Đang tải... (xem toàn văn)
PHÂN BIỆT CÁC LOẠI THỊT HEO, GÀ, TRÂU, BÒ, DÊ, CỪU BẰNG KỸ THUẬT PCR LUẬN VĂN THẠC SĨ KHOA HỌC NÔNG NGHIỆP Thành phố Hồ Chí Minh Tháng 122009 BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP. HỒ CHÍ MINH ….W U X…. ĐOÀN THỊ TUYẾT LÊ PHÂN BIỆT CÁC LOẠI THỊT HEO, GÀ, TRÂU, BÒ, DÊ, CỪU BẰNG KỸ THUẬT PCR Chuyên ngành : Công Nghệ Sinh Học Mã số : 60.42.80 LUẬN VĂN THẠC SĨ KHOA HỌC NÔNG NGHIỆP Hướng dẫn Khoa học: PGS. TS. NGUYỄN NGỌC TUÂN Thành phố Hồ Chí Minh Tháng 122009 ii LÝ LỊCH CÁ NHÂN Tôi tên là Đoàn Thị Tuyết Lê sinh ngày 17 tháng 1 năm 1983 tại huyện Phù Cát tỉnh Bình Định. Con Ông Đoàn Văn Trọng và Bà Lê Thị Mỹ Oanh. Tốt nghiệp Tú tài tại Trường Quốc Học Quy Nhơn, tỉnh Bình Định năm 2001 Tốt nghiệp Đại học ngành Công nghệ sinh học hệ chính quy tại Đại học Nông Lâm, thành phố Hồ Chí Minh năm 2005 Tháng 9 năm 2006 theo học Cao học ngành Công nghệ sinh học tại Đại học Nông Lâm, Thủ Đức, thành phố Hồ Chi Minh. Tình trạng gia đình: kết hôn Địa chỉ liên lạc: 214B Nguyễn Ái Quốc phường Tân Hiệp – thành phố Biên Hòa – tỉnh Đồng Nai. Điện thoại: 0918916861 Email: tuyetledtyahoo.com iii LỜI CAM ĐOAN Tôi cam đoan đây là công trình nghiên cứu của tôi. Các số liệu, kết quả nêu trong luận văn là trung thực và chưa từng được ai công bố trong bất kỳ công trình nào khác. Tác giả luận văn Đoàn Thị Tuyết Lê iv LỜI CẢM ƠN Tôi xin chân thành gởi lời cảm ơn với tấm lòng biết ơn sâu sắc đến: PGS. TS. Nguyễn Ngọc Tuân đã hết lòng giúp đỡ, hướng dẫn cùng những hỗ trợ rất thiết thực cho tôi trong suốt quá trình thực hiện đề tài. Ban Giám hiệu trường Đại học Nông Lâm thành phố Hố Chí Minh, Ban chủ nhiệm Bộ Môn Công Nghệ Sinh Học. TS. Hồ Thị Kim Hoa, giảng viên Khoa Chăn Nuôi Thú Y trường ĐHNL. TP. HCM. Tập thể cán bộ Phòng Đào Tạo Sau Đại Học trường ĐHNL. TP. HCM. Quý thầy cô, cán bộ công chức tại Viện Công nghệ Sinh học và Môi trường trường ĐHNL. TP. HCM đã tận tình giúp đỡ và tạo điều kiện để hoàn thành luận văn. Các bạn bè và người thân đã luôn quan tâm động viên tôi trong suốt quá trình thực hiện đề tài. Chân thành cảm ơn Đoàn Thị Tuyết Lê v TÓM TẮT Đề tài “Phân biệt các loại thịt trâu, bò, dê, cừu, heo, gà bằng kỹ thuật PCR” được tiến hành tại Viện Công nghệ Sinh học và Môi Trường, trường Đại học Nông Lâm TP. HCM từ ngày 142008 đến ngày 182009. Mục tiêu nghiên cứu là: hoàn thiện quy trình mPCR phân biệt các loại thịt dê, cừu, heo, gà, bò lẫn trâu sử dụng primer thiết kế bởi Matsunaga ctv (1999); xây dựng quy trình PCR phát hiện thịt trâu, thịt bò sử dụng primer tự thiết kế; ứng dụng quy trình mPCR, PCRtrâu và PCRbò để phát hiện 6 loại thịt trên đối với hỗn hợp DNA, hỗn hợp thịt không xử lý nhiệt, có có xử lý nhiệt và mẫu bột thịt trên thị trường nguyên liệu chế biến thức ăn gia súc. Kết quả đạt được như sau: Đã tối ưu phản ứng mPCR phát hiện thịt heo, gà, dê, cừu, bò lẫn trâu sử dụng các primer được thiết kế bởi Matsunaga ctv (1999). Tỷ lệ thích hợp cho các primer FSIM:RG:RCh:RCB:RS:RP là 12: 7: 7:10: 5: 25 pmol. Quy trình này có thể áp dụng cho thịt tươi, thịt xử lý nhiệt ở nhiệt độ 80oC15’; 120oC15’; 120oC30’; 130oC15’; 130oC30’, 180oC15’. Ảnh hưởng của tỷ lệ DNA hiện diện trong các hỗn hợp DNA và hỗn hợp thịt lên khả năng phát hiện của mPCR cũng được xác định. Đối với hỗn hợp DNA 6 loài có tỷ lệ bằng nhau, nồng độ DNA thấp nhất mà mPCR phát hiện gà là 0,0001 ngμl, heo là 0,00025 ngμl, cừu, dê, trâubò là 0,0025 ngμl. Còn đối với hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu, tỷ lệ thấp nhất mà mPCR có thể phát hiện trâubò, dê là 0,1%, cừu là 1%. Tỷ lệ giống nhau giữa hỗn hợp DNA và hỗn hợp thịt không xử lý nhiệt ảnh hưởng như nhau đến khả năng phát hiện của mPCR. MPCR không phát hiện được thịt trâubò, dê, cừu với tỷ lệ ≤ 10% trong hỗn hợp thịt xử lý ở 130oC30’. Quy trình mPCR sử dụng primer thiết kế bởi Matsunaga ctv (1999) chưa phân biệt được thịt bò với thịt trâu nên đề tài tiếp tục xây dựng quy trình PCR phát hiện thịt trâu và thịt bò với các primer tự thiết kế. Các primer được thiết kế dựa vào vùng giống và khác nhau của gen cytochrome b của thịt bò, trâu và các loài khác. Quy trình PCR phát hiện thịt trâu với forward primer và reverse primer có trình tự như sau 5’ CTACACATCCGA CACAACAACAGC3’, 5’ ATGTAGCAGGGGCAT GAGAA3’. Mẫu DNA được biến tính ở 94oC trong 4 phút sau đó được khuếch đại qua 35 chu kỳ nhiệt: biến tính 94oC1’, ủ bắt cặp ở 56oC 45’’, kéo dài ở 72oC1’ và kết thúc ở 72oC5’. Nồng độ DNA trâu thấp nhất mà PCRtrâu có thể phát hiện là vi 0,001 ngμl. Tỷ lệ DNA thịt trâu thấp nhất trong hỗn hợp DNA giảm dần của trâu, bò, dê, cừu mà PCRtrâu có thể phát hiện là 0,1%. Tỷ lệ thịt trâu thấp nhất mà PCRtrâu có thể phát hiện trong hỗn hợp thịt giảm dần của trâu, bò, dê, cừu là 0,1%. Quy trình PCRtrâu có khả năng phát hiện thịt trâu trong các hỗn hợp thịt xử lý ở 80oC15’, 120oC15’, 130oC15’, 180oC15’ nhưng không có khả năng phát hiện thịt trâu với tỷ lệ ≤ 10% trong hỗn hợp thịt xử lý ở 120oC30’ và 130oC30’. Quy trình PCR phát hiện thịt bò với forward primer là 5’CTACACATCCGA CACAACAACAGC3’, reverse primer là 5’TCAGTAGGTCTGCTACTAGGGC 3’. Quy trình nhiệt như sau: tiền biến tính 94oC4’; 35 chu kỳ: biến tính ở 94oC1’, bắt cặp ở 54oC 45’’, kéo dài ở 72oC1’; kéo dài cuối cùng ở 72oC5’. Nồng độ DNA bò thấp nhất mà PCRbò có thể phát hiện là 0,001 ngμl. Tỷ lệ DNA bò thấp nhất trong hỗn hợp DNA giảm dần của trâu, bò, dê, cừu mà PCRbò có thể phát hiện là 0,05%. Tỷ lệ thịt bò thấp nhất mà PCRbò có thể phát hiện trong hỗn hợp thịt giảm dần của trâu, bò, dê, cừu là 0,1%. PCRbò có khả năng phát hiện thịt bò trong các hỗn hợp thịt xử lý ở 80oC15’, 180oC15’ nhưng không có khả năng phát hiện thịt bò với tỷ lệ ≤ 10% trong hỗn hợp thịt xử lý ở 120oC15’, 120oC30’, 130oC15’ và 130oC30’. vii SUMMARY Research project “Differentiation of meat species of buffalo, cattle, goat, sheep, pig, and chicken by PCR techniques” was carried out at Institute of Biotechnology Environment, Nong Lam University Ho Chi Minh city from April 1, 2008 to August 1, 2009. The project was aimed: (i) to optimize the mPCR reaction used for differentiation of commercially available meat including lamb, beef andor buffalo meat, chicken, pork and goat meat using primers designed by Matsunaga et al (1998); (ii) to establish PCR reactions for identification of beef and buffalo meat; (iii) consequently, to apply these reactions in identification of meat species in raw and processed meat mixtures. The results were summarized as follows: The optimal mPCR condition for detection of the meat species was confirmed, in which the proportion of primers for identification of pork, lamb, beef, chicken, goat meat, and buffalo was 12: 7: 7:10: 5: 25 pmol (FSIM: RG: RCH: RCB: RS: RP), respectively. This protocol could be applied to fresh meat and meat that had been processed at 80oC15; 120oC15; 120oC30 ; 130oC15; 130oC30, and 180oC15. The effect of the amount of DNA template from different meat species in the reaction was also investigated. For DNA mixture involving the six meat species with equal ratio, the lowest concentration for detection of DNA was 0.0001 ngμl in chicken, 0.00025 ngμl in pork, 0.0025 ngμl in lamb, goat, buffalo andor cattle . In the mixture with reduced DNA concentrations from lamb, cattle and goat meat, the lowest rate of DNA that can be detected in was 0.1% in buffalo meat andor beef, 0,1% in goat meat and 1% in lamb. The mPCR protocol didn’t differentiate between beef and buffalo meat exactly. So, the reseach continued to build PCR protocols detecting buffalo meat and beef with selfdesigned primer. The primers was designed based on similar and different regions of cytochrome b genes of cattle, buffalo and other species. PCR protocol for detection of buffalo meat (buffaloPCR) using specific primers was accomplished. A new set of primers for buffalo meat were designed and tested (Forward primer, 5CTACACATCCGACACAACAACAGC3 and reverse primer, 5ATGTAGCAGGGGCATGAGAA3). Amplification reaction was started with predenaturation step at 94oC4, followed by 35 cycles including 94oC1, 56oC45, viii 72oC1’ and final extension at 72oC5. The lowest concentration of buffalo DNA that could be detected by buffaloPCR was 0.001 ngμl. The lowest rate of buffalo DNA in the DNA mixture reduced ratio of DNA from raw meat of buffalo, cattle, goat, sheep that buffaloPCR could detect was 0.1%, which is the same as the lowest rate of buffalo meat that buffaloPCR could detect in the meat mixture with reduced ratio of buffalo, beef, goat, sheep. The PCR was successfully applied to detect buffalo meat in mixtures having