COMPARATIVE GENETIC ANALYSIS OF THE TRANSCRIPTIONAL REGULATORY DNA OF THE OXYTOCIN AND VASOPRESSIN GENES Patrick Gilligan (M.Sc. University of Waikato) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY INSTITUTE OF MOLECULAR AND CELL BIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2004 Nothing in biology makes sense except in the light of evolution. Theodosius Dobzhansky The American Biology Teacher, 35:125-129 ii Acknowledgements I thank: Firstly, my supervisor Byrappa Venkatesh. Past and present members of the Marine Molecular Genomics lab, including Tay Boon Hui (who helped with cloning and other stuff), Michael Richardson, Choong Po Loong, Meng Hwee, Diane Tan, Goh Boon Young, Eugene Kroll, Hawys, Alan Christoffels, Esther Koh, variously for help and making the lab a good place to work. Roland Degenkolbe, for copious discussions, biochemical advice, style editing and general generously provided opinions. Sathivel Poniah for a great deal of excellent advice. Members of several core facilities, including: from the mouse house, Esther Wong who taught me mouse transgenesis, Nachia, Arun, Din, Florida, Jean; from histology, Yong Tan Foong, who taught me basic histology and Gou Ke who provided lots of help, Li Jia. Members of my supervisory committee: Hans-Ulrich Bernard (who kept suggesting I some gel-shifts somewhere along the line), Wang Yue and Sydney Brenner. The Institute of Molecular and Cell Biology funded this research. Lastly I would like to thank my wife Joanna, without whom I probably wouldn’t have begun the doctorate, whose idea it was to come to Singapore in the first place, and who encouraged me through the thesis. iii TABLE OF CONTENTS Acknowledgements . iii TABLE OF CONTENTS iv List of Figures . viii List of Tables x Abbreviations and Acronyms xi List of publications xiii Summary . xiv Chapter Introduction 1.1 Oxytocin and vasopressin peptides 1.1.1 Neuroanatomy of oxytocin and vasopressin neurosecretory neurons . 1.1.2 Oxytocin and vasopressin receptors 1.1.3 Evolution of the oxytocin and vasopressin neurons 1.2 Structure of oxytocin and vasopressin related genes . 1.3 Regulatory DNA 12 1.3.1 Definitions related to regulatory DNA 12 1.3.2 Enhancers 12 1.3.3 Identification and characterization of enhancers . 14 1.3.3.1 Biochemical approach . 14 1.3.3.2 Genetic approach 16 1.3.3.3 Sequence comparison 17 1.4 Previous work on oxytocin and vasopressin gene expression . 18 1.4.1 Expression studies in transgenics 19 1.4.1.1 Oxytocin transgenes 21 1.4.1.2 Vasopressin transgenes . 21 1.4.2 Expression studies in explants . 23 1.4.3 Expression studies in lung cancer cells . 25 1.4.4 Summary of previous work on oxytocin-vasopressin regulation 27 1.5 Objectives of the present study 30 Materials and Methods 33 2.1 Isolation and sequencing of cosmid 197K21 . 33 2.2 Generation of transgenic mice . 33 2.2.1 Transgene constructs . 34 iv 2.2.2 Preparation of DNA for microinjection . 34 2.2.3 Embryo culture media . 35 2.2.4 Microinjection . 36 2.2.5 Genotyping 39 2.2.6 Transferring DNA. 40 2.2.7 Labeling the probe . 41 2.2.8 Hybridization . 42 2.3 Northern hybridization 42 2.3.1 Extracting total RNA from tissues 42 2.3.2 Fractionation of total RNA 43 2.4 In Situ Hybridization. . 44 2.4.1 Mounting and sectioning tissues. 44 2.4.2 Labeling oligo probes for in situ hybridization . 44 2.4.3 Fixing tissue sections for in situ hybridisation 46 2.4.4 Hybridisation, washing, and visualisation . 47 2.5 Electrophoretic Mobility-shift Assay 50 2.5.1 Nuclear extracts . 50 2.5.2 Radiolabelling probes 51 2.5.3 Cold oligo for competition: . 52 2.5.4 Gel Shifts . 52 2.6 Computer programs and databases 53 2.6.1 Gene prediction . 53 2.6.2 Sequence alignments . 53 Chapter 3. Results: Extension and annotation of Fugu isotocin/vasotocin contig 56 3.1 Extension of the isotocin-vasotocin locus sequence . 57 3.2 Annotation of the Fugu isotocin-vasotocin locus 57 3.2.1 Novel gene predictions 59 3.2.2 Compact and overlapping Fugu promoters . 66 3.3 Conservation of contiguity between the Fugu and human loci 67 3.4 Conserved non-coding sequences 68 v Chapter 4. Results: Expression of Fugu isotocin and vasotocin genes in transgenic mice . 72 4.1 Introduction . 