣớc mơ sẹo dòng chọn lọc giống gốc sau xử lý thổi khơ…………………………………………………………… Hình 3.7 Khả sống sót mơ sẹo sau xử lý thổi khơ………………… 53 54 Hình 3.8 Khả tái sinh từ mô sẹo sau xử lý thổi khơ……………… 55 Hình 3.9 Biểu đồ biểu diễn tỷ lệ thiệt hại hạn gây sau 3, 5, ngày hạn… 57 Hình 3.10 Đồ thị biểu diễn khả chịu hạn dòng chọn lọc hệ R4 59 Hình 3.11 Kết điện di kiểm tra ADN tổng số dòng R4.05……………… 61 Hình 3.12 Kết PCR nhân gen GA2ox1 với cặp mồi EX2-3-F EX2-3-R… 62 Hình 3.13 Sơ đồ vector pBT đƣợc cải biến từ vector pUC18…………………… 62 Hình 3.14 Kết biến nạp vector tái tổ hợp tế bào khả biến E.coli DH5α 63 Hình 3.15 Kết điện di sản phẩm colony-PCR……………………………… 64 Hình 3.16 Kết điện di plasmit tinh chứa đoạn gen GA2ox1………… 65 Hình 3.17 Điện di sản phẩm cắt plasmit tái tổ hợp enzym BamHI……… 65 Hình 3.18 Trình tự nucleotit đoạn gen GA2ox1 tách dòng đƣợc dòng R3.05 so với giống cơng bố Genbank………………………… 68 Hình 3.20 Trình tự nucleotit đoạn gen GA2ox1 trình tự axit amin tƣơng ứng dòng R4.05 so với giống công bố Genbank………… Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 70 NHỮNG CHỮ VIẾT TẮT 2,4D Axit 2,4 – Dichlorphenoxyacetic ABA Axit Abscisic ATPase Adenosin triphosphatase (Enzym phân giải ATP giải phóng lƣợng) ADN Axit Deoxyribose Nucleic AFLP Amplified Fragment Length Polymorphism bp base pair = cặp bazơ nitơ Sn Chỉ số chịu hạn tƣơng đối EDTA Axit Ethylene Diamin Tetraaxetic FAO Food Agriculture Orgnization (Tổ chức nông lƣơng giới) GA Axit Gibberellic HSP Heat shock protein (Protein sốc nhiệt) IPTG Isopropyl- β -D-thiogalactopyranoside IRRI International Rice Research Institute (Viện nghiên cứu lúa quốc tế) Kb Kilobase LEA Late Embryogenesis Abundant protein MS Murashige and Skoog (Môi trƣờng theo Murashige Skoog) NST Nhiễm sắc thể OsGA2ox1 Gen mã hoá cho enzym GA oxidase-1 đăng ký Genbank PCR Polymerase Chain Reaction (Phản ứng chuỗi polymerase) ARNase Ribonuclease SDS Sodium Dodecyl Sulphat SDS-PAGE Phƣơng pháp điện di gel polyacrylamid có chứa SDS TAE Tris - Acetate – EDTA SSR Simple Sequence Repeats (trình tự lặp lại đơn giản) TE Tris – EDTA TELT Tris – EDTA – LiCl – Triton X100 X-gal 5-brom-4-chloro-3-indolyl- β -D-galactosidase Tris Trioxymetylaminometan Số hóa Trung tâm Học liệu – Đại học Thái Nguyên MỞ ĐẦU Đặt vấn đề Cây lúa (Oryza sativa L.) lƣơng thực ngắn ngày thuộc họ hồ thảo có giá trị kinh tế, giá trị dinh dƣỡng cao giữ vai trò quan trọng cấu trồng nƣớc ta Thống kê năm 1998 cho thấy, nƣớc có 7362400 đất trồng lúa sản lƣợng thóc đạt 29,14 triệu tấn, bình qn suất đạt 35,58 tạ/ha [18] Tuy nhiên, lúa chịu ảnh hƣởng lớn chế độ nƣớc, điều kiện nhiệt độ nhiều yếu tố bất lợi khác môi trƣờng (mặn, phèn…) Trong yếu tố bất lợi, hạn hán đƣợc xem nhân tố làm giảm suất lúa Ở Việt Nam hàng năm diện tích lúa nƣớc bị khô hạn lên tới 0,4 triệu [17] Trong 130 triệu đất trồng lúa giới có tới 26 triệu đất bị hạn nặng gây ảnh hƣởng đến suất [3] Để nâng cao ổn định sản lƣợng lúa điều kiện khô hạn nhằm làm giảm thiểu thiệt hại hạn hán gây việc xác định chọn tạo giống lúa có khả chịu hạn trở thành vấn đề cấp thiết Để tạo đƣợc giống lúa có suất cao, phẩm chất tốt thích nghi với vùng sinh thái nơng nghiệp khác đa dạng nguồn gen, nhiều nghiên cứu đƣợc thực để