been processed at 80oC15’, 120oC15’, 130oC15’, 180oC15’ but was not in the case of meat mixtures that had ≤ 10% buffalo meat and had been heated at 120oC30’ and 130oC30’. PCR protocol for detection of beef (cattlePCR) was set up. The new set of primers for the PCR to detect beef were: forward primer, 5CTACACATCCGACAC AACAACAGC3’, and reverse primer, 5TCAGTAGGTCTGCTACTAGGGC3. The thermal process was as follows: 94oC4 for initial denaturation, 35 cycles of denaturation at 94oC1’, annealing at 54oC45, enlongation at 72oC1’ and final extension at 72oC5’. The cattlePCR could detect cattle DNA with the concentration as low as 0.001 ngμl. The lowest rate of cattle DNA in the mixture reduced ratio of DNA from the raw meat of the buffalo, cattle, goat, sheep that cattlePCR could detect was 0.05%. The lowest rate of cattle meat that cattlePCR could detect in the reduced ratio mixture of buffalo, goats, sheep meat was 0.1%. This PCR protocol was successfully to detect beef in meat mixtures which was processed at 80oC15, 180oC15 but was not to identify the meat in those had ≤ 10% buffalo meat and had been processed at 120oC15’, 120oC30’, 130oC15’, and 130oC30’. ix MỤC LỤC CHƯƠNG TRANG Trang tựa Trang Chuẩn Y ................................................................................................................. i LÝ LỊCH CÁ NHÂN ....................................................................................................... i LỜI CAM ĐOAN .......................................................................................................... iii LỜI CẢM ƠN .................................................................................................................iv TÓM TẮT ........................................................................................................................ v DANH SÁCH CÁC CHỮ VIẾT TẮT ........................................................................ xiii DANH SÁCH CÁC HÌNH ............................................................................................ xv DANH SÁCH SƠ ĐỒ ..................................................................................................xvi DANH SÁCH CÁC BẢNG ....................................................................................... xvii Chương 1 .........................................................................................................................1 MỞ ĐẦU ......................................................................................................................... 1 1.1. Đặt vấn đề ............................................................................................................. 1 1.2 Mục tiêu ................................................................................................................ 2 1.3 Mục đích ................................................................................................................ 2 Chương 2 .........................................................................................................................3 TỔNG QUAN.................................................................................................................. 3 2.1. Sơ lược về thịt và thịt chế biến ............................................................................. 3 2.1.1 Giới thiệu sơ lược về thịt ................................................................................ 3 2.1.2 Giới thiệu sơ lược về thịt chế biến .................................................................. 4 2.1.3 Tình hình gian lận trên thị trường thịt của thế giới và Việt Nam ................... 5 2.1.3.1 Tình hình gian lận trên thị trường thịt tươi và thịt chế biến của thế giới ........................................................................................................................ 5 2.1.3.2 Tình hình gian lận trên thị trường thịt tươi và thịt chế biến ở Việt Nam ...................................................................................................................... 5 2.2. Các phương pháp phát hiện thịt ............................................................................ 6 2.2.1 Phương pháp dựa vào protein ......................................................................... 6 2.2.1.1 Phương pháp điện di ................................................................................. 6 2.2.1.2 Phương pháp miễn dịch ............................................................................ 8 2.2.1.3. Phương pháp sắc ký ................................................................................. 9 2.2.2. Phương pháp dựa vào DNA ........................................................................... 9 2.2.2.1 Phương pháp lai DNA .............................................................................. 9 2.2.2.2 Phương pháp dựa vào PCR .................................................................... 11 2.3 Thiết kế primer ..................................................................................................... 21 2.3.1 Tổng quan về thiết kế primer ........................................................................ 21 2.3.1.1 Giới thiệu ................................................................................................ 21 2.3.1.2 Các đặc điểm của primer ........................................................................ 21 2.3.1.3 Nguyên tắc chung của thiết kế primer .................................................... 23 2.3.2 FastPCR......................................................................................................... 24 2.4 DNA ty thể và gen cytochrome b trong việc phát hiện loài ................................ 24 2.4.1 DNA ty thể .................................................................................................... 24 2.4.2 Di truyền của ty thể....................................................................................... 28 2.4.3 Sử dụng gen cytochrome b để phát hiện nguồn gốc loài trong các sản phẩm thịt chế biến .................................................................................................. 28 x 2.5 Tổng quan các công trình nghiên cứu về phát hiện loài của thịt bằng phương pháp PCR và multiplex PCR ........................................................................ 29 Chương 3 ....................................................................................................................... 33 NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU ..................................................... 33 3.1 Thời gian và địa điểm tiến hành .......................................................................... 33 3.2 Nội dung nghiên cứu ........................................................................................... 33 3.3 Vật liệu ................................................................................................................. 33 3.3.1 Nguồn mẫu tách chiết DNA .......................................................................... 33 3.3.2 Primer ............................................................................................................ 34 3.3.3 Hóa chất, thiết bị và dụng cụ......................................................................... 34 3.4 Phương pháp tiến hành ........................................................................................ 35 3.4.1 Lấy và bảo quản mẫu .................................................................................... 35 3.4.2 Tách chiết DNA ............................................................................................ 35 3.4.3 Điều chỉnh quy trình mPCR phát hiện thịt có nguồn gốc từ heo, gà, dê, cừu, bò vàhoặc trâu ......................................................................................... 36 3.4.3.1 Phát hiện từng loại thịt bằng các phản ứng PCR đơn ............................. 36 3.4.3.2 Thiết lập và tối ưu hóa quy trình mPCR ............................................... 36 3.4.3.3 Thí nghiệm xác định khả năng phát hiện thịt trâu của mPCR .............. 37 3.4.4 Thiết kế và kiểm tra primer phát hiện thịt trâu và thịt bò ............................. 38 3.4.4.1 Thiết kế primer ....................................................................................... 38 3.4.4.3 Kiểm tra trên thực tế độ đặc hiệu các cặp primer FRB, FRC .......... 39 3.4.5 Xác định quy trình PCR trâu và PCRbò ..................................................... 