72 4.2 Transgenic mice carrying Fugu cosmids 73 4.3 Transgenic mice with isotocin- and vasotocin-subclones 76 4.3.1 Expression from isotocin-subclone 76 4.3.2 Salt-loading and isotocin expression . 78 4.3.3 Expression from the vasotocin-subclone . 80 4.3.4 Vasotocin expression and salt-loading 82 4.4 Discussion . 82 4.4.1 Possible mosaic expression of isotocin in oxytocin neurons 83 4.4.2 Oxytocin expression detected in Vasopressin neurons . 84 4.4.3 Vasotocin gene insensitivity to salt-loading in mice . 85 4.4.4 Sequence similarity between Fugu and mouse orthologues 86 Chapter 5. Results: Detection of regulatory DNA – Theoretical considerations . 89 5.1 Conservation of regulatory information . 89 5.1.1 Conservation of regulatory DNA 89 5.1.2 The short sequence matches are probably not informative . 90 5.1.3 Comparing mouse and human non-coding sequences 90 5.2 How can sequence not be conserved while function is? 94 5.3 Where is the oxytocin CRM? . 98 5.3.1 Transgenic evidence for the oxytocin CRM 99 5.3.2 Sequence alignment evidence for the oxytocin CRM . 102 5.3.3 Explant transfection evidence for the oxytocin CRM . 103 5.4 Summary 104 Chapter 6. Results: Gel-shift analysis of oxytocin CRM . 107 6.1 Introduction . 107 6.1.2 Gel-shifts to identify TFBSs 107 6.1.3 The nuclear extracts . 109 6.2 The initial screen . 110 6.2.2 Shift C 113 vi 6.2.2.1 Binding site C present in both mouse and human oxytocin CRMs 113 6.2.2.2 TF C is Sp1-like 114 6.2.2.3 An anti-Sp1 antibody super-shifts Shift C 116 6.2.2.4 The weak Sp1-like sites in the mouse CRM might be cooperative 116 6.2.3 Shift A . 118 6.2.3.1 Shift A reveals the same binding site on h15 and m19 . 118 6.2.3.2 Factor A binds a long, G-rich sequence 120 6.2.4 Shift D . 121 6.2.4.1 Site D is present in mouse and human presumed CRMs 121 6.2.5 Shift B 122 6.2.5.1 TFBS B is present in the mouse and human CRMs 123 6.3 Derived maps . 125 6.4 Discussion . 130 6.4.1 Evidence for the TFBSs being functional . 130 6.4.2 Validation of identified TFBSs . 131 6.4.3 These gel-shifts and previous in silico work . 132 6.4.3 TFBS turnover . 133 6.5 Outlook . 134 6.5.1 Limitations of the protocol 135 6.5.2 And on to syntax… 136 References 137 Appendix . 148 Appendix II 149 Appendix III 151 Appendix IV 156 vii List of Figures 1.1 Schematic diagram of mouse brain 1.2 Schematic diagram of the mouse oxytocin/vasopressin locus 10 1.3 Expression patterns of oxytocin transgenes 20 1.4 Expression patterns of vasopressin transgenes 22 1.5 Oxytocin constructs transfected into hypothalamic slice explants 24 1.6 Vasopressin constructs transfected into hypothalamic slice explants 25 1.7 “The intergenic region” hypothesis 28 3.1 Schematic diagram of the Fugu isotocin-vasotocin locus 56 3.2 Alignment of the Fugu ZF1 protein with its human ortholog 60 3.3 Alignment of the Fugu ZF2 protein with its human ortholog 61 3.4 Expression patterns of the Fugu ZF1, CL1, ZF2, PK, IHABP and PG1 genes analysed by RT–PCR 62 3.5 Alignment of the novel Fugu PG1 protein with its human ortholog 3.6 Amino acid alignment of Fugu chemokine gene CL1 with human CCL28 and zebrafish CCL1 64 3.7 Alignment of the Fugu PK (fPK) and its closest human protein, HIPK2 65 3.8 Conserved ZF1 and ZF2 non-coding sequences 67 3.9 Conserved contiguity between Fugu isotocin contig and human orthologous fragments 69 4.1 Schematic diagram of the Fugu isotocin/vasotocin locus 72 4.2 Northern analysis of vasotocin expression in cosmid transgenics 74 4.3 In situ detection of isotocin mRNA in 155F06 transgenic 63 following 74 viii 4.4 Representative photomicrographs of SON from transgenic mice bearing Fugu cosmids 75 4.5 Double in situ detection of isotocin and oxytocin or isotocin and vasopressin transcripts in transgenic mice bearing a 5-kb isotocin transgene 77 4.6 Higher-expressing lines not have higher transgene copy-number 4.7 Expression of both isotocin and oxytocin is increased in response to salt loading, in both the SON and PVN 80 4.8 Double in situ detection of vasotocin and vasopressin or vasotocin and oxytocin transcripts in transgenic mice bearing a 9-kb vasotocin transgene 81 4.9 Vasotocin expression does not respond to salt loading in transgenic mice 5.1 The alignment of sequences 3’ of the mouse and human oxytocin polyA signals 92 5.2 The alignment of sequence 3’ of the mouse and