cải thiện giống thông qua phƣơng pháp chọn dòng biến dị soma Chọn dòng tế bào thực vật hƣớng cho cải tạo giống trồng, khắc phục hạn chế phƣơng pháp truyền thống Kỹ thuật nuôi cấy in vitro tạo biến đổi kiểu gen kiểu hình, chọn lọc đƣợc dòng tế bào khác đặc điểm sinh lý, sinh hóa… theo định hƣớng ngƣời thực nghiệm Phƣơng pháp cho phép thu đƣợc dòng giống có khả chống chịu cao với điều kiện bất lợi môi trƣờng Sự đời phát triển kỹ thuật sinh học phân tử nhƣ PCR, RT-PCR, RFLP, SSR, kỹ thuật tách dòng đọc trình tự gen đƣợc ứng dụng phân tích genom thực vật Các kỹ thuật sinh học phân tử đại giúp nhà nghiên cứu chọn giống phân tích đánh giá gen thực vật cách Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 65 Hình 3.16 Kết điện di plasmit tinh chứa đoạn gen GA2ox1 Để khẳng định lại plasmit cần tìm có gắn đoạn gen sản phẩm PCR hay không, chọn ADN plasmit tinh mẫu thí nghiệm để tiến hành cắt enzym giới hạn BamHI 370C Vị trí enzym vector nằm hai đầu đoạn gắn Theo lý thuyết, phản ứng cắt enzym xảy thành cơng sẽ thu đƣợc phân đoạn ADN có kích thƣớc khoảng 2700bp vector pBT phần lại gen GA2ox1 khoảng 1240bp Kết phân tích enzym giới hạn cho thấy plasmit pBT tái tổ hợp mang đoạn ADN xen đƣợc vào, với kích thƣớc phân tử tƣơng đƣơng với sản phẩm PCR (hình 3.17) Hình 3.17 cho thấy, sau phản ứng cắt enzym giới hạn BamHI xảy điện di gel agarose 0,8%, mẫu nghiên cứu có băng, băng có kích thƣớc khoảng 2,7kb tƣơng ứng với kích thƣớc vector, băng dƣới có kích thƣớc khoảng 1,24kb tƣơng đƣơng với kích thƣớc đoạn gen GA2ox1 Nhƣ vậy, đoạn gen GA2ox1 đƣợc tách dòng đủ điều kiện để tiến hành đọc trình tự Hình 3.17 Kết điện di sản phẩm cắt plasmit tái tổ hợp enzym BamHI Thang ADN chuẩn; Dòng R4.05 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 66 3.4.5 Kết đọc trình tự nucleotit đoạn gen GA2ox1 Tiến hành xác định trình tự nucleotit gen GA2ox1 mẫu nghiên cứu dòng R4.05 máy xác định trình tự tự động theo chiều xuôi chiều ngƣợc Kết xác định trình tự đƣợc xử lý phần mềm DNAstar BioEdit Kết phân tích trình tự gen dòng R4.05, đoạn gen GA2ox1 tách dòng đƣợc có kích thƣớc so với dự tính (hình 3.18) So sánh trình tự với liệu có NCBI, cho thấy trình tự gen mã hố cho enzym GA2oxidase GA2ox1 Đoạn gen tách dòng đƣợc có chiều dài 1238 nucleotit, chứa exon2 exon3 với tổng số 706 nucleotit, mã hoá cho 234 axit amin, số nucleotit thuộc intron 532 Nhƣ vậy, nghiên cứu bƣớc đầu thành cơng việc tách dòng xác định trình tự gen GA2ox1 dòng R4.05 3.4.6 So sánh trình tự nucleotit gen GA2ox1 dòng R4.05 với giống công bố Dựa vào kết giải trình tự R4.05 chúng tơi so sánh với trình tự gen giống Tám xoan Hải Hậu TĐB06 đƣợc cơng bố Genbank Hai trình tự gen GA2ox1 đăng ký quyền ngân hàng gen giới với mã số EF164903 (của giống TĐB06) EF164904 (của giống Tám xoan) [7] Kết cho thấy có 11 vị trí sai khác giống lúa (bảng 3.19) Bảng Thống kê nucleotit sai khác dòng R4.05 với giống công bố Genbank STT 10 11 Vị trí 418 426 519 713 803 893 922 1032 1198 1215 1217 Tám xoan Hải Hậu T C A A G A C A T C C Số hóa Trung tâm Học liệu – Đại học Thái Nguyên TĐB06 C T A G A G C G A A G R405 C T T G A G T A A A T 67 Giữa giống so sánh trình tự nucleotit cho thấy có tƣơng đồng cao (99,3% - 99,7%), sai khác 11 vị