Đang tải... (xem toàn văn)
Abstract The acetate uptake by polyphosphate accumulating organisms (PAOs) and glycogen accumulating organisms (GAOs) were compared under different pH conditions. These two microorganisms are known to play key roles in the enhanced biological phosphorus removal (EBPR) processes. In this study, micro-autoradiography (MAR) with acetate as the radio-labeled substrate and fluorescence in situ hybridization (FISH) with PAOmix probe and GB probe were applied. Activated sludge samples taken at a wastewater treatment plant were subjected to anaerobic batch incubation with radio-labeled acetate at different initial pH conditions. The relative amount of carbon uptake by each cell was estimated based on the silver granule area around the cell. The results showed that anaerobic acetate uptake by PAOmix-positive and GB-positive cells were affected by the initial pH. Both PAOs and GAOs were found to have a weak tendency to take up less acetate under higher initial pH conditions. Key words polyphosphate accumulating organisms, glycogen-accumulating organisms, enhanced biological phosphorus removal, micro-autoradiography
Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 215 - Impact of pH on Anaerobic Substrate Uptake by PAOs and GAOs in an EBPR Activated Sludge Process Analyzed by MAR-FISH Kazuya Fujiwara, Motoharu Onuki, Hiroyasu Satoh*, Takashi Mino Institute of Environmental Studies, Graduate School of Frontier Sciences, The University of Tokyo Abstract The acetate uptake by polyphosphate accumulating organisms (PAOs) and glycogen accumulating organisms (GAOs) were compared under different pH conditions. These two microorganisms are known to play key roles in the enhanced biological phosphorus removal (EBPR) processes. In this study, micro-autoradiography (MAR) with acetate as the radio-labeled substrate and fluorescence in situ hybridization (FISH) with PAOmix probe and GB probe were applied. Activated sludge samples taken at a wastewater treatment plant were subjected to anaerobic batch incubation with radio-labeled acetate at different initial pH conditions. The relative amount of carbon uptake by each cell was estimated based on the silver granule area around the cell. The results showed that anaerobic acetate uptake by PAOmix-positive and GB-positive cells were affected by the initial pH. Both PAOs and GAOs were found to have a weak tendency to take up less acetate under higher initial pH conditions. Key words polyphosphate accumulating organisms, glycogen-accumulating organisms, enhanced biological phosphorus removal, micro-autoradiography. INTRODUCTION Enhanced biological phosphorus removal (EBPR) activated sludge processes are widely used for the removal of phosphorus from wastewater. Polyphosphate accumulating organisms (PAOs) are responsible for the enhanced removal of phosphorus since they accumulate phosphorus as intracellular polyphosphate under aerobic condition. They are thought to have an advantage over other heterotrophic microorganisms in the EBPR processes because PAOs can utilize polyphosphate as the energy source to take up organic matters while other heterotrophs cannot take up organic matters, as they cannot effectively obtain energy under anaerobic conditions. Yet, special types of heterotrophic bacteria that do not accumulate polyphosphate are also able to effectively obtain energy under anaerobic conditions, and compete with PAOs to take up organic matters anaerobically. They are often referred to as GAOs (glycogen accumulating organisms), as they utilize glycogen as the anaerobic energy source (Mino et al., 1998, Seviour et al., 2003). Address correspondence to Hiroyasu Satoh, Institute of Environmental Studies, Graduate School of Frontier Sciences, The University of Tokyo, Email: hiroyasu@ k.u-tokyo.ac.jp Received April 23, 2008, Accepted July 16, 2009. Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 216 - Since the predomination of GAOs instead of PAOs leads to the deterioration of EBPR, it is essential to understand the mechanisms of the competition between PAOs and GAOs. In the past few years, different researchers have pointed out the possible effect of pH on their competition (Bond et al., 1998; Jeon et al., 2001; Serafim et al., 2002, Schuler and Jenkins, 2002, Zeng et al., 2003, Oehmen et al., 2005; Zhang et al., 2005) In the present study, using pure cultures, quantitativeness of the MAR-FISH method to estimate the carbon uptake was evaluated. Furthermore, MAR-FIRH was applied to clarify the impact of pH on carbon uptake by PAOs and GAOs. MATERIALS AND METHODS Labeled acetate Tritium labeled sodium acetate, 150μCi ･ mL -1 , was obtained from Amersham Biosciences, Inc. The labeled sodium acetate was used for the experiments with analytical grade natural sodium acetate trihydrate obtained from Kishida Chemicals