40 3.4.6 Ứng dụng mPCR, PCRtrâu, PCRbò để phát hiện thịt trâu, bò, dê, cừu, heo, gà ............................................................................................................ 40 3.4.6.1 Ứng dụng mPCR ................................................................................... 40 a. Xác định giới hạn nồng độ DNA có thể phát hiện được của mPCR ............................................................................................................ 40 b.Thực hiện mPCR đối với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu ....................................................................... 41 c. Thực hiện mPCR để phát hiện thịt heo, gà, trâu, bò, dê, cừu trong các hỗn hợp thịt không xử lý nhiệt ................................................. 41 d. Thực hiện mPCR để phát hiện thịt heo, gà, trâu, bò, dê, cừu trong các hỗn hợp thịt xử lý nhiệt ............................................................ 42 e. Thực hiện mPCR với bột thịt trên thị trường ............................................ 42 3.4.6.2 Ứng dụng PCRtrâu ................................................................................ 42 a. Xác định giới hạn phát hiện của PCRtrâu ................................................. 42 b. PCRtrâu với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu .............................................................................................. 42 c. PCRtrâu phát hiện thịt trâu trong các hỗn hợp thịt không xử lý nhiệt ....................................................................................................... 42 d. PCRtrâu phát hiện thịt trâu trong các hỗn hợp thịt xử lý nhiệt ................................................................................................................ 42 e. PCRtrâu với bột thịt trên thị trường ........................................................... 42 3.4.8.3 Ứng dụng PCRbò .................................................................................. 44 a. Xác định giới hạn phát hiện của PCRbò .................................................... 44 b. PCRbò với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu .............................................................................................. 44 xi c. PCRbò phát hiện thịt bò trong các hỗn hợp thịt không xử lý nhiệt ............................................................................................................ 44 d. PCRbò phát hiện thịt bò trong các hỗn hợp thịt xử lý nhiệt ...................... 44 e. PCRbò với bột thịt trên thị trường ............................................................. 44 Chương 4 ....................................................................................................................... 46 KẾT QUẢ THẢO LUẬN ............................................................................................. 46 4.1 Điều chỉnh quy trình mPCR ............................................................................... 46 4.1.1 PCR phát hiện từng loại thịt heo, gà, trâu, bò, dê, cừu ................................. 46 4.1.2 Quá trình thiết lập và tối ưu hóa mPCR ...................................................... 47 4.1.3 Thí nghiệm xác định khả năng phát hiện thịt trâu của mPCR ..................... 49 4.2 Kết quả thiết kế và tổng hợp primer phát hiện thịt trâu, thịt bò .......................... 50 4.3 Kết quả kiểm tra lý thuyết độ đặc hiệu các cặp primer FRB, FRC ............... 50 4.3.1 Kết quả kiểm tra bằng FASTPCR ................................................................. 50 4.3.2 Kết quả kiểm tra bằng Clustal W .................................................................. 51 4.3.3 Kết quả BLAST ............................................................................................ 51 4.4 Kết quả kiểm tra trên thực tế độ đặc hiệu các cặp primer FRB, FRC ........... 51 4.4.1 Bằng PCR ...................................................................................................... 51 4.4.1.1 Kết quả kiểm tra tổ hợp primer A và B .................................................. 52 4.4.1.2 Kết quả kiểm tra tổ hợp primer C và D .................................................. 52 4.4.1.3 Kết quả kiểm tra tổ hợp primer E và F ................................................... 52 4.4.1.4 Kết quả kiểm tra tổ hợp primer G và H .................................................. 53 4.4.1.5 Kiểm tra độ đặc hiệu primer F2RBU2 và F2RC2 với các DNA template của lúa, đậu phộng, đậu nành, mè, cà chua ......................................... 55 4.4.2 Giải trình tự sản phẩm PCR của cặp FRB; FRC đặc hiệu ...................... 55 4.4.3 Xác nhận sản phẩm khuếch đại là của thịt trâu và bò ................................... 56 4.4.3.1 BLAST ................................................................................................... 56 4.4.3.2 Gởi mã số lên NCBI cho trình tự đoạn DNA của thịt trâu và bò ........... 56 4.5 Xác định quy trình PCRtrâu ............................................................................... 57 4.6 Xác định quy trình PCRbò ................................................................................. 57 4.7 Ứng dụng mPCR, PCRtrâu và PCRbò phát hiện thịt trâu, bò, dê, cừu, heo, gà ........................................................................................................................ 57 4.7.1 Ứng dụng mPCR .......................................................................................... 57 4.7.1.1 Xác định giới hạn nồng độ DNA mỗi loài có thể phát hiện được của mPCR .......................................................................................................... 57 4.7.1.2 MPCR đối với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu .......................................................................................................... 58 4.7.1.3 MPCR phát hiện thịt heo, gà, trâubò, dê, cừu trong các hỗn hợp thịt không xử lý nhiệt ......................................................................................... 59 4.7.1.4 MPCR phát hiện thịt heo, gà, trâubò, dê, cừu trong các hỗn hợp thịt xử lý nhiệt .................................................................................................... 60 a. Kết quả phát hiện thịt heo, gà, trâubò, dê, cừu trong các hỗn hợp thịt xử lý ............................................................................................ 61 b. Kết quả so sánh mPCR với thịt không xử lý nhiệt và thịt xử lý nhiệt ở cùng nhóm tỷ lệ phối trộn ......................................................... 64 4.7.1.5 MPCR với bột thịt trên thị trường ......................................................... 67 4.7.2 Ứng dụng PCRtrâu ...................................................................................... 68 4.7.2.1 Giới hạn nồng độ DNA trâu có thể phát hiện được của PCRtrâu ......... 68 xii 4.7.2.2 PCRtrâu đối với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu .......................................................................................................... 68 4.7.2.3 PCRtrâu phát hiện thịt trâu trong các hỗn hợp thịt không xử lý nhiệt .................................................................................................................... 69 4.7.2.4 PCRtrâu phát hiện thịt trâu trong các hỗn hợp thịt xử lý nhiệt ............. 69 4.7.2.5 PCRtrâu với bột thịt trên thị trường ...................................................... 71 4.7.3 Ứng dụng PCRbò ......................................................................................... 71 4.7.3.1 Giới hạn nồng độ DNA bò có thể phát hiện được của PCRbò ............. 71 4.7.3.2 PCRbò đối với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu .......................................................................................................... 72 4.7.3.3 PCRbò phát hiện thịt bò trong các hỗn hợp thịt không xử lý nhiệt ...... 72 4.7.3.4 PCRbò phát hiện thịt bò trong các hỗn hợp thịt xử lý nhiệt ................. 73 4.7.2.5 PCRbò với bột thịt trên thị trường ........................................................ 75 Chương 5 ....................................................................................................................... 76 KẾT LUẬN VÀ ĐỀ NGHỊ ........................................................................................... 76 5.1 Kết luận ................................................................................................................ 