trí Trong TĐB06 R4.05 có độ tƣơng đồng 99,7%, khác vị trí ( 519, 922, 1032 1217) Giữa Tám xoan Hải hậu R4.05 tƣơng đồng 99,3% khác 10 vị trí (418, 426, 519, 713, 803, 893, 922, 1198, 1215 1217) (bảng 3.9, 3.10, hình 3.18) Bảng 3.10 So sánh mức độ tƣơng đồng đoạn gen GA2ox1 dòng R4.05 với giống công bố Genbank Giống Tám xoan Hải Hậu Tám xoan Hải Hậu TĐB06 R4.05 100 99,2 99,3 100 99,7 TĐB06 R4.05 100 10 20 30 || | | | | Tam xoan 40 50 60 ||| | | | 70 80 | | | || 90 100 | | | CTCACTCTGTTGCAGTGCTATTGTGAATGAGTACATTGAAGCCATGAAGAAGCTCGCATGTGAGATCCTGGACCTGTTAGGAGAGGGGCTAGGTCTCAAG TDB06 R405 110 120 130 140 150 160 170 180 190 200 | | | | | | | | | | | | | | | | | | | | Tam xoan GACCCCAGATACTTCAGCAAGCTTACCACAAACGCTGACAGTGACTGCCTCCTGAGGATCAACCACTACCCTCCATCATGCAACATTCACAAACTTGACC TDB06 R405 210 220 230 240 250 260 270 280 290 300 | | | | | | | | | | | | | | | | | | | | Tam xoan ATGATGACCAATGCAATATCAAGAGCCTTGTTAGCACCAAGGCTAGCAATGGTGGGAATCTGATGGCAGGTGGGCGCATTGGGTTCGGCGAGCACTCTGA TDB06 R405 310 320 330 340 350 360 370 380 390 400 | | | | | | | | | | | | | | | | | | | | Tam xoan CCCGCAGATCCTTAGCTTGCTCCGAGCAAACGATGTGGAAGGGCTACAGGTGTTTGTGCCGGACCACGAGGGCAAGGAGATGTGGGTTCAGGTGCCATCG TDB06 R405 410 420 430 440 450 460 470 480 490 500 | | | | | | | | | | | | | | | | | | | Tam xoan GACCCATCGGCCATTTTTGTCAATGCTGGTGATGTCCTCCAGGTAGTCACAGTAAATGACTAGAGCAAAAAAAAACAGCATTACATATATCAGAATAAGG TDB06 C T R405 C T | 510 520 530 540 550 560 570 580 590 600 | | | | | | | | | | | | | | | | | | | Tam xoan TTTACTATTATCAAAAGAAATTATTTCATAGATTATAAAAGGACCGCAAAGAAATTATTTCATAGATTATAAAAGGACCGCATTGACTATCATATGATTT | Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 68 TDB06 R405 T 610 620 630 640 650 660 670 680 690 700 | | | | | | | | | | | | | | | | | | | | Tam xoan ACAAATTATGTGGCTTTCTTCCAGTTATTCATAAAAAATGTTTCTTTGCTCACTGCAAAACACACAGGAAAGTAATATATATTTAATCATTTGATTCATA TDB06 R405 710 720 730 740 750 760 770 780 790 800 | | | | | | | | | | | | | | | | | | | | Tam xoan AGGCTGCAGCACTACTGAACAATGTTTCTTTTGTCAAAAAAAATGCAACACTGATATGTTTGTTATTTTCAGACTCAAATTCATTGTATTGCTGCAATTC TDB06 G R405 G 810 820 830 840 850 860 870 880 890 900 | | | | | | | | | | | | | | | | | | | | Tam xoan TTGCCAGCTGACAAAAAAATCTCTTTCTATCCTGCAACTACCGCTGTTTTACTCAACTTAAAAAAACAAATCACTAAAACATGATGCTGTAAACCTGGAC TDB06 A G R405 A G 910 920 930 940 950 960 970 980 990 1000 | | | | | | | | | | | | | | | | | | | | Tam xoan ATAGTTTTGCATTCCTGACATTCTTCGGCTTATCCTTTCTTTGGCCTTTATTTCTTCAGGCTCTGACAAATGGGAGGCTGATAAGTATCCGGCACAGGGT TDB06 .C R405 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 | | | | | | | | | | | | | | | | | | | | Tam xoan AATTGCAACCGCCTGCAGGCCAAGGCTGTCCACAATATACTTCGCATCACCACCCCTGCATGCACGAATCTCGGCACTCCCAGAGACAATCACAGCCAGC TDB06 G R405 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 | | | | | | | | | | | | | | | | | | | | Tam xoan AGCCCACGCCGATACCGATCATTCACCTGGGCTGAGTACAAGACGACAATGTACTCACTCCGCCTGAGCCACAGCCGCCTAGAACTCTTCAAAATTGTCG TDB06 A R405 .A 1210 1220 1230 | | | | | | | Tam xoan ATGATGACAGCGACCACGCCAGTGAGGGAAAAGCATAG TDB06 A.G R405 A.T Hình 3.18 Trình tự nucleotit đoạn gen GA2ox1 tách dòng đƣợc dòng R4.05 so với giống cơng bố Genbank Tam xoan: Trình tự giống tám xoan Hải Hậu Genbank TDB06: Trình tự giống TĐB06 Genbank