Inc., Japan. Pure cultures Escherichia coli K-12 and Ralstonia eutropha H-16 were incubated with LB medium for 14-16 hrs and 22-24 hrs, respectively, and washed with sterilized 10mM phosphate buffer. Prior to the incubation with radio-labeled acetate, the pure cultures were washed with 1mM potassium phosphate solution and resuspended in medium containing: calcium chloride dihydrate, 9mg･L -1 , magnesium chloride hexahydrate, 90 mg･L-1, potassium chloride, 40 mg･L -1 , ammonium chloride, 17 mg･L -1 , ammonium sulfate, 22 mg･L -1 , dipotassium hydrogen phosphate, 18 mg･L -1 , and potassium dihydrogen phosphate, 14 mg･L -1 . Each of the pure cultures (1.1×10 9 cell/mL) was aerobically incubated with 5 mgC･L -1 acetate (5 μCi･mL -1 ) and 20mgC･L -1 acetate (20 μCi･mL -1 ) for 2 hours. As control, E. coli and R. eutropha were pasteurized by heating at 70 o C for 10min, added with acetate, and incubated in the same way. They were then subjected to the MAR-FISH analysis. Batch experiment with activated sludge Activated sludge samples were obtained from a full-scale wastewater treatment plant in October 2006 (first experiment), December 2006 (second experiment) and February 2007 (third experiment). Each of these samples was immediately transferred to the laboratory after sampling. The activated sludge samples were washed three times with mineral medium containing calcium chloride dihydrate, 9 mg･L -1 , magnesium chloride hexahydrate, 90 mg･L -1 , potassium chloride, 40 mg･L -1 , ammonium chloride, 17 mg･L -1 , ammonium sulfate, 22 mg ･ L -1 , dipotassium hydrogen phosphate, 18 mg ･ L -1 , and potassium dihydrogen Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 217 - phosphate, 14 mg･L -1 . Then, biomass concentration (as MLSS) was adjusted to around 1,000 mg･L -1 , transferred to sealed vessels, and the headspace was purged with nitrogen gas. The initial pH was adjusted to 6, 7, 8 or 9. “Hot” experiments were conducted in 9mL vessels with 2mL activated sludge mixed liquor treated above. Tritium labeled sodium acetate together with natural sodium acetate was added at a final concentration of 20mg mgC･L -1 with radioactivity 20 μCi･mL -1 . For each pH, incubation was conducted in triplicate. As control, activated sludge mixed liquor treated at 70 o C for 10 min was also incubated with the same substrate. The activated sludge was collected after the incubation, and then subjected to MAR-FISH analysis. “Cold” experiments using only natural acetate were performed in 500mL vessels with 250mL activated sludge mixed liquor. The added acetate concentration was either 20 mgC･L -1 or 6 mgC･L -1 . In this experiment, mixed liquor samples were taken during the incubation to monitor residual acetate, phosphate concentrations, and pH. Chemical analyses Acetate and phosphate ions were determined by ion chromatography using a Compact IC 761 (Metrohm, Switzerland) or DX-AQ1110 (Dionex, USA) ion chromatograph. MAR and MAR-FISH Analyses Activated sludge after hot incubation was fixed with the same volume of 8% paraformaldehyde for 3hrs and washed with tap water. The sample was suspended in the mixture of 98% ethanol and 1x PBS buffer (1:1) and stored at -20 o C until use. Then, the sample was sonicated, fixed on a cover-slip, and subjected to FISH. FISH was carried out by the method detailed by Amann et al (1995). In FISH, the following oligonucleotide probes were used: PAOmix probe (a mixture of CCGTCATCTACWCAGGGTATTAAC, CCCTCTGCCAAACTCCAG, and GTTAGCTACGGCACTAAAAGG) (Crocetti et al., 2000) targeting at Candidatus ‘Accumulibacter phosphatis’, one of the PAOs; GB probe (CGATCCTCTAGCCCACT) (Kong et al., 2002) targetting at Candidatus ‘Competibacter phosphatis’, one group of the GAOs; and EUBmix probe (a mixture of GCTGCCTCCCGTAGGAGT, GCAGCCACCCGTAGGTGT, and GCTGCCACCCGTAGGTGT) (Daims et al., 1999) targetting at most Bacteria. Probes PAOmix and GB were labeled with Cy3, and EUBmix with FITC at the 5’ ends, respectively. MAR was conducted by the method described by Andreasen and Nielsen(1997) and Lee et al (1999). The cover slip was immersed in Hypercoat Emulsion LM1(Amersham Bioscience Inc.) at 43 o C for 5 sec, and dried. The cover slip was placed in the dark to expose the emulsion to radioactivity. For each experiment, different exposure times were applied, and the optimal exposure time was selected based on the density of granules around the cells (not too dense). For the experiments with pure cultures, an exposure time of 5 days (R.eutropha) or 7 days (E.coli) was employed. For the experiments with activated sludge, exposure times were 6 hrs (Candidatus ‘Competibacter phosphatis’ for the first and second experiments and Candidatus ‘Accumulibacter phosphatis’ for the Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 218 - second experiment) or 12 hrs (Candidatus ‘Competibacter phosphatis’ for the