76 5.2 Đề nghị................................................................................................................. 76 TÀI LIỆU THAM KHẢO ............................................................................................. 78 xiii DANH SÁCH CÁC CHỮ VIẾT TẮT BLAST : Basic Local Alignment Search Tool BSE : bovine spongiform encephalophathy F : forward primer chung cho bò và trâu tự thiết kế ( gồm F1 và F2) FSIM : forward primer SIM (kí hiệu của forward primer chung của mPCR) GC : gas chromatography HPLC : high performance liquid chromatography IEF : isoelectric focusing LC : liquid chromatography LTRs : long terminal repeats mPCR : multiplex polymerase reaction chain MTATP6 : mitochondrially encoded ATP synthase 6 mtDNA : mitochondrial deoxyribonucleic acid MTND1 : mitochondrially encoded NADH dehydrogenase 1 MTND4 : mitochondrially encoded NADH dehydrogenase 4 MTND4L : mitochondrially encoded NADH dehydrogenase 4L MTND5 : mitochondrially encoded NADH dehydrogenase 5 MTND6 : mitochondrially encoded NADH dehydrogenase 6 MTRNR1 : mitochondrially encoded 12S RNA MTTH : mitochondrially encoded tRNA histidine MTTL1 : mitochondrially encoded tRNA leucine 1 (UUAG) MTTS1 : mitochondrially encoded tRNA serine 1 (UCN) MTTV : mitochondrially encoded tRNA valine NADH : Nicotinamide adenine dinucleotide PCR : polymerase chain reaction Prion : proteinaceous infectious particle RBU : reverse primer buffalo (gọi chung cho RBU1 và RBU2 tự thiết kế) RC : reverse primer cattle (gọi chung cho RC1 và RC2 tự thiết kế) RCB : reverse primer cattle buffalo (theo Matsunaga ctv, 1999) RCh : reverse primer chicken RG : reverse primer goat xiv RP HPLC : reverse phase high performance liquid chromatography RP : reverse primer pig RS : reverse primer sheep SSRs : simple sequence repeats xv DANH SÁCH CÁC HÌNH Hình 2.1: Mô hình kiểm tra một mẫu bằng kỹ thuật lai DNA ...................................... 10 Hình 2.2: Genome của ty thể......................................................................................... 27 Hình 4.1: Sản phẩm PCR riêng lẻ của heo, cừu, bò, gà, dê .......................................... 46 Hình 4.2: Sản phẩm PCR của thịt bò và trâu ................................................................. 47 Hình 4.3: Kết quả mPCR theo PCR riêng lẻ................................................................ 48 Hình 4.4: Kết quả tối ưu mPCR ................................................................................... 48 Hình 4.5: Kết quả thí nghiệm khẳng định mPCR phát hiện thịt trâu ........................... 49 Hình 4.6: Kết quả kiểm tra tổ hợp primer A (F1RBU1) và B (F1RBU2) .................. 53 Hình 4.7: Kết quả kiểm tra tổ hợp primer C (F1RC1) và D (F1RC2) ........................ 53 Hình 4.8: Kết quả kiểm tra tổ hợp primer E (F2RBU1)và F (F2RBU2) .................... 54 Hình 4.9: Kết quả kiểm tra tổ hợp primer G ((F2RC1) và H (F2RC2) ...................... 54 Hình 4.10: Kiểm tra độ đặc hiệu primer F2 RBU2 (Ta=56oC) .................................. 54 Hình 4.11: Kiểm tra độ đặc hiệu primer F2RBU2 và F2RC2 với các DNA template của lúa, đậu phộng, đậu nành, mè, cà chua ................................................. 55 Hình 4.12: Giới hạn nồng độ DNA có thể phát hiện được của mPCR ........................ 57 Hình 4.13: Kết quả mPCR đối với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu ................................................................................................... 59 Hình 4.14: MPCR phát hiện thịt heo, gà, bò, dê, cừu trong các hỗn hợp thịt không xử lý nhiệt ......................................................................................................... 60 Hình 4.15: MPCR phát hiện thịt heo, gà, trâubò, dê, cừu trong các hỗn hợp thịt xử lý nhiệt ở 80oC15’(M2.1M2.7) và 120oC15’ (M3.1M3.7) .................... 63 Hình 4.16: MPCR phát hiện thịt heo, gà, trâubò, dê, cừu trong các hỗn hợp thịt xử lý nhiệt ở 120oC30’(M4.1M4.7) và 130oC15’ (M5.1M5.7) .................. 63 Hình 4.17: MPCR phát hiện thịt heo, gà, trâubò, dê, cừu trong các hỗn hợp thịt xử lý nhiệt ở 130oC30’(M6.1M6.7) và 180oC15’ (M7.1M7.7) .................. 63 Hình 4.18: Kết quả mPCR với bột thịt trên thị trường ................................................ 67 Hình 4.19: Giới hạn nồng độ DNA trâu có thể phát hiện được của PCRtrâu .............. 68 Hình 4.20: PCRtrâu đối với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu ............................................................................................................... 68 Hình 4.21: PCRtrâu phát hiện thịt trâu trong các hỗn hợp thịt không xử lý nhiệt ....... 69 Hình 4.22: PCRtrâu phát hiện thịt trâu trong các hỗn hợp thịt xử lý nhiệt ở 80oC15’(M2.1M2.7) và 180oC15’ (M7.1M7.7) ..................................... 70 Hình 4.23: PCRtrâu phát hiện thịt trâu trong các hỗn hợp thịt xử lý nhiệt ở 130oC30’(M6.1M6.7) và 120oC15’ (M3.1M3.7)................................... 70 Hình 4.24: PCRtrâu phát hiện thịt trong các hỗn hợp thịt xử lý nhiệt ở 130oC15’(M5.1M5.7) và 120oC30’ (M4.1M4.7)................................... 70 Hình 4.25: PCRtrâu với bột thịt ................................................................................... 71 Hình 4.26: Giới hạn nồng độ DNA bò có thể phát hiện được của PCRbò .................. 71 Hình 4.27: PCRbò đối với các hỗn hợp DNA có nồng độ giảm dần của trâu, bò, dê, cừu ............................................................................................................... 72 Hình 4.28: PCRbò phát hiện thịt bò trong các hỗn hợp thịt không xử lý nhiệt ........... 73 Hình 4.29: PCRbò phát hiện thịt bò trong các hỗn hợp thịt xử lý nhiệt ở 80oC15’(M2.1M2.7) và 120oC15’ (M3.1M3.7) ..................................... 74 Hình 4.30: PCRbò phát hiện thịt bòtrong các hỗn hợp thịt xử lý nhiệt ở 120oC30’(M4.1M4.7) và 130oC15’ (M5.1M5.7)................................... 7
BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH ….W U X… ĐỒN THỊ TUYẾT LÊ PHÂN BIỆT CÁC LOẠI THỊT HEO, GÀ, TRÂU, BÒ, DÊ, CỪU BẰNG KỸ THUẬT PCR LUẬN VĂN THẠC SĨ KHOA HỌC NƠNG NGHIỆP Thành phố Hồ Chí Minh Tháng 12/2009 BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH ….W U X… ĐỒN THỊ TUYẾT LÊ PHÂN BIỆT CÁC LOẠI THỊT HEO, GÀ, TRÂU, BÒ, DÊ, CỪU BẰNG KỸ THUẬT PCR Chuyên ngành : Công Nghệ Sinh Học Mã số : 60.42.80 LUẬN VĂN THẠC SĨ KHOA HỌC NÔNG NGHIỆP Hướng dẫn Khoa học: PGS TS NGUYỄN NGỌC TUÂN Thành phố Hồ Chí Minh Tháng 12/2009 LÝ LỊCH CÁ NHÂN Tơi tên Đồn Thị Tuyết Lê sinh ngày 17 tháng năm 1983 huyện Phù Cát tỉnh Bình Định Con Ơng Đồn Văn Trọng Bà Lê Thị Mỹ Oanh Tốt nghiệp Tú tài Trường Quốc Học Quy Nhơn, tỉnh Bình Định năm 2001 Tốt nghiệp Đại học ngành Công nghệ sinh học hệ quy Đại học Nơng Lâm, thành phố Hồ Chí Minh năm 2005 Tháng năm 2006 theo học Cao học ngành Công nghệ sinh học Đại học Nông Lâm, Thủ Đức, thành phố Hồ Chi Minh Tình trạng gia đình: kết Địa liên lạc: 214B Nguyễn Ái Quốc - phường Tân Hiệp – thành phố Biên Hòa – tỉnh Đồng Nai Điện thoại: 0918916861 Email: tuyetledt@yahoo.com ii LỜI CAM ĐOAN Tôi cam đoan cơng trình nghiên cứu tơi Các số liệu, kết nêu luận văn trung thực chưa công bố cơng trình khác Tác giả luận văn Đồn Thị Tuyết Lê iii LỜI CẢM ƠN Tôi xin chân thành gởi lời cảm ơn với lòng biết ơn sâu sắc đến: * PGS TS Nguyễn Ngọc Tuân hết lòng giúp đỡ, hướng dẫn hỗ trợ thiết thực cho tơi suốt q trình thực đề tài * Ban Giám hiệu trường Đại học Nơng Lâm thành phố Hố Chí Minh, Ban chủ nhiệm Bộ Môn Công Nghệ Sinh Học * TS Hồ Thị Kim Hoa, giảng viên Khoa Chăn Nuôi Thú Y trường ĐHNL TP HCM * Tập thể cán Phòng Đào Tạo Sau Đại Học trường ĐHNL TP HCM * Quý thầy cô, cán công chức Viện Công nghệ Sinh học Môi trường - trường ĐHNL TP HCM tận tình giúp đỡ tạo điều kiện để hoàn thành luận văn * Các bạn bè người thân quan tâm động viên suốt trình thực đề tài Chân thành cảm ơn Đồn Thị Tuyết Lê iv TĨM TẮT Đề tài “Phân biệt loại thịt trâu, bò, dê, cừu, heo, gà kỹ thuật PCR” tiến hành Viện Công nghệ Sinh học Môi Trường, trường Đại học Nông Lâm TP HCM từ ngày 1/4/2008 đến ngày 1/8/2009 Mục tiêu nghiên cứu là: hồn thiện quy trình m-PCR phân biệt loại thịt dê, cừu, heo, gà, bò lẫn trâu sử dụng primer thiết kế Matsunaga & ctv (1999); xây dựng quy trình PCR phát thịt trâu, thịt bò sử dụng primer tự thiết kế; ứng dụng quy trình m-PCR, PCR-trâu PCRbị để phát loại thịt hỗn hợp DNA, hỗn hợp thịt khơng xử lý nhiệt, có có xử lý nhiệt mẫu bột thịt thị trường nguyên liệu chế biến thức ăn gia súc Kết đạt sau: Đã tối ưu phản ứng m-PCR phát thịt heo, gà, dê, cừu, bò lẫn trâu sử dụng primer thiết kế Matsunaga & ctv (1999) Tỷ lệ thích hợp cho primer FSIM:RG:RCh:RCB:RS:RP 12: 7: 7:10: 5: 