R4.05: Trình tự dòng R4.05 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 69 3.4.7 So sánh trình tự axit amin dòng R4.05 với giống cơng bố Sử dụng trình tự đoạn gen GA2ox1 tách dòng đƣợc sau loại bỏ phần intron, ghép phần exon thu đƣợc đoạn gen cấu trúc gen GA2ox1 có tổng số 706 nucleotit Sử dụng phần mềm BioEdit dịch mã giả thuyết đoạn gen sang protein, kết thu đƣợc 234 axit amin (hình 3.19) Khi so sánh, tổng hợp vị trí axit amin sai khác trình tự axit amin dòng R4.05 so với giống Tám xoan TĐB06, kết đƣợc trình bày bảng 3.11 Kết so sánh trình tự axit amin giống Tám xoan Hải Hậu dòng R4.05 cho thấy, có vị trí sai khác (137, 222, 228) Khi so sánh giống TĐB06 với R4.05 có vị trí sai khác (167 128) Nhƣ vậy, so sánh với giống Tám xoan Hải Hậu ta thấy, trình tự nucleotit gen GA2ox1 dòng R4.05 có sai khác nhiều so với giống TĐB06 (10 vị trí – vị trí) Tƣơng tự nhƣ vậy, trình tự axit amin dòng R4.05 có vị trí sai khác so với giống Tám xoan Hải Hậu, so với giống TĐB06 có vị trí sai khác Có thể sai khác trình tự nucleotit dẫn đến thay đổi số axit amin làm cho enzym GA2-oxidase-1 hoạt động bất hoạt gây nên kìm hãm trình sinh tổng hợp giberelin Đây nguyên nhân tạo giống lúa thấp Giống lúa TĐB06 có chiều cao 90cm - 110cm, Tám xoan Hải Hậu có chiều cao 150cm [7], Dòng R4.05 có chiều cao 93cm - 95cm Bảng 3.11 So sánh sai khác axit amin số vị tri dòng R3.05 với giống công bố Genbank STT Giống Vị trí Tám xoan TĐB06 R4.05 137 A V V 167 T A T 222 V D D 228 H K N Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 70 Tam xoan TDB06 R405 10 20 30 40 50 60 70 80 | | | | | | | | | | | | | | | | GCTATTGTGAATGAGTACATTGAAGCCATGAAGAAGCTCGCATGTGAGATCCTGGACCTGTTAGGAGAGGGGCTAGGTCTCAAG A I V N E Y I E A M K K L A C E I L D L L G E G L G L K A I V N E Y I E A M K K L A C E I L D L L G E G L G L K A I V N E Y I E A M K K L A C E I L D L L G E G L G L K 90 100 110 120 130 140 150 160 170 180 | | | | | | | | | | | | | | | | | | | | Tam xoan GACCCCAGATACTTCAGCAAGCTTACCACAAACGCTGACAGTGACTGCCTCCTGAGGATCAACCACTACCCTCCATCATGCAACATTCACAAACTTGACC D P R Y F S K L T T N A D S D C L L R I N H Y P P S C N I H K L D TDB06 D P R Y F S K L T T N A D S D C L L R I N H Y P P S C N I H K L D R405 D P R Y F S K L T T N A D S D C L L R I N H Y P P S C N I H K L D 190 200 210 220 230 240 250 260 270 280 | | | | | | | | | | | | | | | | | | | | Tam xoan ATGATGACCAATGCAATATCAAGAGCCTTGTTAGCACCAAGGCTAGCAATGGTGGGAATCTGATGGCAGGTGGGCGCATTGGGTTCGGCGAGCACTCTGA H D D Q C N I K S L V S T K A S N G G N L M A G G R I G F G E H S D TDB06 H D D Q C N I K S L V S T K A S N G G N L M A G G R I G F G E H S D R405 H D D Q C N I K S L V S T K A S N G G N L M A G G R I G F G E H S D 290 300 310 320 330 340 350 360 370 380 | | | | | | | | | | | | | | | | | | | | Tam xoan CCCGCAGATCCTTAGCTTGCTCCGAGCAAACGATGTGGAAGGGCTACAGGTGTTTGTGCCGGACCACGAGGGCAAGGAGATGTGGGTTCAGGTGCCATCG P Q I L S L L R A N D V E G L Q V F V P D H E G K E M W V Q V P S TDB06 P Q I L S L L R A N D V E G L Q V F V P D H E G K E M W V Q V P S R405 P Q I L S L L R A N D V E G L Q V F V P D H E G K E M W V Q V P S 390 400 410 420 430 440 450 460 470 480 | | | | | | | | | | | | | | | | | | | | Tam xoan GACCCATCGGCCATTTTTGTCAATGCTGGTGATGTCCTCCAGGCT