human vasopressin polyA signals 93 5.3 Apparent “blocks” of contiguous nucleotide identity in a human/mouse oxytocin non-coding alignment break down in multi-species comparisons 94 5.4 Hypotesised location of the oxytocin and vasopressin CRMs 99 5.5 Evidence for a downstream oxytocin enhancer 101 5.6 Each gene likely has two enhancers 103 6.1 Initial screen 112 6.2 Shift C is shared between the mouse and human sequences 114 6.3 Weak, adjacent Sp1-like sites identified by tiling oligos 117 6.4 Shift A is present in both mouse and human regions 119 6.5 Shift D is present in both human and mouse sequences 122 6.6 Mouse (aligned with rat) and human oligos containing site D 123 6.7 Mapping of TFBS D on h16 78 82 124 ix 6.8 Shift B is present in both the human and mouse sequences 126 6.9 Inferred maps of the TFBSs in the presumed CRMs of human and mouse oxytocin 127 6.10 A partial TFBS map plus BLASTZ alignment of the human and mouse oxytocin CRM 129 6.11 Comparison of TFBS map with MEME/MAST results 132 6.12 Conservation of regulatory DNA between mouse and human in the HoxA and βglobin loci following 134 List of Tables 1.1 Oxytocin and related peptides 4.1 79 Relative copy and expression level of different transgenic lines x Jeong, S. W., Castel, M., Zhang, B. J., Fields, R. L., Paras, P., Arnheiter, H., Chin, H., and Gainer, H. Cell-specific expression and subcellular localization of neurophysinCAT-fusion proteins expressed from oxytocin and vasopressin gene promoter-driven constructs in transgenic mice. Exp Neurol 2001 Oct ;171 (2 ):255 -71 171, 255-271. Kaczynski, J., Cook, T., and Urrutia, R. (2003) Sp1- and Kruppel-like transcription factors. Genome Biol 4, 206. Kammandel, B., Chowdhury, K., Stoykova, A., Aparicio, S., Brenner, S., and Gruss, P. (1999) Distinct cis-essential modules direct the time-space pattern of the Pax6 gene activity. Dev Biol 205, 79-97. Kanda, A., Takuwa-Kuroda, K., Iwakoshi-Ukena, E., and Minakata, H. (2003) Single exon structures of the oxytocin/vasopressin superfamily peptides of octopus. Biochem Biophys Res Commun 309, 743-748. Karpen, G. H. (1994) Position-effect variegation and the new biology of heterochromatin. Curr Opin Genet Dev 4, 281-291. Kelner, G. S., Kennedy, J., Bacon, K. B., Kleyensteuber, S., Largaespada, D. A., Jenkins, N. A., Copeland, N. G., Bazan, J. F., Moore, K. W., Schall, T. J., and . (1994) Lymphotactin: a cytokine that represents a new class of chemokine. Science 266, 13951399. Kim, Y. H., Choi, C. Y., Lee, S. J., Conti, M. A., and Kim, Y. (1998) Homeodomaininteracting protein kinases, a novel family of co-repressors for homeodomain transcription factors. J Biol Chem 273, 25875-25879. Kimura, C., Takeda, N., Suzuki, M., Oshimura, M., Aizawa, S., and Matsuo, I. (1997) Cis-acting elements conserved between mouse and pufferfish Otx2 genes govern the expression in mesencephalic neural crest cells. Development 124, 3929-3941. Kimura, M. (1981) Possibility of extensive neutral evolution under stabilizing selectionwith special reference to non-random usage of synonymous codons. Proc. Natl Acad Sci. USA 78, 5773-5777. Kimura, M. (1983) The Neutral Theory of Molecular Evolution (Cambridge Univ. Press, Cambridge). Kimura, T., Tanizawa, O., Mori, K., Brownstein, M. J., and Okayama, H. (1992) Structure and expression of a human oxytocin receptor. Nature 356, 526-529. Kioussis, D. and Festenstein, R. (1997) Locus control regions: overcoming heterochromatin-induced gene inactivation in mammals. Curr Opin Genet Dev 7, 614619. Langeland, J. A. and Carroll, S. B. (1993) Conservation of regulatory elements controlling hairy pair-rule stripe formation. Development 117, 585-596. 