25 pmol Quy trình áp dụng cho thịt tươi, thịt xử lý nhiệt nhiệt độ 80oC/15’; 120oC/15’; 120oC/30’; 130oC/15’; 130oC/30’, 180oC/15’ Ảnh hưởng tỷ lệ DNA diện hỗn hợp DNA hỗn hợp thịt lên khả phát m-PCR xác định Đối với hỗn hợp DNA lồi có tỷ lệ nhau, nồng độ DNA thấp mà m-PCR phát gà 0,0001 ng/μl, heo 0,00025 ng/μl, cừu, dê, trâu/&bò 0,0025 ng/μl Cịn hỗn hợp DNA có nồng độ giảm dần trâu, bò, dê, cừu, tỷ lệ thấp mà m-PCR phát trâu/&bị, dê 0,1%, cừu 1% Tỷ lệ giống hỗn hợp DNA hỗn hợp thịt không xử lý nhiệt ảnh hưởng đến khả phát mPCR M-PCR khơng phát thịt trâu/&bị, dê, cừu với tỷ lệ ≤ 10% hỗn hợp thịt xử lý 130oC/30’ Quy trình m-PCR sử dụng primer thiết kế Matsunaga & ctv (1999) chưa phân biệt thịt bò với thịt trâu nên đề tài tiếp tục xây dựng quy trình PCR phát thịt trâu thịt bò với primer tự thiết kế Các primer thiết kế dựa vào vùng giống khác gen cytochrome b thịt bị, trâu lồi khác Quy trình PCR phát thịt trâu với forward primer reverse primer có trình tự sau 5’- CTACACATCCGA CACAACAACAGC-3’, 5’- ATGTAGCAGGGGCAT GAGAA-3’ Mẫu DNA biến tính 94oC phút sau khuếch đại qua 35 chu kỳ nhiệt: biến tính 94oC/1’, ủ bắt cặp 56oC/ 45’’, kéo dài 72oC/1’ kết thúc 72oC/5’ Nồng độ DNA trâu thấp mà PCR-trâu phát v 0,001 ng/μl Tỷ lệ DNA thịt trâu thấp hỗn hợp DNA giảm dần trâu, bị, dê, cừu mà PCR-trâu phát 0,1% Tỷ lệ thịt trâu thấp mà PCR-trâu phát hỗn hợp thịt giảm dần trâu, bò, dê, cừu 0,1% Quy trình PCR-trâu có khả phát thịt trâu hỗn hợp thịt xử lý 80oC/15’, 120oC/15’, 130oC/15’, 180oC/15’ khơng có khả phát thịt trâu với tỷ lệ ≤ 10% hỗn hợp thịt xử lý 120oC/30’ 130oC/30’ Quy trình PCR phát thịt bò với forward primer 5’-CTACACATCCGA CACAACAACAGC-3’, reverse primer 5’-TCAGTAGGTCTGCTACTAGGGC -3’ Quy trình nhiệt sau: tiền biến tính 94oC/4’; 35 chu kỳ: biến tính 94oC/1’, bắt cặp 54oC/ 45’’, kéo dài 72oC/1’; kéo dài cuối 72oC/5’ Nồng độ DNA bò thấp mà PCR-bị phát 0,001 ng/μl Tỷ lệ DNA bò thấp hỗn hợp DNA giảm dần trâu, bị, dê, cừu mà PCR-bị phát 0,05% Tỷ lệ thịt bò thấp mà PCR-bị phát hỗn hợp thịt giảm dần trâu, bò, dê, cừu 0,1% PCR-bị có khả phát thịt bị hỗn hợp thịt xử lý 80oC/15’, 180oC/15’ khả phát thịt bị với tỷ lệ ≤ 10% hỗn hợp thịt xử lý 120oC/15’, 120oC/30’, 130oC/15’ 130oC/30’ vi SUMMARY Research project “Differentiation of meat species of buffalo, cattle, goat, sheep, pig, and chicken by PCR techniques” was carried out at Institute of Biotechnology & Environment, Nong Lam University Ho Chi Minh city from April 1, 2008 to August 1, 2009 The project was aimed: (i) to optimize the m-PCR reaction used for differentiation of commercially available meat including lamb, beef and/or buffalo meat, chicken, pork and goat meat using primers designed by Matsunaga & et al (1998); (ii) to establish PCR reactions for identification of beef and buffalo meat; (iii) consequently, to apply these reactions in identification of meat species in raw and processed meat mixtures The results were summarized as follows: The optimal m-PCR condition for detection of the meat species was confirmed, in which the proportion of primers for identification of pork, lamb, beef, chicken, goat meat, and buffalo was 12: 7: 7:10: 5: 25 pmol (FSIM: RG: RCH: RCB: RS: RP), respectively This protocol could be applied to fresh meat and meat that had been processed at 80oC/15; 120oC/15'; 120oC/30 '; 130oC/15'; 130oC/30', and 180oC/15' The effect of the amount of DNA template from different meat species in the reaction was also investigated For DNA mixture involving the six meat species with equal ratio, the lowest concentration for detection of DNA was 0.0001 ng/μl in chicken, 0.00025 ng/μl in pork, 0.0025 ng/μl in lamb, goat, buffalo and/or cattle In the mixture with reduced DNA concentrations from lamb, cattle and goat meat, the lowest rate of DNA that can be detected in was 0.1% in buffalo meat and/or beef, 0,1% in goat meat and 1% in lamb The m-PCR protocol didn’t differentiate between beef and buffalo meat exactly So, the reseach continued to build PCR protocols detecting buffalo meat and beef with self-designed primer The primers was designed based on similar and different regions of cytochrome b genes of cattle, buffalo and other species PCR protocol for detection of buffalo meat (buffalo-PCR) using specific primers was accomplished A new set of primers for buffalo meat were designed and tested (Forward primer, 5'-CTACACATCCGACACAACAACAGC-3' and reverse primer, 5'-ATGTAGCAGGGGCATGAGAA-3') Amplification reaction was started with predenaturation step at 94oC/4', followed by 35 cycles including 94oC/1', 56oC/45'', vii 72oC/1’ and final extension at 72oC/5' The lowest concentration of buffalo DNA that could be detected by buffalo-PCR was 0.001 ng/μl The lowest rate of buffalo DNA in the DNA mixture reduced ratio of DNA from raw meat of buffalo, cattle, goat, sheep that buffalo-PCR could detect was 0.1%, which is the same as the lowest rate of buffalo meat that buffalo-PCR could detect in the meat mixture with reduced ratio of buffalo, beef, goat, sheep The PCR was successfully applied to detect buffalo meat in mixtures having been processed at 80oC/15’, 120oC/15’, 130oC/15’, 180oC/15’ but was not in the case of meat mixtures that had ≤ 10% buffalo meat and had been heated at 120oC/30’ and 130oC/30’ PCR protocol for detection of beef (cattle-PCR) was set up The new set of primers for the PCR to detect beef were: forward primer, 5'-CTACACATCCGACAC AACAACAGC-3’, and reverse primer, 5'-TCAGTAGGTCTGCTACTAGGGC-3' The thermal process was as follows: 94oC/4' for initial denaturation, 35 cycles of denaturation at 94oC/1’, annealing at 54oC/45'', enlongation at 72oC/1’ and final extension at 72oC/5’ The cattle-PCR could detect cattle DNA with the concentration as low as 0.001 ng/μl The lowest rate of cattle DNA in the mixture reduced ratio of DNA from the raw meat of the buffalo, cattle, goat, sheep that cattle-PCR could detect was 0.05% The lowest rate of cattle meat that cattle-PCR could detect in the reduced ratio mixture of buffalo, goats, sheep meat was 0.1% This PCR protocol was successfully to detect beef in meat mixtures which was processed at 80oC/15', 180oC/15' but was not to identify the meat in those had ≤ 10% buffalo meat and had been processed at 120oC/15’, 120oC/30’, 130oC/15’, and 130oC/30’ viii MỤC LỤC CHƯƠNG TRANG Trang tựa Trang Chuẩn Y i LÝ LỊCH CÁ NHÂN .i LỜI CAM ĐOAN iii LỜI CẢM ƠN .iv TÓM TẮT v DANH SÁCH CÁC CHỮ VIẾT TẮT xiii DANH SÁCH CÁC HÌNH xv DANH SÁCH SƠ ĐỒ xvi DANH SÁCH CÁC BẢNG xvii Chương MỞ ĐẦU 1.1 Đặt vấn đề 1.2 Mục tiêu 1.3 Mục đích Chương TỔNG QUAN 2.1 Sơ lược thịt thịt chế biến 2.1.1 Giới thiệu sơ lược thịt 2.1.2 Giới thiệu sơ lược thịt chế biến 2.1.3 Tình hình gian lận thị trường thịt giới Việt Nam 2.1.3.1 Tình hình gian lận thị trường thịt tươi thịt chế biến giới 2.1.3.2 Tình hình gian lận thị trường thịt tươi thịt chế biến Việt Nam 2.2 Các phương pháp phát thịt 2.2.1 Phương pháp dựa vào protein 2.2.1.1 Phương pháp điện di 2.2.1.2 Phương pháp miễn dịch 2.2.1.3 Phương pháp sắc ký 2.2.2 Phương pháp dựa vào DNA 2.2.2.1 Phương pháp lai DNA 2.2.2.2 Phương pháp dựa vào PCR 11 2.3 Thiết kế primer 21 2.3.1 Tổng quan thiết kế primer 21 2.3.1.1 Giới thiệu 21 2.3.1.2 Các đặc điểm primer 21 2.3.1.3 Nguyên tắc chung thiết kế primer 23 2.3.2 FastPCR .24 2.4 DNA ty thể gen cytochrome b việc phát loài 24 2.4.1 DNA ty thể 24 2.4.2 Di truyền ty thể .28 2.4.3 Sử dụng gen cytochrome b để phát nguồn gốc loài sản phẩm thịt chế biến 28 ix TÀI LIỆU THAM KHẢO TIẾNG VIỆT Bùi Thị Cúc, 2006 Tình hình xuất nhập động vật sản phẩm động vật Cục Thú y Hồ Huỳnh Thùy Dương, 2002 Sinh học phân tử Nhà xuất Giáo dục Thành phố Hồ Chí Minh Hồ Thị Nguyệt Thu, 2003 Chế biến thịt Giáo trình học tập trường Đại học Nơng Lâm TP HCM Lương Quý Phương, 2006 Sản xuất kit tách chiết DNA kit PCR phát gen halothan heo Khóa luận tốt nghiệp kỹ sư công nghệ sinh học Trường Đại học Nông Lâm TP HCM Lưu Phúc Lợi, 2005 Bài giảng Sinh tin học Đại học Nông Lâm TPHCM Nguyễn Ngọc Tuân, Lê Thanh Hiền, 2004 Chế biến bảo quản thịt sữa Nhà xuất Nơng Nghiệp Tp Hồ Chí Minh, 163 trang Trịnh Thị Thanh Huyền, 2007 Phân biệt loại thịt heo, bò, cừu phương pháp multiplex PCR Khóa luận tốt nghiệp kỹ sư cơng nghệ sinh học Trường Đại học Nông Lâm TP HCM TIẾNG NƯỚC NGOÀI Alberts B., Bray D., Lewis J., Raf M., Roberts K and Watson J.D.,1994 Molecular Biology of the Cell (3rd ed.), Garland Publishing Inc, New York and London Arslan A., Ilhak O I Calicioglu M., 2006 Effect of method of cooking on dentification of heat processed beef using polymerase chain reaction (PCR) technique