CTGACAAATGGGAGGCTGATAAGTATCCGGCACAGGGTAATTGCAACCGCCTGCA D P S A I F V N A G D V L Q A L T N G R L I S I R H R V I A T A C TDB06 C T D P S A I F V N V G D V L Q A L T N G R L I S I R H R V I A T A C R405 .C T D P S A I F V N V G D V L Q A L T N G R L I S I R H R V I A T A C 490 500 510 520 530 540 550 560 570 580 | | | | | | | | | | | | | | | | | | | | Tam xoan GGCCAAGGCTGTCCACAATATACTTCGCATCACCACCCCTGCATGCACGAATCTCGGCACTCCCAGAGACAATCACAGCCAGCAGCCCACGCCGATACCGA R P R L S T I Y F A S P P L H A R I S A L P E T I T A S S P R R Y R TDB06 G R P R L S A I Y F A S P P L H A R I S A L P E T I T A S S P R R Y R R405 R P R L S T I Y F A S P P L H A R I S A L P E T I T A S S P R R Y R | 590 600 610 620 630 640 650 660 670 680 | | | | | | | | | | | | | | | | | | | | Tam xoan TCATTCACCTGGGCTGAGTACAAGACGACAATGTACTCACTCCGCCTGAGCCACAGCCGCCTAGAACTCTTCAAAATTGTCGATGATGACAGCGACCACGCC S F T W A E Y K T T M Y S L R L S H S R L E L F K I V D D D S D H A TDB06 A .A.G S F T W A E Y K T T M Y S L R L S H S R L E L F K I D D D D S D K A R405 A A.T S F T W A E Y K T T M Y S L R L S H S R L E L F K I D D D D S D N A 690 700 | | | | Tam xoan AGTGAGGGAAAAGCATAG S E G K A * TDB06 S E G K A * R405 S E G K A * Hình 3.19 Trình tự nucleotit đoạn gen GA2ox1 trình tự axit amin tƣơng ứng dòng R4.05 so với giống cơng bố Genbank Tam xoan: Trình tự giống tám xoan Hải Hậu Genbank TDB06: Trình tự giống TĐB06 Genbank R405: Trình tự dòng R4.05 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 71 * Nhận xét kết tách dòng gen GA2ox1 dòng R4.05 - Đã tách dòng đọc trình tự gen GA2ox1 dòng R4.05 dài 1238 nucleotit So sánh với trình tự gen giống Tám xoan Hải Hậu Genbank cho thấy, đoạn gen có 10 vị trí sai khác (418, 426, 519, 713, 803, 893, 922, 1198, 1215 1217), mức độ tƣơng đồng 99,3% So sánh với giống TĐB06 Genbank có vị trí sai khác (519, 922, 1032 1217), mức độ tƣơng đồng 99,7% - Đoạn mã hố gen GA2ox1 có tổng số 706 nucleotit, tƣơng ứng với 234 axit amin So sánh trình tự axit amin giống Tám xoan Hải Hậu dòng R4.05 cho thấy, giống có vị trí sai khác (137, 222, 228), so sánh giống TĐB06 với dòng R4.05 có vị trí sai khác (167 128) Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 72 KẾT LUẬN VÀ ĐỀ NGHỊ KẾT LUẬN Đánh giá đặc điểm nông học dòng chọn lọc giống gốc hệ R3 R4, dòng chọn lọc có nhiều đặc điểm bật so với giống gốc (chiều cao cao, chiều dài bơng, số nhánh hữu hiệu/khóm, khối lƣợng 1000 hạt ) Mức độ biến động nhiều tính trạng nơng học có ổn định hệ R3, R4 cho phép rút ngắn thời gian chọn lọc Hàm lƣợng protein, đƣờng tan lipit hầu hết dòng chọn lọc có xu hƣớng tăng cao so với giống gốc Các dòng chọn lọc giống gốc khơng có sai khác thành phần protein dự trữ, nhƣng hàm lƣợng số loại protein có thay đổi so với giống gốc Hàm lƣợng axit amin tổng số hạt dòng chọn lọc cao so với giống gốc từ 1,93% đến 11,18% Đánh giá khả chịu hạn dòng chọn lọc mức độ mơ sẹo cho thấy phần lớn dòng chọn lọc có gia tăng khả chịu hạn Đặc biệt dòng R4.04, R4.05 có nguồn gốc từ giống KD Các dòng chọn lọc giống gốc có phản ứng khác hạn, tỷ lệ thiệt hại dòng chọn lọc giống gốc tăng dần theo thời gian xử lý hạn Dòng R4.04 R4.05 có số chịu hạn tƣơng đối cao 10285,02 9697,605 Đã tách dòng xác định đƣợc trình tự