141 Liao, E. C., Paw, B. H., Oates, A. C., Pratt, S. J., Postlethwait, J. H., and Zon, L. I. (1998) SCL/Tal-1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish. Genes Dev 12, 621-626. Lightman, S. L. and Young, W. S., III (1987) Vasopressin, oxytocin, dynorphin, enkephalin and corticotrophin-releasing factor mRNA stimulation in the rat. J Physiol 394:23-39., 23-39. Lolait, S. J., O'Carroll, A. M., McBride, O. W., Konig, M., Morel, A., and Brownstein, M. J. (1992) Cloning and characterization of a vasopressin V2 receptor and possible link to nephrogenic diabetes insipidus. Nature 357, 336-339. Ludwig, M. Z., Bergman, C., Patel, N. H., and Kreitman, M. (2000) Evidence for stabilizing selection in a eukaryotic enhancer element. Nature 403, 564-567. Ludwig, M. Z., Patel, N. H., and Kreitman, M. (1998) Functional analysis of eve stripe enhancer evolution in Drosophila: rules governing conservation and change. Development 125, 949-958. Maier, D., Preiss, A., and Powell, J. R. (1990) Regulation of the segmentation gene fushi tarazu has been functionally conserved in Drosophila. EMBO J 9, 3957-3966. Mastrangelo, I. A., Courey, A. J., Wall, J. S., Jackson, S. P., and Hough, P. V. (1991) DNA looping and Sp1 multimer links: a mechanism for transcriptional synergism and enhancement. Proc Natl Acad Sci U S A 88, 5670-5674. Merika, M. and Thanos, D. (2001) Enhanceosomes. Curr Opin Genet Dev 11, 205-208. Mezey, E. and Kiss, J. Z. (1991) Coexpression of vasopressin and oxytocin in hypothalamic supraoptic neurons of lactating rats. Endocrinology 129, 1814-1820. Morel, A., O'Carroll, A. M., Brownstein, M. J., and Lolait, S. J. (1992) Molecular cloning and expression of a rat V1a arginine vasopressin receptor. Nature 356, 523-526. Murphy, D., Bishop, A., Rindi, G., Murphy, M. N., Stamp, G. W., Hanson, J., Polak, J. M., and Hogan, B. (1987) Mice transgenic for a vasopressin-SV40 hybrid oncogene develop tumors of the endocrine pancreas and the anterior pituitary. A possible model for human multiple endocrine neoplasia type 1. Am J Pathol 129, 552-566. Murphy, D. and Carter, D. A. (1993) Transgenic Techniques: Principals and Protocols. Humana Press, Ottawa, NJ. Murphy, D., Si-Hoe, S. L., Brenner, S., and Venkatesh, B. (1998) Something fishy in the rat brain: molecular genetics of the hypothalamo-neurohypophysial system. Bioessays 20, 741-749. Murphy, D. and Wells, S. (2003) In vivo gene transfer studies on the regulation and function of the vasopressin and oxytocin genes. J Neuroendocrinol 15, 109-125. 142 Nonchev, S., Vesque, C., Maconochie, M., Seitanidou, T., Ariza-McNaughton, L., Frain, M., Marshall, H., Sham, M. H., Krumlauf, R., and Charnay, P. (1996) Segmental expression of Hoxa-2 in the hindbrain is directly regulated by Krox-20. Development 122, 543-554. Ocejo-Garcia, M., Ahmed, S. I., Coulson, J. M., and Woll, P. J. (2001) Use of RT-PCR to detect co-expression of neuropeptides and their receptors in lung cancer. Lung Cancer 33, 1-9. Orkin, S. H. (1995) Regulation of globin gene expression in erythroid cells. Eur J Biochem 231, 271-281. Orloff, J. and Handler, J. (1967) The role of adenosine 3',5'-phosphate in the action of antidiuretic hormone. Am J Med 42, 757-768. Oumi, T., Ukena, K., Matsushima, O., Ikeda, T., Fujita, T., Minakata, H., and Nomoto, K. (1994) Annetocin: an oxytocin-related peptide isolated from the earthworm, Eisenia foetida. Biochem Biophys Res Commun 198, 393-399. Paldi, A., Deltour, L., and Jami, J. (1993) Cis effect of lacZ sequences in transgenic mice. Transgenic Res 2, 325-329. Pardy, K., Adan, R. A., Carter, D. A., Seah, V., Burbach, J. P., and Murphy, D. (1992) The identification of a cis-acting element involved in cyclic 3',5'-adenosine monophosphate regulation of bovine vasopressin gene expression. J Biol Chem 267, 21746-21752. Powell JR (1997) Progress and Prospects in Evolutionary Biology: The Drosophila Model. Oxford University Press: Oxford. Ratty, A. K., Jeong, S. W., Nagle, J. W., Chin, H., Gainer, H., Murphy, D., and Venkatesh, B. (1996) A systematic survey of the intergenic region between the murine oxytocin- and vasopressin-encoding genes. Gene 174, 71-78. Reich, G. (1992) A new peptide of the oxytocin/vasopressin family isolated from nerves of the cephalopod Octopus vulgaris. Neurosci Lett 134, 191-194. Rhodes, C. H., Morrell, J. I., and Pfaff, D. W. (1981) Immunohistochemical analysis of magnocellular elements in rat hypothalamus: distribution and numbers of cells containing neurophysin, oxytocin, and vasopressin. J Comp Neurol 198, 45-64. Roulet, E., Busso, S., Camargo, A. A., Simpson, A. J., Mermod, N., and Bucher, P. (2002) High-throughput SELEX SAGE method for quantitative modeling of transcription-factor binding sites. Nat Biotechnol 20, 831-835. Rozen, F., Russo, C., Banville, D., and Zingg, H. H. (1995) Structure, characterization, and expression of the rat oxytocin receptor gene. Proc Natl Acad Sci U S A 92, 200-204. 