Meat Science 72: 326–330 10 Ashoor S H., Monte W G., Stiles P G., 1998 Liquid chromatographic identification of meats Journal of Association of Official Analytical Chemists 71:397–403 11 Behrens M., Untham., Brinkmann Y., Buchholz R., and Latus N.,1999 Identification of Animal Species in Heated and Complex Meat Products Using Species Specific PCR Reactions Fleischwirtsch 79: 97 – 100 78 12 Bellagamba F., Valfre F., Panseri S., & Moretti V M., 2003 Polymerase chain reaction-based analysis to detect terrestrial animal protein in fish meal Journal of Food Protection 66(4): 682–685 13 Beneke B and Hagen M., 1998 Applicability of PCR (Polymerase Chain Reaction) for the Detection of Animal Species in Heated Meat Products Fleischwirts 78: 1016 – 1019 14 Bogenhagen D., Clayton D.A., 1974 The number of mitochondrial deoxyribonucleic acid genomes in mouse L and human HeLa cells Journal of Biological Chemistry 249:7791 15 Borgo R., Souty Grosset C., Bouchon & Gomot D L., 1996 PCR-RFLP analysis of mitochondrial DNA for identification of quail meat species Journal of Food Science 61: 1–4 16 Bossier P., 1999 Authentication of seafood products by DNA pattern Journal Food Science 64:1899–1993 17 Brodmann P D., Moor D., 2003 Sensitive and semi quantitative TaqMan real time polymerase chain reaction systems for the detection of beef (Bos taurus) and the detection of the family mammalia in food and feed Meat Science 65:599–607 18 Brodmann P D., Nicholas G., Schaltenbrand P., Ilg E C., 2001 Identifying unknown game species: experience with nucleotide sequencing of the mitochondrial cytochrome b gene and a subsequent basic local alignment search tool search European Food Research and Technology 212:491– 496 19 Burgener M., Hubner P.,1998 Mitochondrial DNA enrichment for species identification and revolutionary analysis Z Lebensm Unters Forsch 207:261–263 20 Carnegie P R., Illic M Z., Etheridge M.O., Collins M G., 1983 Improved high performance liquid chromatographic method for analysis of histidine dipeptides anserine, camosine and balenine present in fresh meat Journal of Chromatography 261:153–157 21 Chikuni K., Tabata T., Kosugiyama M., Monma M and Saito M., 1994 Polymerase Chain Reaction Assay for Detection of Sheep and Goat Meats Meat Science 37: 337 – 345 79 22 Chow S., Inogue S., 1993 Intra- and Interspecifc Restriction Fragment Length Polymorphism in Mitochondrial Genes of Thun- nus Tuna Species National Research Institute of Far Seas Fisheries 30: 207-224 23 Chung G.S., Lee M H., Kim J M., Park J M., 1998 Differentiation the species of origin of meats on the basis of the contents of histidine dipeptides in muscle Journal of Veterinary Science 40:1–6 24 Collins S.J., Lawson V A Masters C.L., 2004 Transmissible spongiform encephalopathies Lancet 363 (9402): 51–61 25 Colombo F., Viacava R., Giaretti M., 2000 Differentiation of the species ostrich (Struthio camelus) and emu (Dromaius novaehollandiae) by polymerase chain reaction using an ostrich-specific primer pair Meat Science 56:15–17 26 Cushwa W T., Medrano J F., 1996 Applications of the random amplified polymorphic DNA (RAPD) assay for genetic analysis of livestock species Animal Biotechnology 7:11–31 27 Dalmasso A., Fontanella E., Piatti P., Civera T., Rosati S., Bottero M.T., 2004 A multiplex PCR assay for the identification of animal species in feedstuffs Molecular and Cellular Probes 18: 81–87 28 Desmarais E., Lanneluc I., Lagne J., 1998 Direct amplification of length polymorphism (DALP) or how to get and characterize new genetic markers in many species Nucleic Acids Research 26:1458–1465 29 Ellen H., Hans T., Gottfried S., 1964 Deoxyribonucleic Acid Associated with Yeast Mitochondria Biochemical and Biophysical Research Communication 15: 127 - 132 30 Fairbrother K S., Hopwood A J., Lockley A K., Bardsley R G., 1998 Meat speciation by restriction fragment length polymorphism analysis using an actin cDNA probe Meat Science 50:105–114 31 Fairbrother K.S., Hopwood A.J., Lockley A.K and Bardsley R.G., 1998 The Actin Multigene Family and Livestock Speciation Using the Polymerase Chain Reaction Animal Biotechnology 9: 89 – 100 32 Fontaine K.M., Cooley J.R., Simon C., 2007 Evidence for paternal leakage in hybrid periodical cicadas (Hemiptera: Magicicada spp.) PloS one 2(9): e892 80 33 Fukall L., Kas J., 1989 The advantages of immunoassay in food analysis Trends in Analytical Chemistry 8: 112 – 116 34 Guoli Z., Mingguang Z., Zhijiang Z., Hongsheng O., Qiang L., 1999 Establishment and application of a polymerase chain reaction for the identification of beef Meat Science 51:233–236 35 Gyllesten, U B., Wharton, D., Josefsson, A and Wilson, A C., 1991 Paternal inheritance of mitochodrial DNA in mice Nature 352: 255-257 36 Haushi S., Basumatary R., Girish P S., Doley S., Bardoloi R K., Kumar A., 2009 Identification of chicken, duck, pigeon and pig meat by speciesspecific markers of mitochondrial origin Meat science Article in Press 37 Hayashi K., 1996 PCR SSCP Single Strand Conformation Polymorphism Analysis of PCR Products Laboratory Proto- cols for Mutation Detection (Landegren, U., ed.), Oxford University Press pp 14 – 22 38 Herman L., 2000 Determination of the animal origin of raw food by speciesspecific PCR Journal of Dairy Research 68:429–436 39 Hird H., J., Chisholm A.,Sanchez M., Hernandez R., Goodier K., Schneede C., Boltz and Popping B., 2006 Effect of heat and pressure processing on DNA fragmentation and implications for the detection of meat using a realtime polymerase chain reaction Food Additives and Contaminants 23:645–650 40 Hitchcock C H S., 1998 Immunoassays for veterinary and food analysis Elsevier Applied Science Publishers Ltd., London, New York, p3 41 Hoeh W.R., Blakley K.H., Brown W.M., 1991 Heteroplasmy suggests limited biparental inheritance of Mytilus mitochondrial DNA Science 251:1488– 1490 42 Hofmann K., 1997 Nachweis der Tierart bei Fleisch und Fleischerzeugnissen Mitteilung Fleischwirtschaft 77 (2):151-154 In: Detection of meat of different animal species in meat products P Review of applicable methods Mieso i Wedliny 1998, 3, 74-79 [in Polish] 43 Holland P M., Abramson R D., Watson R., Gelfand D H., 1991 Detection of specific polymerase chain reaction product by utilization the 5_ to 3_ exonuclease activity of Thermus aquaticus Proceedings of the National Academy of Sciences USA 88:7276–7280 81 44 Hong W., Gao D B., Zhang A H., Pan W Q., Lian, C Z L., 2004 Multiplex Polymerase Chain Reaction Method for Detection of Bovine Materials in Foodstuffs Journal of Association of Official Analytical Chemists International 86(4): 764-767 45 Hopwood A.J., Fairbrother K.S., Lockley A.K and Bardsley R.G., 1999 An Actin Gene-Related Polymerase Chain Reaction (PCR) Test for Identification of Chicken in Meat Mixtures Meat Science 53: 227 – 231 46 Hsieh H.M., Chiang H.L., Tsai L.C., Lai S.Y., Huang N.E., Linacre A., Lee J.C.I., 2001 Cytochrome b gene for species identification of the conservation animals Forensic Science International 122: 7-18 47 Hsing M H., Chin C T., Li C T., Hsiao L C., Nu E H., Rocky T P S., Adrian L., James C L., 2005 Species identification of meat products using the cytochrome b gene Forensic science Journal 4: 29-36 48 Hui Y H., 2006 Handbook of Food science technology and engineering CRC Press Taylor & Francis Group 49 Irfan O I., 2007 Identification of meat species by polymerase chain reaction (PCR) teachnique Turkish Journal of Veterinary and Animal Sciences 31(3): 159-163 50 Irwin D.M., Kocher T.D., Wilson A.C., 1991 Evolution of the cytochrome b gene of mammals Journal of Molecular Evolution 32: 128-44 51 Jain S., Brahmbhait M N., Rank D N., Joshi C G and Solank J V., 2007 Use of cytochrome b gene variability in detecting meat species by multiplex PCR assay Indian Journal of Animal Sciences 77 (9): 880-881 52 Kesmen Z., Sahin F., Yetim H., 2007 PCR assay for the identification of animal species in cooked sausages Meat Science 77: 649–653 53 Kocher T D., Thomas W K., Meyer A., Edwards S V., Paabo S., Villablanca F X., et al., 1989 Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing of conserved primers Proceedings of the National Academy Sciences of the United States of America 86: 6196-200 54 Koh M C., Lim C H., Chua S B., Chew S T., Phang S T W., 1998 Random amplified polymorphic DNA (RAPD) fingerprints for identification of red meat animal species Meat Science 48:275–285 82 55 Kondo R., Matsuura E.T., Chigusa S.I., 1992 Further observation of paternal transmission of Drosophila mitochondrial