đoạn gen GA2ox1 có kích thƣớc 1238 nucleotit dòng chọn lọc R4.05 Đoạn gen cấu trúc có kích thƣớc 706 nucleotit mã hố cho 234 axit amin Xác định đƣợc 11 vị trí sai khác đoạn gen GA2ox1 dòng R4.05 so với giống Tám xoan Hải Hậu giống TĐB06 đƣợc công bố Genbank Trong số 234 axit amin đƣợc mã hoá từ gen GA2ox1 xác định vị trí sai khác so với Tám xoan Hải Hậu giống TĐB06 Từ dòng chọn lọc qua hệ chọn đƣợc dòng bật R4.04 R4.05 với đặc điểm suất cao, hàm lƣợng protein, đƣờng tan, axit amin liên kết hạt cao, khả chịu hạn cao so với giống gốc Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 73 ĐỀ NGHỊ Tiếp tục theo dõi dòng chọn lọc R4.04 R4.05 hệ để đƣa vào khảo nghiệm Tiếp tục nghiên cứu gen GA2ox1 nhằm tìm hiểu vai trò GA2ox1 khả ứng dụng công tác tạo giống trồng Số hóa Trung tâm Học liệu – Đại học Thái Ngun 74 NHỮNG CƠNG TRÌNH ĐÃ CÔNG BỐ LIÊN QUAN ĐẾN LUẬN VĂN Nguyễn Thị Tâm, Võ Văn Ngọc (2009), “Một số đặc điểm hoá sinh dòng lúa chọn lọc hệ R4 có nguồn gốc từ mơ sẹo chịu nƣớc”, Gửi báo cáo Hội nghị Công nghệ Sinh học, tổ chức Thái Nguyên 11/2009 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 75 TÀI LIỆU THAM KHẢO Tiếng Việt Lê Trần Bình, Võ Thị Ngọc Điệp, Lê Thị Muội (1995), “Nghiên cứu khả chịu lạnh chịu khô mô sẹo lúa giống có nguồn gốc sinh thái khác nhau”, Tạp chí Sinh học, 17(1): tr.25 – 29 Lê Trần Bình, Hồ Hữu Nhị, Lê Thị Muội (1997), Ứng dụng công nghệ tế bào thực vật cải tiến giống trồng, Nxb Nơng nghiệp, Hà Nội Lê Trần Bình, Lê Thị Muội (1998), Phân lập gen chọn dòng chống chịu ngoại cảnh bất lợi lúa, Nxb Đại học Quốc Gia, Hà Nội Phạm Thị Trân Châu, Nguyễn Thị Hiền, Phùng Gia Tƣờng (1998), Thực hành hoá sinh học, NXB Giáo dục, tr.54-55 Phan Văn Chi, Nguyễn Bích Nhi, Nguyễn Thị Tỵ (1998), “Xác định thành phần axit amin phƣơng pháp dẫn xuất hoá với O–phthaldialdyhyd 9luorenylmethyl chlorofomat hệ máy HP amino quant series II”, Kỷ yếu Viện Công nghệ Sinh học NXB Khoa học Kỹ thuật, Hà Nội, tr.454-461 Nguyễn Hữu Cƣờng, Nguyễn Thị Kim Anh, Đinh Thị Phòng, Lê Thị Muội, Lê Trần Bình (2003), “Mối tƣơng quan hàm lƣợng prolin tính chống chịu lúa”, Tạp chí Công nghệ Sinh học,1(1), tr.85-93 Lê Xuân Đắc (2007), Nghiên cứu biện pháp công nghệ sinh học thực vật nhằm cải biến tính trạng chiều cao lúa, Luận án Tiến sĩ Sinh học, Hà Nội Trần Kim Đổng, Nguyễn Quang Phổ, Lê Thị Hoa (1991) Giáo trình sinh lý trồng, Nxb Đại học giáo dục chun nghiệp, Hà Nội Phan Trọng Hồng, Nơng Văn Hải, Lê Trần Bình, Chu Hồng Hà (2005), “Sử dung enzym XcmI để thiết kế vector pBT phục vụ tách dòng đọc trình tự gen”, Tạp chí Cơng nghệ Sinh học 3(4): tr.459-463 10 INGER, IRRI (1996), Hệ thống tiêu chuẩn đánh giá nguồn gen lúa, Xuất lần thứ Tài liệu dịch Viện Khoa học Kỹ thuật Nông nghiệp Việt Nam 11 Nguyễn Thị Lẫm (1999), Giáo trình lúa, NXB Nơng nghiệp, Hà Nội Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 76 12 Trần Thị Phƣơng Liên (1999), Nghiên cứu đặc tính hoá sinh sinh học phân tử của mợt số giống đậu tương có khả chịu nóng, chịu hạn Việt Nam, Luận án Tiến sĩ Sinh học, Hà Nội 13 Nguyễn Hoàng Lộc, H T T Ngọc, Lê Trần Bình, Lê Thị Muội (1992), ″Nghiên cứu khả chịu nƣớc mô sẹo thuốc nuôi cấy in vitro”, Tạp chí Sinh học, 14, tr.31 –37 14 Nguyễn Hoàng Lộc (1993), Chọn