143 Russell, J. A. and Leng, G. (1998) Sex, parturition and motherhood without oxytocin? J Endocrinol 157, 343-359. Sanchez, M., Gottgens, B., Sinclair, A. M., Stanley, M., Begley, C. G., Hunter, S., and Green, A. R. (1999) An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors. Development 126, 3891-3904. Satake, H., Takuwa, K., Minakata, H., and Matsushima, O. (1999) Evidence for conservation of the vasopressin/oxytocin superfamily in Annelida. J Biol Chem 274, 5605-5611. Schmitz, E., Mohr, E., and Richter, D. (1991) Rat vasopressin and oxytocin genes are linked by a long interspersed repeated DNA element (LINE): sequence and transcriptional analysis of LINE. DNA Cell Biol 10, 81-91. Schwartz, S., Kent, W. J., Smit, A., Zhang, Z., Baertsch, R., Hardison, R. C., Haussler, D., and Miller, W. (2003) Human-mouse alignments with BLASTZ. Genome Res 13, 103-107. Schwartz, S., Zhang, Z., Frazer, K. A., Smit, A., Riemer, C., Bouck, J., Gibbs, R., Hardison, R., and Miller, W. (2000) PipMaker--a web server for aligning two genomic DNA sequences. Genome Res 10, 577-586. Sinclair, A. M., Gottgens, B., Barton, L. M., Stanley, M. L., Pardanaud, L., Klaine, M., Gering, M., Bahn, S., Sanchez, M., Bench, A. J., et al. (1999) Distinct 5' SCL enhancers direct transcription to developing brain, spinal cord, and endothelium: neural expression is mediated by GATA factor binding sites. Dev Biol 209, 128-142. Small, S., Blair, A., and Levine, M. (1992) Regulation of even-skipped stripe in the Drosophila embryo. EMBO J 11, 4047-4057. Small, S., Kraut, R., Hoey, T., Warrior, R., and Levine, M. (1991) Transcriptional regulation of a pair-rule stripe in Drosophila. Genes Dev 5, 827-839. Sofroniew, M. V. and Glasmann, W. (1981) Golgi-like immunoperoxidase staining of hypothalamic magnocellular neurons that contain vasopressin, oxytocin or neurophysin in the rat. Neuroscience 6, 619-643. Stanojevic, D., Hoey, T., and Levine, M. (1989) Sequence-specific DNA-binding activities of the gap proteins encoded by hunchback and Kruppel in Drosophila. Nature 341, 331-335. Stanojevic, D., Small, S., and Levine, M. (1991) Regulation of a segmentation stripe by overlapping activators and repressors in the Drosophila embryo. Science 254, 1385-1387. Stone, J. R. and Wray, G. A. (2001) Rapid evolution of cis-regulatory sequences via local point mutations. Mol Biol Evol 18, 1764-1770. 144 Sugimoto, T., Saito, M., Mochizuki, S., Watanabe, Y., Hashimoto, S., and Kawashima, H. (1994) Molecular cloning and functional expression of a cDNA encoding the human V1b vasopressin receptor. J Biol Chem 269, 27088-27092. Suzuki, M., Kubokawa, K., Nagasawa, H., and Urano, A. (1995) Sequence analysis of vasotocin cDNAs of the lamprey, Lampetra japonica, and the hagfish, Eptatretus burgeri: evolution of cyclostome vasotocin precursors. J Mol Endocrinol 14, 67-77. Takuwa-Kuroda, K., Iwakoshi-Ukena, E., Kanda, A., and Minakata, H. (2003) Octopus, which owns the most advanced brain in invertebrates, has two members of vasopressin/oxytocin superfamily as in vertebrates. Regul Pept 115, 139-149. Thibonnier, M., Auzan, C., Madhun, Z., Wilkins, P., Berti-Mattera, L., and Clauser, E. (1994) Molecular cloning, sequencing, and functional expression of a cDNA encoding the human V1a vasopressin receptor. J Biol Chem 269, 3304-3310. Thomas, J. W., Touchman, J. W., Blakesley, R. W., Bouffard, G. G., BeckstromSternberg, S. M., Margulies, E. H., Blanchette, M., Siepel, A. C., Thomas, P. J., et al (2003) Comparative analyses of multi-species sequences from targeted genomic regions. Nature 424, 788-793. Valerie, K. and Povirk, L. F. (2003) Regulation and mechanisms of mammalian doublestrand break repair. Oncogene 22, 5792-5812. van Kesteren, R. E., Smit, A. B., de With, N. D., van Minnen, J., Dirks, R. W., Van Der Schors, R. C., and Joosse, J. (1992a) A vasopressin-related peptide in the mollusc Lymnaea stagnalis: peptide structure, prohormone organization, evolutionary and functional aspects of Lymnaea conopressin. Prog Brain Res 92:47-57., 47-57. van Kesteren, R. E., Smit, A. B., Dirks, R. W., de With, N. D., Geraerts, W. P., and Joosse, J. (1992b) Evolution of the vasopressin/oxytocin superfamily: characterization