DNA by PCR selective amplification method Genetical Research 59 (2): 81–4) 56 Kremar P and Rencova E., 2003 Identification of species specific DNA in feedstuffs Journal of Agricultural and Food Chemistry 51(26): 76557658 57 Lahiff S., Glennon M., Lyng J., Smith T, Shilton N., Maher M., 2002 Real-time polymerase chain reaction detection of bovine DNA in meat and bone meal samples Journal of Food Protection 65:1158–1165 58 Laube L., Spiegelberg A., Butschke A., Zagon J., Schauzu M., Kroh L., Broll H., 2003 Methods for the detection of beef and pork in foods using real-time polymerase chain reaction International Journal of Food Science & Technology 38:111–118 59 Lee J.C.I and Chang J.G., 1994 Random Amplified Poly-morphic DNA Polymerase Chain Reaction (RAPD PCR) Finger-prints in Forensic Species Identification Forensic Science International 67: 103 – 107 60 Lockley A K., Bardsley R G., 2000 DNA-based methods for food authentication Trends in Food Science & Technology 11: 67 – 77 61 Maede, D., 2006 A strategy for molecular species detection in meat and meat products by PCR-RFLP and DNA sequencing using mitochondrial and chromosomal genetic sequences European Food Research and Technology 224(2): 209–217 62 Martin, I., Garcia T., Fajardo V., Lopez-Calleja I., Hernández P E., Gonzalez I., and Martín R 2007 Species-specific PCR for the identification of ruminant species in feedstuffs Meat Science 75:120–127 63 Martinez I., 1997 DNA typing of fish products for species identification In: Seafood from Product to Consumer: Integrated Approach to Quality J Luten, T Borresen, J Oehlenschlager (eds.) Amsterdam: Elsevier Science 497–506 64 Martinez I., Yman M., 1999 Species identification in meat products by RAPD analysis Food Research International 31:459–466 83 65 Matsunaga T., Chikuni K., Tanabe R., Muroya S., Shibata K., Yamad J., Shinmura Y., 1999 A quick and simple method for the identification of meat species cow meat product by PCR assay Meat Science 51: 143-148 66 McPherson M J and Moller S G., 2006 PCR Taylor and Francis Group 67 Meusel M.S., Moritz R.F., 1993 Transfer of paternal mitochondrial DNA during fertilization of honeybee (Apis mellifera L.) eggs Cureent Genetics 24 (6): 539–43) 68 Meyer R., Candrian U and Luethy J., 1994 Detection of Pork in Heated Meat Products by Polymerase Chain Reaction (PCR) Journal AOAC International 77: 617 – 622 69 Meyer R., Hoefelein C., Luethy J., & Candrian U., 1995 Polymerase chain reaction-restriction fragment length polymorphism analysis: a simple method for species identification in food Journal of Association of Official Analytical Chemists International 78: 1542–1551 70 Michael A I., David H G., 1990 PCR protocol: A guide to methods and application Academic Press, San Diego, CA p 3-12 71 Michele L., 2003 Food authenticity traceability Woodhead Publishing Limited Abington Hall, Abington Cambridge CB1 6AH England 72 Miguel A R., Teresa G., Isabel G., Luis A., Pablo E H and Rosario M., 2004 PCR identification of beef, sheep, goat and pork in raw and heat treated meat mixtures Journal of Food Protection 67: 172-77 73 Minkiewicz P., Dziuba J., Nałecz D., 2000 Modern methods of separation and research of peptides structure and proteins of food Przem Spo 12: 34-37 74 Montiel-Sosa J.F., Ruiz E., Montoya J., Roncales P., Lopez-Perez M.J., PerezMartos A., 2000 Direct and highly species-specific detection of pork meat and fat in meat products by PCR amplification of mitochondrial DNA Journal of Agricultural and Food Chemistry 48(7):2829-2832 75 Murray B W., McClymont R A., & Strobeck C., 1995 Forensic identification of ungulate species using restriction fragment digests of PCR amplified mitochondrial DNA Journal of Forensic Science 40: 943–951 76 Nass M.M., Nass S., 1963 Intramitochondrial Fibers with DNA characteristics Journal of Cell Biology 593–629 84 77 Partis L., Croan D., Guo Z., Clark R., Coldham T and Murby J.,2000 Evaluation of a DNA Fingerprinting Method for Determining the Species of Origin of Meats Meat Science 54: 369 – 376 78 Pascoal A., Prado M., Calo P., Cepeda A., & Barros-Velazquez J., 2005 Detection of bovine DNA in raw and heat-processed foodstuffs, commercial foods and specific risk materials by a novel specific polymerase chain reaction method European Food Research and Technology 220(3–4): 444–450 79 Penman & Danny, 2002 Mitochondria can be inherited from both parents NewScientist.com 5/2/2008 80 Pinto A D., Forte V.T., Conversano M.C., Tantillo G.M., 2005 Duplex polymerase chain reaction for detection of pork meat in horse meat fresh sausages from Italian retail sources Food Control 16: 391-394 81 Pyz L R., 1998 Methods of species identification of meat Med Wet 54 (11): 732-736 [in Polish] 82 Rahman A S M., Ahmed M M M., 2007 Rapid and sensitive identification of buffalo’s, cattle’s and sheep’s milk using species-specific PCR and PCR– RFLP techniques Food Control 18:1246–1249 83 Rea S., Chikuni K., Avellini P.,1996 Possibility of using single strand conformation polymorphism (SSCP) analysis for discriminating European pig and wild boar meat samples Italian Journal of Food Science 3:211– 220 84 Roa K.B.C.A., Bhat V and Totey S.M., 1996 Detection of Species-Specific Genetic Markers in Farm Animals Through Random Amplified Polymorphic DNA (RAPD) Genetic Analysis: Biomolecular Engineering 13: 135 – 138 85 Rodriguez M A., Garcia T., Gonzalez I., Asensio L., Mayoral B., Lopez-Calleja I., Hernandez P E., Martin R., 2003 Identification of goose, mule duck, turkey, and swine in foie grass by species-specific polymerase chain reaction Journal of agriculture and food chemistry 51:1524–1529 86 Saeed T., Ali S G., Rahman H A.A., Sawaya W N., 1989 Detection of pork and lard as adulterants in processed meat: Liquid chromatographic analysis of derivatized triglycerides Journal - Association of Official Analytical Chemists 72:921–925, 1989 85 87 Saez R., Sanz Y., Toldra F., 2004 PCR-based fingerprinting techniques for rapid detection of animal species in meat products Meat Science 66:659–665 88 Sambrook J., Russell W D., 2001 Molecular cloning (A laboratory manual) Cold Spring Harbor laboratory press, New York, USA 89 Sawyer M., Rensen G., Smith W., Yee M., Wong A., Osburn B., Cullor J., 1997 Overcoming RNA inhibition in the fluorescent polymerse chain reaction assay to enhance detection of bovine DNA in cattle feeds Department of Population Health and Reproduction, School of Veterinary Medicine, University of California 90 Sutovsky, P., et al, 1999 Ubiquitin tag for sperm mitochondria Nature 402: 371–372 91 Tajima K., Enishi O., Amari M., Mitsumori M., Kajikawa H., Kurihara M., Yanai S., Matsui H., Yasue H., Mitsuhashi T., Kawashima T., Matsumoto M., 2002 PCR detection of DNAs of animal origin in feed by primers based on sequences of short and long interspersed repetitive elements Bioscience, Biotechnology, and Biochemistry 66(10):2247–2250 92 Tartaglia M., Saulle E., Pestalozza S., Morelli L., Antonucci G., Battaglia P., 1998 Detection of bovine mitochondrial DNA in ruminant feeds: A molecular approach to test for the presence of bovine-derived materials Journal of Food Protection 61:513–518 93 Too H P., 2001 Demystifying the new genetics Molecular aspects of biomedical sciences Biochemistry Department Faculty of medicine National University of Singapore 244 pages 94 Toorop R M., Murch S J., Ball R O., 1997 Development of a rapid and accurate method for separation and quantification of myofibrillar proteins in meat Food Research International 30:619–627 95 Verbeke R., Brabander H D., 1985 Differentiation of meat species in processed meat products through identification of animal fat species Biochemical Identification of Meat Species R L S Patterson (ed.) New York: Elsevier Science Publishing, Inc pp 145–154 96 Wallace R.B., Shaffer J., Murphy R.F., Bonner J., Hirose T., Itakura K., 1979 Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch Nucleic Acids Research 6: 35433557 86 97 Wayne R.K., Geffen E., Girman D.J., Koepfli K.P., Lau L.M., Marshall C.R., 1997 Molecular systematics of the Canidae Syst Biol 46(4):622-53 98 Weighardt F., 2004 The analysis of food samples for the presence of genetically modified organisms Session 10 “Quantitative PCR for the detection of GMOs” European Commission Joint Research Centre 19 pages 99 Wiesner R.J., Ruegg J.C., Morano I., 1992 Counting target molecules by exponential polymerase chain reaction, copy number of mitochondrial DNA in rat tissues Biochimistry Biophysica Acta 183: 553–559 100 Wolf C., Rentsch J and Huebner P., 1999 PCR-RFLP Analysis of Mitochondrial DNA: A Reliable Method for Species Identification Journal of Agricultural and Food Chemistry 47:1350 – 1355 101 Zouros E., Freeman K R., Ball A O and Pogson G H., 1992 Direct evidence for extensive paternal mitochondrial DNA inheritance in the marine mussel Mytilus Nature 359: 412-414 TRANG WEB 102 http://archive.food.gov.uk 103 http://www.cucthuy.gov.vn/index.php?option=com_content&task=view&id=182 &Itemid=65 104 http://www.ncbi.nlm.nih.gov 105 http://align.genome.jp 106 http://www.thuvienkhoahoc.com 107 http://www.mitomap.org/MITOMAP/mitomapgenome 108 Protocol online: http://www.protocol-online.org/prot/Molecular-Biology/PCR/ Multiplex- PCR 109 http://www.vcn.vnn.vn/PrintPreview.aspx?ID=4227 110 Octavian, 1997 Troubleshooting for PCR and multiplex (http://info.med.yale.edu/genetics/ward/tavi/Trblesht.html) 111 http://www.biocenter.helsinki.fi/bi/Programs/download.htm 112 http://www.biocenter.helsinki.fi/bi/Programs/manual.htm 87 PCR PHỤ LỤC VỊ TRÍ CÁC PRIMER THIẾT KẾ Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ ATGACCAACATCCGAAAATCCCACCCACTAATAAAAATTCTAAACAATGC ATGACTAACATTCGAAAGTCCCACCCACTAATAAAAATTGTAAACAATGC ***** ***** *****.