dòng chịu muối NaCl chịu mất nước thuốc (Nicotiana tabacum L) Luận án Phó tiến sĩ Sinh học, Viện cơng nghệ sinh học, Hà Nội 15 Nguyễn Hồng Lộc (2005), “Phân tích thành phần điện di protein hạt trình tự gen chịu hạn dòng lúa chọn lọc in vitro” Báo cáo khoa học Hội nghị tồn quốc, tr.11358-1361 16 Đinh Văn Lữ (1978), Giáo trình lúa, NXB Nông nghiệp, Hà Nội 17 Đinh Thị Phòng, Lê Trần Bình, Lê Thị Muội (1995), Sử dụng công nghệ tế bào thực vật để chọn dòng chịu mất nước lúa, Kỷ yếu Viện Công nghệ Sinh học, Nxb KH KT, Hà Nội 18 Đinh Thị Phòng (2001), Nghiên cứu khả chịu hạn chọn dòng chịu hạn lúa công nghệ tế bào thực vật, Luận án Tiến sĩ Sinh học, Viện công nghệ sinh học, Hà Nội 19 Rubin BA (1978), Cơ sở sinh lý học thực vật, Nxb khoa học kỹ thuật,tr.165-187 20 Nguyễn Thị Tâm (2004), Nghiên cứu khả chịu nóng chọn dòng chịu nóng lúa công nghệ tế bào thực vật, Luận án Tiến sĩ Sinh học, Viện Công nghệ Sinh học, Hà Nội 21 Nguyễn Đức Thành (2000), Nuôi cấy mô tế bào thực vật – nghiên cứu ứng dụng, Nxb Nông nghiệp, Hà Nội 22 Mai Thọ Trung , Lê Song Dƣƣ̣ , Ngô ThịĐào (1990), Trồng trọt chuy ên khoa, Nxb Giáo dục, Hà Nội 23 Nguyễn Hải Tuất, Ngô Kim Khôi (1996), Xử lý kết nghiên cứu thực nghiệm nông lâm nghư nghiệp máy vi tính, Nxb Nơng nghiệp, Hà nội Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 77 24 Đỗ Năng Vịnh (2005), Công nghệ tế bào thực vật ứng dụng, Nxb Nông nghiệp, Hà Nội 25 Nguyễn Tƣờng Vân, Lê Trần Bình, Lê Thị Muội (1994), “Chọn dòng chịu muối lúa công nghệ nuôi cấy tế bào thực vật”, Kỷ yếu Viện CNSH, NXB KH & KT, Hà Nội, tr.19-27 26 Nguyễn Thị Vinh, Lê Duy Thành, Lê Trần Bình, Lê Thị Mi (1995), “Gây tạo dòng lúa chống chịu phèn kỹ thuật chọn lọc biến dị dòng soma”, Tạp chí Di truyền ứng dụng, 4: tr.21 – 27 Tiếng Anh 27 Bates L.S (1973), ″Rapid determination of free protein for water-stress studies”, Plant and Soil, 39, pp.205-207 28 Bohnert H.J, Jensen R.G (1996), “Strategies for enginnering water stress tolerance in plants”, Tibtech, 14, pp 89 – 97 29 Boston R S, Viitanen P V and Vierling E., 1996 Molecular chaperones and protein foling in plant Plant Mol Biol., 32, pp 191-222 30 Chodari K V., Ramakrishna W., Tamhankar S.A., Hendre R.R., Gupta V.S., (1998), Identification of minor variation in rice somaclonal variants, Plant Cell Rep, 18, pp 55-58 31 Collin H.A., Dix P.J (1990), “Culture systems and selection procedure”, in: Plant cell line selection, VCH Verlagsgesellschaft 32 FAO (1976), Hand book on human requirements in foodstuff, Geneve 33 Foolad M.R., Siva A., and Rodriguez L R (1995), Application of polymerase chain reaction (PCR) to plant genome analysis, In: Tissue and organ culture, Fundamental method, Springer Verlag, Berlin, Heidelberg, pp 281- 298 34 Gamborg O.L, Phillip G.C (Eds) (1995), Basal media for plant cell and tissue culture Pages 301-306 in: Plant Cell, Tissue and Organ Culture Fundamental methods, Springer Heidelberg 35 Hanson A D., Hizt W D (1982), Metabolic responses of mesophytes to plant water deficits, Ann Rev Plant Physoil, 33, pp 163-203 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 78 36 Henry R.J (1997), Molecular and biochemical characterization of somaclonal variation, In: Somaclonal Variation and Induced for Crop Improvement, Jain S.M., Brar D.S., Ahloowalia B.S.