of a cDNA encoding a vasopressin-related precursor, preproconopressin, from the mollusc Lymnaea stagnalis. Proc Natl Acad Sci U S A 89, 4593-4597. Venkatesh, B., Gilligan, P., and Brenner, S. (2000) Fugu: a compact vertebrate reference genome. FEBS Lett 476, 3-7. Venkatesh, B., Si-Hoe, S. L., Murphy, D., and Brenner, S. (1997) Transgenic rats reveal functional conservation of regulatory controls between the Fugu isotocin and rat oxytocin genes. Proc Natl Acad Sci U S A 94, 12462-12466. Verbalis, J. G., Mangione, M. P., and Stricker, E. M. (1991) Oxytocin produces natriuresis in rats at physiological plasma concentrations. Endocrinology 128, 1317-1322. Vesque, C., Maconochie, M., Nonchev, S., Ariza-McNaughton, L., Kuroiwa, A., Charnay, P., and Krumlauf, R. (1996) Hoxb-2 transcriptional activation in rhombomeres and requires an evolutionarily conserved cis-acting element in addition to the Krox20 binding site. EMBO J 15, 5383-5396. 145 Warne, J. M. and Balment, R. J. (1995) Effect of acute manipulation of blood volume and osmolality on plasma [AVT] in seawater flounder. Am J Physiol 269, R1107-R1112. Warne, J. M., Hyodo, S., Harding, K., and Balment, R. J. (2000) Cloning of provasotocin and pro-isotocin cDNAs from the flounder Platichthys flesus; levels of hypothalamic mRNA following acute osmotic challenge. Gen Comp Endocrinol 119, 7784. Winslow, J. T. and Insel, T. R. (2002) The social deficits of the oxytocin knockout mouse. Neuropeptides 36, 221-229. Xi, D., Kusano, K., and Gainer, H. (1999) Quantitative analysis of oxytocin and vasopressin messenger ribonucleic acids in single magnocellular neurons isolated from supraoptic nucleus of rat hypothalamus. Endocrinology 140, 4677-4682. Young, W. S., Iacangelo, A., Luo, X. Z., King, C., Duncan, K., and Ginns, E. I. (1999) Transgenic expression of green fluorescent protein in mouse oxytocin neurones. J Neuroendocrinol 11, 935-939. Young, W. S., Reynolds, K., Shepard, E. A., Gainer, H., and Castel, M. (1990) Cell specific expression of the rat oxytocin gene in transgenic mice. J Neuroendocrinol 2, 917-925. Yuh, C. H., Bolouri, H., and Davidson, E. H. (1998) Genomic cis-regulatory logic: experimental and computational analysis of a sea urchin gene. Science 279, 1896-1902. Zeng, Q., Carter, D. A., and Murphy, D. (1994a) Cell specific expression of a vasopressin transgene in rats. J Neuroendocrinol 6, 469-477. Zeng, Q., Foo, N. C., Funkhouser, J. M., Carter, D. A., and Murphy, D. (1994b) Expression of a rat vasopressin transgene in rat testes. J Reprod Fertil 102, 471-481. Zeng, Q., Foo, N. C., Funkhouser, J. M., Carter, D. A., and Murphy, D. (1994c) Expression of a rat vasopressin transgene in rat testes. J Reprod Fertil 102, 471-481. Zhang, B. J., Kusano, K., Zerfas, P., Iacangelo, A., Young, W. S., and Gainer, H. Targeting of green fluorescent protein to secretory granules in oxytocin magnocellular neurons and its secretion from neurohypophysial nerve terminals in transgenic mice. Endocrinology 2002 Mar ;143 (3 ):1036 -46 143, 1036-1046. Zlotnik, A. and Yoshie, O. (2000) Chemokines: a new classification system and their role in immunity. Immunity 12, 121-127. 146 Appendices 147 Appendix Kruppel AATATAACCCAATAATTTGAAGTAACTGGCAGG--AGCGAGG-TATCCTTCCTGGTTACC AATATAACCCAATAATTTGAAGTAACTCGCAGG--AGCGAGG-TATCCTTCCTGGTTACC AATATAACCCAATAATTTGAACCAACTCGCGGAGCAGCGAGGGCATCCTACCCGGTTACC AATATAACCCAATAATTTGAACTAACTCA-------------ACGACTGGGAGAGTTACT AATATAACCCAATAATTTGAACTAACTCAC-----AGCAACAACAACTGGGAGAGTTACT ********************* **** * ***** D. D. D. D. D. melanogaster simulans erecta virilis picticornis D. D. D. D. D. melanogaster simulans erecta virilis picticornis CGGTACTGCATAACAATGGA----------ACCCGAACCGTAACTGGGACAG-----ATC CGGTACTGCATAACAATGGA----------ACCCGAACCGTAACTGGGACAG-----ATC CGGTACTGCATAACAATGAA----------AC-------GAAACTGGGACAG-----ATC TAGTAATGCATAACAATGAGCGCAGTTGAGGCTGAAACTGAAATTGAAATGTTTGATGCC TAGTAATGCATAACAATAAG-----TTGAGGCTGAAATTGAAACTGAAATGCTCT-CGCC *** *********** * * ** ** * * D. D. D. D. D. melanogaster simulans erecta virilis picticornis D. D. D. D. D. melanogaster simulans erecta virilis picticornis GAAAAGCTGG-----------------------CCTGGTTTCTCG------------CTG GAAAAGCTGG-----------------------CCTGGTTTCTCG------------CTG