third experiment and Candidatus ‘Accumulibacter phosphatis’ for the first and third experiments). After the exposure, the slip was dipped in Kodak D19 (40g･L -1 , 3 min), distilled water (1min), and thiosulfate solution (300g･L -1 , 4min) successively. The cover slip was further washed with tap water and distilled water, and then it was immediately dried. Silver granules formed around the cell that had accumulated radioactive substrate as a result of exposure to beta ray from tritium. In the case of MAR-FISH analysis, samples were first treated for FISH, and then treated for MAR. The cover slip was loaded on a slide with Slow Fade Gold anti-fade reagent (Molecular Probes Inc.) and microscopic observation was carried out on an epifluorescence microscope DP50. Image analyses The amounts of cells labeled using the fluorescent oligonucleotide probes in the microscopically obtained images were quantified by fluorescence based on the pixel counts. Silver granules formed on the cover slip were scattered in different focus layers, and thus could not be quantified from one single image. On the same microscopic field, images were obtained at an interval of 0.5μm in z axis. The images were converted to binary images so that only the focused granules are expressed in black, and combined together. The black area of the combined image around each cell was quantified. Image handling was performed on Adobe Photoshop (Adobe, USA). For each analysis, more than 25 microscopic fields were analyzed. RESULTS AND DISCUSSION Evaluation of the quantitativeness of MAR-FISH method The quantitativeness of MAR was evaluated with pure culture experiments added with radio-labeled acetate. In the control experiments with pasteurized cells, no cells were observed with silver granules. The results with live cells are shown in Fig. 1. A linear relationship was observed between acetate concentration and silver granule area but if species were different, the linearity was less. It was suggested that if species are different, the absolute amount of carbon uptake could not be compared. On the other hand, within the same bacteria, MAR was proved to be an effective tool to compare the amount of carbon uptake. Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 219 - Figure 1 Correlation between acetate concentration reduction and the area of silver granules per cell. Dotted lines are for 95% limits for the mean. (Left: E. coli. Right: R. eutropha ) Effect of pH on acetate uptake by PAOs and GAOs The profiles of pH, acetate uptake, and phosphate release observed in the cold experiments are shown in Figs. 2, 3 and 4. In all cases, acetate uptake and the release of phosphate were observed. The pH range narrowed down to around 7 and 8 after the incubation, which originally ranged between 6 and 8 or 9. The effect of pH on the anaerobic uptake of radio-labeled acetate by Candidatus ‘Accumulibacter phosphatis’ and Candidatus ‘Competibacter phosphatis’ was examined by MAR-FISH, and the results are shown in Figs. 5 and 6. Lower initial pH conditions increased anaerobic acetate uptake by Candidatus ‘Accumulibacter phosphatis’ in the second and third experiments, as can be seen by the increase of silver granule area per cell but in the first experiment, the effect of initial pH was not so clear. Lower initial pH conditions also increased anaerobic acetate uptake by Candidatus ‘Competibacter phosphatis’ in the first experiment but in the second and third experiments, the effect of initial pH was not so clear. Based on the observations, it is concluded that both Candidatus ‘Accumulibacter phosphatis’ and Candidatus ‘Competibacter phosphatis’ seem to take up more acetate under lower initial pH conditions. However, it was also found that lower pH did not apparently result in more acetate uptake by Candidatus ‘Accumulibacter phosphatis’ and Candidatus ‘Competibacter phosphatis’, as was seen in one of the three experiments respectively. At least, the effect of pH on anaerobic acetate uptake by these two species of bacteria seems to be similar within the initial pH range of 6 to 8 and the final pH range of around 7 to 8. The value of pH does not seem to be a major determining factor for these two bacterial groups regarding their competition for substrate under anaerobic conditions. Many of the studies on pH effect state that higher pH was beneficial for PAOs and EBPR (Bond et al , 1998; Jeon et al , 2001; Serafim et al , 2002, Zeng et al , 2003, Oehmen et al , 2005; Zhang et al , 2005), although there is a report with opposite results (Schuler and Jenkins, 2002). In the present study, no clear evidence that supports the advantage of PAOs under higher pH in the anaerobic carbon uptake was found. The examined pH Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 220 - range was only between 7 and 8 as the final pH. Examination under wider pH range is worth to be done. However, there may be some other factors that determine the competition between PAOs and GAOs, even if pH condition gives an advantage to only one of them. Fig. 2 Results of the first experiment performed with sludge sampled in October 2006. Fig. 3 Results of the second experiment performed with sludge sampled in December 2006. Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 221 - Fig. 4 Results of the first experiment performed with sludge sampled in February 2007. (a) First experiment (b) Second experiment (c) Third Experiment Fig. 5 Evaluation of acetate uptake by Candidatus ‘Accumulibacter phosphatis’ under different pH conditions. Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 222 - (a) First experiment (b) Second experiment (c) Third Experiment Fig. 6 Evaluation of acetate uptake by Candidatus ‘Competibacter phosphatis’ under different pH conditions. CONCLUSIONS It was demonstrated that MAR-FISH is an effective and quantitative tool to determine and compare the amount of carbon taken up by the clones of the same bacterial isolate. That is, silver granule area had a linear relationship with the amount of carbon taken up. However, if the species is different, the area of silver granule can be different even if the amount of carbon taken up is the same. The quantitative MAR-FISH method was applied to determine the effect of pH on anaerobic acetate uptake by Candidatus ‘Accumulibacter phosphatis’ and Candidatus ‘Competibacter phosphatis’. Within the tested pH range (initial pH from 6 to 8 and final pH from 7 to 8), pH had similar impact on anaerobic acetate uptake by these two bacteria. The value of pH does not seem to be a major determining factor for the competition of these two bacterial groups. REFERENCES Amann, R.I., Ludwig, W. and Schleifer, K. H. (1995). Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbial Reviews. 59,143-169. Andreasen, K., and Nielsen, P.H. (1997). Application of microautoradiography for the Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 223 - study of substrate uptake by filamentous microorganisms in activated sludge. Appl. Environ. Microbiol., 63, 3662-3668. Bond, P. L.; Keller, J; Blackall, L. L.(1998). Characterization of enhanced biological phosphorus removal activated sludges with dissimilar phosphorus removal performances. Wat. Sci. Tech., 37, 567-571. Daims, H., Brühl, A., Amann, R., Schleifer, K.-H., Wagner, M. (1999). The domain-specific probe EUB338 is insufficient for the detection of all bacteria: development and evaluation of a more comprehensive probe set. Syst. Appl. Microbiol. 22, 434-444. Jeon, C.O., Lee, D.S., Lee, M.W., Park, J.M. (2001) Enhanced biological phosphorus removal in an anaerobic-aerobic sequencing batch reactor: Effect of pH. Wa t . Environ. Res., 73, 301-306. Kong, Y. H. Beer, M., Rees, G. N., Seviour, R. J. (2002) Functional analysis of microbioal communities in aerobic-anaerobic sequencing batch reactors fed with different phosphorus/carbon (P/C) ratios. Microbiol. 148, 2299-2307. Lee, N., Nielsen, P.H., Andreasen, K.H., Juretschko, S., Nielsen, J.L., Schleifer, K.H., Wagner, M. (1999) Combination offluorescent in situ hybridization and microautordiography – a new tool for structure-function analyses in microbial ecology. Appl. Environ. Microbiol. 65, 1289-1297. Mino, T.; Van Loosdrecht, M. C. M.; Heijnen, J. J. (1998) Microbiology and biochemistry of the enhanced biological phosphate removal process. Wat. R es., 32, 3193-3207. Oehmen, A.; Vives, M. T.; Lu, H.; Yuan, Z.; Keller, J. (2005) The effect of pH on the competition between polyphosphate-accumulating organisms and glycogen-accumulating organisms. Wat . R e s ., 39, 3727-3737. Seviour, R. J., Mino, T., Onuki, M. (2003) The microbiology of biological phosphorus removal in activated sludge systems FEMS Microbiol. Rev, 27, 99-127. Serafim, L. S., Lemos, P. C., Reis, M. A. M.(2002) Effect of pH control on EBPR stability and efficiency. Wat. Sci. Tech., 46(4/5), 179-184. Schuler, A. J., Jenkins, D.(2002) Effects of pH on enhanced biological phosphorus removal metabolisms Wat. Sci. Tech., 46(4/5),, 171-178. Zeng, R. J., Van Loosdrecht, M. C. M.; Yuan, Z., Keller, J (2003) Metabolic model for glycogen-accumulating organisms in anaerobic/aerobic activated sludge systems Biotechnol. Bioeng., 81, 92-105. Zhang, T.; Liu, Y., Fang, H. H. P. (2005) Effect of pH change on the performance and microbial community of enhanced biological phosphate removal process. Biotechnol. Bioeng, 92, 173-182. . Journal of Water and Environment Technology, Vol. 7, No. 4, 2009 - 215 - Impact of pH on Anaerobic Substrate Uptake by PAOs and GAOs in an EBPR Activated Sludge. phosphatis’ was examined by MAR-FISH, and the results are shown in Figs. 5 and 6. Lower initial pH conditions increased anaerobic acetate uptake by Candidatus