(eds), Kluwer Acard Publ, Netherlands, pp 134-139 37 http://en.wikipedia.org/w/index.php?title=Gibberellin_acid&old=150030333 38 Ingram K.I,Bueno F.D, Namuco O.S, Yambao E.B, Beyrouty C.A (1994), Rice root straists for drought resistance and their genetic 39 Itoh H., Tasumi T., Sakamoto T., Otomo K., Toyomasu T., Kitano H., Ashikari M., Ichihara S., Matsuoka M (2004), “A rice semi-dwarf gene, Tan-ginbozu (D35), encodes the gibberellin biosynthesis enzym, zent-kaurene oxidase”, Plant Mol Biol, 54: pp.533-547 40 Jain S.M (1997), Somaclonal variation and mutagenesis for crop improvement, Matalouden Tutkimuskuksen Julkaisuja, MTTK, Jokioinen, Finland, 18, pp 122-133 41 Khush G S (1997), “Origin, dispersal, cultivation and variation of rice”, Plant Mol Biol, 35, pp.25-34 42 Konzak C.K., (2001), Breeding in Crop Plant – Mutations and In Vitro Mutatio Breeding, Crop Science, 41: pp.253-256 43 Laemmli J K (1970), Natura, 27: pp.680 – 688 44 Mc Kersie B.D and Leshem Y.Y., 1994 Heat stress In: Stress and stress coping in cultivated plants Kluwer Acad Pub 45 Meier C., Bouquin T., Nielsen M.E (2001), “Gibberellin response mutants indentified by luciferase imaging”, Plant Journal, 25(5): pp.509-519 46 Murashige T., and Skoog F C (1962), “A revised medium for rapid growth and bioassays with tobacco tissue culture” Physiologia plantarum 15: pp.473-497 47 Nguyen H T., Babu C R., Blum A (1997), Breredinh for drought in rice: Physiology and Molecular Genetic Consideration, Crop Sci, 37,pp.1426-1434 48 Rahman M., Malik T.A., Iqbal M.J., Zafar Y., Alam K., Perveen Z., Rehman S., (1998), Salt impact on somaclonal variation in rice, Rice Bio Quar, 35,pp.13-14 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên 79 49 Sakamoto T., Kobayashi M., Itoh H., Tagiri A., kayano T., Tanaka H., Iwahori S., and Matsuoka M (2001), “Expression of a gibberellin 2-oxidase gene around the shoot apex is related to phase transition in rice”, Plant physiol 125 (3): pp.1508-1516 50 Sakamoto T., Morinaka Y., Ishyama K., Kobayashy M., Itoh H., Kayano T., Iwahori S., Matsuoka M., Tanaka H (2003), “Genetic manipulation of gibberellin metabolism in transgenic rice”, Nature Biotechnology, 2:pp.909-913 51 Sakamoto T., Miura K., Itoh H., Tatsumi T., Ueguchi-Tanaka M., Ishyama K., Kobayashy M., Agrawal G.K., Takeda S., Abe K., Miyao A., Hirochika H., Kitano H., Ashikari M., Matsuoka M (2004), “An overview of gibberellin metabolism enzym genes and their related mutants in rice”, Plant Physiol, 134: pp.1642-1645 52 Sambrook J., Russell D.W., (2001), “Molecular Cloning: A Laboratory Manual” Cold spring Harbor, New York: Cold spring Harbor Laboratory Press 53 Spilmeyer W., Ellis M.H., Chandler P.M (2002), “Semidwarf (sd-1), “green revolution” rice, contains a defective gibberellin 20-oxidase gene”, Proc Natl Acad Sci USA, 99: pp.9043-9048 54 Yamaguchi S., Sun T.P., Kawaide H., and Kamiya Y (1998), “The GA2 locus of Arabidopsi thaliana encodes ent-kaurene synthase of gibberellin biosynthesis”, Plant physiol, 116: pp.271-278 Số hóa Trung tâm Học liệu – Đại học Thái Nguyên
- Xem thêm -


Gợi ý tài liệu liên quan cho bạn