********************* ********** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ ATTCATTGACCTCCCTGCTCCATCAAACATCTCATCATGATGAAACTTTG 100 ATTCATCGACCTTCCAGCCCCATCAAACATTTCATCATGATGAAATTTCG ****** ***** **:** *********** ************** ** * Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GCTCTCTCCTAGGCATCTGCCTAATCCTGCAAATCCTCACCGGCCTATTC GTTCCCTCCTGGGAATCTGCCTAATCCTACAAATCCTCACAGGCCTATTC * ** *****.**.**************.***********.********* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ F2 CTAGCAATACACTACACATCCGACACAACAACAGCATTCTCCTCCGTCGC 200 CTAGCAATACACTACACATCCGACACAACAACAGCATTCTCCTCTGTTAC ******************************************** ** * Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CCACATCTGCCGGGACGTGAACTATGGATGAATTATTCGATACATACACG CCATATCTGCCGAGACGTGAACTACGGCTGAATCATCCGATACATACACG *** ********.*********** **.***** ** ************* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CAAACGGAGCTTCAATATTTTTCATCTGCTTATATATACACGTAGGACGA 300 CAAACGGAGCTTCAATGTTTTTTATCTGCTTATATATGCACGTAGGACGA ****************.***** **************.************ Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GGCATATACTACGGATCATATACCTTTCTAGAAACATGAAACATCGGAGT GGCTTATATTACGGGTCTTACACTTTTCTAGAAACATGAAATATTGGAGT ***:**** *****.**:** ** ***************** ** ***** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ F1 AATCCTACTATTCGCAGTAATAGCCACAGCATTTATAGGATACGTACTGC 400 AATCCTTCTGCTCACAGTAATAGCCACAGCATTTATAGGATACGTCCTAC ******:** **.*******************************.**.* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ cggcacaaatttagtcgaatgaatctgag Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CATGAGGACAAATATCATTCTGAGGGGCAACAGTCATCACCAACCTTCTC CATGAGGACAAATATCATTCTGAGGAGCAACAGTCATCACCAACCTCTTA *************************.******************** * TCAGCAATCCCATACATTGGTACAAGTCTGGTTGAATGAATTTGAGGGGG 500 RC1 TCAGCAATCCCATACATCGGCACAAATTTAGTCGAATGAATCTGAGGCGG ***************** ** ****.* *.** ******** ***** ** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ ATTCTCAGTAGACAAAGCAACCCTCACCCGATTCTTCGCATTTCACTTCA ATTCTCAGTAGACAAAGCAACCCTTACCCGATTCTTCGCTTTCCATTTTA ************************ **************:** ** ** * Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ TCCTCCCATTCATTATCGCAGCACTTGCAATAGTCCACCTATTATTTCTC 600 TCCTTCCATTCATCATCATAGCAATTGCCATAGTCCACCTACTATTCCTC **** ******** *** ****.****.************ **** *** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CACGAAACAGGATCCAACAACCCAACAGGAATCTCATCAGACACAGACAA CACGAAACAGGCTCCAACAACCCAACAGGAATTTCCTCAGACGTAGACAA ***********.******************** **.****** ****** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ AATCCCATTCCACCCCTATTACACCATTAAAGACATCCTAGGCGCCCTAC 700 AATCCCATTCCACCCCTACTATACCATTAAGGACATCTTAGGGGCCCTCT ****************** ** ********.****** **** ***** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ TATTAATCCTAGCCCTAATACTATTAGTACTATTCGCACCCGACCTCCTC TACTAATTCTAGCTCTAATACTACTAGTACTATTCGCACCCGACCTCCTC ** **** ***** ********* ************************** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GGGGACCCAGACAACTACACCCCAGCAAACCCACTCAACACACCTCCCCA 800 GGAGACCCAGATAACTACACCCCAGCCAATCCACTCAACACACCCCCTCA **.******** **************.** ************** ** ** Trau-gi|1813366|dbj|D82894.1|_RBU1 Bo-gi|58489534|gb|AY885304.1|_ CATCAAGCCTGAATGGTACTTCCTATTCGCATACGCAATCTTACGATCAA CATCAAACCCGAGTGATACTTCTTATTTGCATACGCAATCTTACGATCAA ******.** **.**.****** **** ********************** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ TTCCTAACAAACTAGGAGGGGTTCTAGCCCTAGTTCTCTCTATCCTAATC 900 TCCCCAACAAACTAGGAGGAGTACTAGCCCTAGCCTTCTCTATCCTAATT * ** **************.**:********** ************* CTCATTCTCATGCCCCTGCTACATACATCCAAACAACGAAGTATGATGTT Trau-gi|1813366|dbj|D82894.1| RBU2 88 Bo-gi|58489534|gb|AY885304.1|_ Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CTTGCTCTAATCCCCCTACTACACACCTCCAAACAACGAAGCATAATATT ** ***.** *****.***** **.************** **.**.** CCGGCCATTCAGCCAATGCCTATTCTGAATTCTAGTAGCAAACCTGCTAA 1000 RC2 CCGACCACTCAGCCAATGCCTATTCTGAGCCCTAGTAGCAGACCTACTGA ***.*** ******************** *********.****.**.* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CACTCACATGGATTGGAGGACAGCCAGTCGAACACCCATATATTATCATT CACTCACATGAATTGGAGGACAACCAGTCGAACACCCATATATCACCATC **********.***********.******************** * *** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GGACAACTAGCATCTATCACATACTTCCTCCTCATCCTAGTGCTAATACC GGACAACTAGCATCTGTCCTATACTTTCTCCTCATCCTAGTGCTAATACC ***************.** ****** *********************** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ AACGGCCAGCATAATCGAAAATAATCTCTTAAAATGAAGA AACGGCCGGCACAATCGAAAACAAATTACTAAAATGAAGA *******.*** ********* **: * *********** 89 PHỤ LỤC KẾT QUẢ M-PCR VỚI CÁC NHÓM TỶ LỆ PHỐI TRỘN Tỷ lệ phát (%) 120 100 80 60 40 20 N1 M2.1 M3.1 M4.1 M5.1 M6.1 M7.1 Không xử 80oC/15' 120oC/15' 120oC/30' 130oC/15' 130oC/30' 180oC/15' lý nhiệt Nhiệt độ thời gian xử lý (a) Nhóm 1: tỷ lệ phối trộn (30:30:10:10:10:10) Tỷ lệ phát (%) 120 100 80 60 40 20 N2 M2.2 Không xử lý nhiệt 80oC/15' M3.2 M4.2 M5.2 M6.2 M7.2 120oC/15' 120oC/30' 130oC/15' 130oC/30' 180oC/15' Nhiệt độ thời gian xử lý (b) Nhóm 2: tỷ lệ phối trộn (40:40:5:5:5:5) Tỷ lệ phát (%) 120 100 80 60 40 20 N3 M2.3 Không xử 80oC/15' lý nhiệt M3.3 M4.3 M5.3 M6.3 M7.3 120oC/15' 120oC/30' 130oC/15' 130oC/30' 180oC/15' Nhiệt độ thời gian xử lý (c) Nhóm 3: tỷ lệ phối trộn (48:48:1:1:1:1) 90 Tỷ lệ phát (%) 90 80 70 60 50 40 30 20 10 N4 M2.4 Không xử lý nhiệt 80oC/15' M3.4 M4.4 M5.4 M6.4 M7.4 120oC/15' 120oC/30' 130oC/15' 130oC/30' 180oC/15' Thời gian nhiệt độ xử lý Tỷ lệ phát (%) (d) Nhóm 4: tỷ lệ phối trộn (49:49:0,5:0,5:0,5:0,5) 90 80 70 60 50 40 30 20 10 N5 M2.5 M3.5 M4.5 M5.5 M6.5 M7.5 Không xử 80oC/15' 120oC/15'120oC/30'130oC/15'130oC/30'180oC/15' lý nhiệt Nhiệt độ thời gian xử lý (e) Nhóm 5: tỷ lệ phối trộn (49,8:49,8:0,1:0,1:0,1:0,1) Tỷ lệ phát (%) 70 60 50 40 30 20 10 N6 M2.6 M3.6 M4.6 M5.6 M6.6 M7.6 Không xử 80oC/15' 120oC/15' 120oC/30' 130oC/15' 130oC/30' 180oC/15' lý nhiệt Nhiệt độ thời gian xử lý (f) Nhóm 6: tỷ lệ phối trộn (49,9:49,9:0,05:0,05:0,05:0,05) 91 Tỷ lệ phát (%) 70 60 50 40 30 20 10 N7 M2.7 M3.7 M4.7 M5.7 M6.7 M7.7 Không xử 80oC/15' 120oC/15' 120oC/30' 130oC/15' 130oC/30' 180oC/15' lý nhiệt Nhiệt độ thời gian xử lý (g) Nhóm 7: tỷ lệ phối trộn (49,94:49,94:0,03:0,03:0,03:0,03) Biểu đồ: Tỷ lệ phát m-PCR nhóm tỷ lệ phối trộn khơng xử lý nhiệt xử lý nhiệt (a) Nhóm 1: tỷ lệ phối trộn (30:30:10:10:10:10) (b) Nhóm 2: tỷ lệ phối trộn (40:40:5:5:5:5) (c) Nhóm 3: tỷ lệ phối trộn (48:48:1:1:1:1) (d) Nhóm 4: tỷ lệ phối trộn (49:49:0,5:0,5:0,5:0,5) (e) Nhóm 5: tỷ lệ phối trộn (49,8:49,8:0,1:0,1:0,1:0,1) (f) Nhóm 6: tỷ lệ phối trộn (49,9:49,9:0,05:0,05:0,05:0,05) (g) Nhóm 7: tỷ lệ phối trộn (49,94:49,94:0,03:0,03:0,03:0,03) 92 ... ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH ….W U X… ĐỒN THỊ TUYẾT LÊ PHÂN BIỆT CÁC LOẠI THỊT HEO, GÀ, TRÂU, BÒ, DÊ, CỪU BẰNG KỸ THUẬT PCR Chuyên ngành : Công Nghệ Sinh Học Mã số : 60.42.80 LUẬN VĂN THẠC SĨ... quy trình PCR- bị phát thịt bị 3.2.3 Ứng dụng quy trình m -PCR, PCR- trâu PCR- bò Khảo sát m -PCR, PCR- trâu PCR- bò việc phát loại thịt heo, gà, trâu, bò, dê, cừu hỗn hợp DNA từ thịt tươi, thịt chế... 4.7.1.4 M -PCR phát thịt heo, gà, trâu/ &bò, dê, cừu hỗn hợp thịt xử lý nhiệt 60 a Kết phát thịt heo, gà, trâu/ &bò, dê, cừu hỗn hợp thịt xử lý 61 b Kết so sánh m -PCR với thịt