GGTGA------------------------------TGGTTTCTCG------------CTG AAGGGTTTTGGCATTGACTAGAACTCGTCCTGGTCTGGTGTCCTGTGT-GCTGTGTGCTG GAAGTTTTCAGCCACATC----GTTTTTCCAAGGGTTCTCCTCGGCATTGACTGGTCCAG * * * * * bicoid5/kruppel5 bicoid4/Giant3 TGTGTGCCGTGTTAATCCGTTT-GCCATCAGCGAGATTATTAGTCAATTGCAGTT----TGTGTGCCGTGTTAATCCGTTT-GCCATCAGCCAGATTATTAGTCAATTGCAGTT----TGTGTGCCGTGTTAATCCGTTT-GCCATCAGCCAGATTATTAGTCAATTGCAGTC----TGTCCTGTGCGTTAATCCGTTT-GCCATCAGCGACATTATTAGTCGATTTTCT------CATCCTGTGCGTTAATCCGTTTTGCCATCAGCGACATTATTACTCTATTTTCCATTTCTC * * ************ ********* * ******* ** *** D. D. D. D. D. melanogaster simulans erecta virilis picticornis D. D. D. D. D. melanogaster simulans erecta virilis picticornis -----------------------GCAGC------------------GTTTCGCTTTC-------------------------GCAGC------------------GTTTCGCTTTC-------------------------GCAGTCGCAGTTGCAGTTGCAGGGTTTCGCTTTCCTC ------------------------CAGTTTGGCT----------------CAGTTTCA-C TCTAAAATTTGAACATTTTCTCAACCGTTTGCATTTCCATATCCATTTTCCATTTTCA-C * * * **** Giant2 GTCCTCGTTTCACTTTCGAGTTAGACTTTATTGCAGCATCTTG----AACAATCGTC--GTCCTCGTTTCACTTTCGAGTTAGACTTTATTGCAGCATCTTG----AACAATCGTC--GTCCTCGTTTCACTTTCGAGTTAGACTTTATTGCAGCATCTTGCAGCAACAATCGGC--TTTCGCCTTGCGGATACGAGTTAGATTTTATTGCAGCATCTTG----AACAATCGC---TTTCGCCT-GCGGATACGAGTTAGATTTTATTGCAGCATCTTG----AACAATCGCCTCA * * * * * * ********* ***************** ******** Appendic I Legend. Alignment of part of the eve stripe2 enhancer from five Drosophila species. Divergence times from Drosophila melanogaster are approximately: D. simulans, MY; D. erecta, – 15 MY; D. virilis, 60 – 80 MY; and D. picticornis, ~60 MY (Powell JR 1997). Boxes indicate TFBSs (for kruppel, bicoid and giant) defined biochemically (Small et al. 1992; Small et al. 1991; Stanojevic et al. 1991); names are above. Note that TFBSs are observed as discrete, highly conserved blocks in the alignment. Adapted from (Ludwig et al. 1998). 148 Appendix II mouse human tgcttggcttactggctctgacctcggcctgctacatccagaactgccccctgggcggcaagagggctgtgct tgctcggcctcctggcgctgacctccgcctgctacatccagaactgccccctgggaggcaagagggccgcgcc **** *** * ***** ******** ***************************** *********** * ** intron 1: mouse human ggacctggatatgcgcaagGTGAGTCTCCCCGACCCTGTCCCTTCCCTTCCCGTTCTGGCGATGCTAAGGACC ggacctcgacgtgcgcaagGTGAGTC--CCCAGCCCTGG----TCCCGCGGCGCTCCGGGGA----------****** ** *************** *** ***** **** ** ** ** ** mouse human AGAGAAGCTCTCCCACCTACAGAGAGCATTCCCGCACACTTGCCAGCCCTACCAAGGCCTCGCGTGGGAACCC -GGGAGGGACCCGCAGCCACAGGG-----------------GCGCGCCCCGCTCCGGCCTCGCCTGAGAACTC * ** * * * ** * **** * ** **** * ******** ** **** * mouse human AGGGCTTTGGGAAGTGTTAGGCTCCCT---CTTGAC-GCCGTGAAGGTAACGACAATGCCGGAGCAC-----CAGGAGCTGAGCGGATTTTGACGCCCCGCCCTTGACCGCGGTCGAGGCCCCCACGGCGCCCCAGCGCGTCTCA ** ** * * ** * * *** ****** ** ** *** * ** *** *** * mouse human ---CCACTGCCCC--------------------------------TCGCTCTGC---CACAGTCCGGATTCGG GCCCCGCTGTCCCGCCCGAACTCCGAACCCCGGACCCCAGCATCCTTGCCCGGCGCACCCCGGCCGGCCTCGC ** *** *** * ** * ** * * * **** *** mouse human ATTGTGCACGG----------------------------CGCCCACCCGCATCCTTCCCCACAGtgtctcccc AGGGTCCTCCGAGCGAGTCCCCAGCGCCGCCCCGGCTCCCGCTCACCC-CGCCCGTCCCCGCAGtgcctcccc * ** * * * *** ***** * ** ***** ***** ****** mouse human tgcggcccgggcggcaaaggacgctgcttcggaccaagcatctgctgcgcggacgagctgggctgcttcgtgg tgcggccccgggggcaaaggccgctgcttcgggcccaatatctgctgcgcggaagagctgggctgcttcgtgg ******** ** ******** *********** ** * ************** ******************* mouse human gcaccgccgaggcgctgcgctgccaggaggagaactacctgccttcgccctgccagtctggccagaagccctg gcaccgccgaagcgctgcgctgccaggaggagaactacctgccgtcgccctgccagtccggccagaaggcgtg ********** ******************************** ************** ********* * ** intron 2: mouse human cgggagcggaggccgctgcgccgccacaggcatctgctgcagcccggGTGAGCAGGAGGGGGCCCAGCAGGGT cgggagcgggggccgctgcgcggtcttgggcctctgctgcagcccggGTGAGCGGGGCAAGGCGCTCCGGGG********* *********** * * *** ********************* ** *** * * *** mouse human GACCCGGCAAGGAGCCGTCGGGTTTGCAGCTCAGA--ACACTGAC-CCATTTC-TCTTGCAGatggctgccgc ---CCAGGGGGAGGCGGGCGGGGGTGCGGCCGGGATTCCCCTGACTCCACCTCTTCCTCCAGacggctgccac ** * * ** * **** *** ** ** * ***** *** ** ** * **** ******* * mouse human acagaccccgcctgcgaccctgagtctgccttctcggagcgctgagcccactttctgg----gaataccttt-gccgaccctgcctgcgacgcggaagccaccttctcccagcgctgaa---acttgatggctccgaacaccctcga * ***** ********* * ** * ******* ******** **** *** *** *** * mouse human agcgcgcttccttcgttccccatggccactgccagaaaaaaaaaaaaaaaagaaaagaaaagaaaagaaaagaa agcgcgccactcgcttcccccatagccacc-ccagaaatggtgaaaa-------------------------ta ******* * * * ****** ***** ******* **** * 149 mouse human aaataaagtaga-tttcctcttcaaacttgactgGTGTCTAATTGTCGGAAACGGGAGGGAGGAAAGGCACCGaaataaagcaggtttttctcctctaccttgactcGTGTCTAAGTGCCAGAAATGGGACGGGGAGGGGGCATTGT ******** ** *** *** ** * ******* ******** ** * **** **** ** * **** * mouse human ------GGAA-------CGCCGTGGATCT-TGGCATTTTGTA-GCAAAAACAGTCCAG-----------CAGGC GGGACTGGAAGATCGCGCGCGTTGGACCTGTGGCTTGTTGCGCTCAGAGCTGGCCCAGGAAGACGTGTCCCGGC **** *** **** ** **** * *** ** * * **** * *** mouse human TGCTC—-GGGGACCGAG-GGGTGCTCTATGGGCTGCCATCTCCC-----------------------------TACCCGAGGGGACAGAGCGGGTGCTGTTCTGGCTGCCACCACCCTGGAGGGGCTGGAAGAGGGAGGGGCACAAA * * * ****** *** ******* * ******** * *** mouse human -----------------ATTAGCCCCA--TTTCCATTTCAA--CTGGGCTGGGCCTGATAG--------ACTTA GGCTCTGAGGACGTGGAAACAGCCCCAGCTTCCCGCTCCCAGCCTGGGCTGAGGCCTACAGCAGGCTGCACCTC * ******* ** ** * * * ******** * * * ** ** * mouse human AGAGAAGAATTTGGAAGTCCAAACAGCAACGGTGGACTTCTGTGGGAAAGGGCAACGCCTAACAGGGGACTGAG AGGGGATCTTTCAAAATTCAAAAAGACGAGGAT------------GAGGGAGCAAATACAGACAAGGGTCTGAG ** * * ** ** ** *** * * * * ** * **** * *** *** ***** mouse human GAGCCTAACAAGGCAGGCTAGGAGGCAGG-GGAACTAGTTCAGTCACTTCC--ATATCTGAGAGGGGGCTTTAG CGGGATGACCA-------CAGGAAGCGGGCAGTGCACACTGAATGGCTTCCTGACCCCTGAAAGGAGGTTTGAG * * ** * **** ** ** * * * * * ***** * **** *** ** ** ** mouse human CTGTGACCTCAGAGGTTGAGGGGGCAATCCTGGCCTAGAAGGCAGGGTCTTGGCCAGGGGAGGGTAGTTACAGA CCACA--CTTAGAAGTTGAGGGAGCGGAGCGGGCCTGGGGGGAGGGGGC----CCTGGGGA--GCAGCTGAAGG * ** *** ******** ** * ***** * ** *** * ** ***** * ** * ** mouse human TACCAA-AGGTTTCCACAGAGCTGAATTCTCACGCAGGCCCCAAGGAAACCACAGCTGGAAAGATC-----AAG -GCCAACATGTTTCCAAGGAGCT-------------GGCCCCCAGGAGGCCA---CTGGCACGCTCAGAAGAGG *** * ******* ***** ****** **** *** **** * * ** * * mouse human AACC-----------AACTGGCCT----------------CTCCTCTGCTGTCCCCAGGGTCGGGCCTGAGCTG AGCCCAAGCTGCCGGGACTGGGCTTGAATGCCAGCATGACCGTCCCTGGTGTCCCCAGGGCTGGGTCTGACCCA * ** ***** ** * * *** *********** *** **** * mouse human GGGGTGGGGGTGGGGGGCGGGGGGGGGGCTGCCCGCCTCTGCAGGACAGCGTGCT----CTGGGGA-------GCAGCTCTACT--------------------CCTGCCTGTGCAATAAAACATGTCAGGGCTGGGGACCCCACAA * * * ** **** **** * * * ** ******* mouse human ---GACATGGGATC-TAAGAGCCAGTGGGCACA GCGGACAGGGGATCTTGAGAGCCCAGGGCCACA **** ****** * ****** ** **** Appendix II Legend. BLASTZ alignment of human and mouse oxytocin. Sequence similarity in the 3’ presumed CRM is not obviously greater than that in the introns. Intron sequence is boxed, and indicated above; mRNA sequence is lower-case. The alignment is from the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgGateway, April 2003 freeze). 150 Appendix III Oligos used for gel-shift screen. The oligos for the gelshift experiments were mostly 25mers; paired forward and reverse oligos were designed so that the 3’ most 10 bases paired and the annealed oligos could be filled in with klenow to generate double stranded 40mers, e.g.: m1f m1r 5’ GTAGATTTCCTCTTCAAACTTGACT |||||||||| 3’ TTTGAACTGACCACAGATTAACAGC 3’ 5’ List of oligos used in the gelshift experiments: m1f m2f m3f m4f m5f m6f m7f m8f m9f m10f m11f m12f m13f m14f m15f m16f m17f m18f m19f m20f m21f m22f m23f m24f m25f m26f m27f m28f m29f 5’ GTAGATTTCCTCTTCAAACTTGACT 3’ 5’ CTAATTGTCGGAAACGGGAGGGAGG 3’ 5’ CACCGGGAACGCCGTGGATCTTGGC 3’ 5’ GTAGCAAAAACAGTCCAGCAGGCTG 3’ 5’ GACCGAGGGGTGCTCTATGGGCTGC 3’ 5’ TCCCATTAGCCCCATTTCCATTTCA 3’ 5’ GCTGGGCCTGATAGACTTAAGAGAA 3’ 5’ TGGAAGTCCAAACAGCAACGGTGGA 3’ 5’ GTGGGAAAGGGCAACGCCTAACAGG 3’ 5’ GAGGAGCCTAACAAGGCAGGCTAGG 3’ 5’ GGGGAACTAGTTCAGTCACTTCCAT 3’ 5’ AGAGGGGGCTTTAGCTGTGACCTCA 3’ 5’ TGAGGGGGCAATCCTGGCCTAGAAG 3’ 5’ GTCTTGGCCAGGGGAGGGTAGTTAC 3’ 5’ CATAAGGTTTCCACAGAGCTGAATT 3’ 5’ GCAGGCCCCAAGGAAACCACAGCTG 3’ 5’ ATCAAGAACCAACTGGCCTCTCCTC 3’ 5’ TCCCCAGGGTCGGGCCTGAGCTGGG 3’ 5’ GGGTGGGGGGCGGGGGGGGGGCTGC 3’ 5’ TCTGCAGGACAGCGTGCTCTGGGGA 3’ 5’ GGGATCTAAGAGCCAGTGGGCACAA 3’ 5’ CACAAAGCACGGAGCCCACAGACAA 3’ 5’ AATCCACAATCTATACTGCTCCCTT 3’ 5’ TGGATTAAAATACCGCCCTTGCCAC 3’ 5’ GCGCCTCACTTGGCTGCCAGTGTTC 3’ 5’ AGCAGTAATGGGCAGAAGTGAGGGC 3’ 5’ CCGCCTCCACAAGGGCACGTGATTC 3’ 5’ CAGAACAAAGTGTGAGGGCTTGGGT 3’ 5’ TCAGAGACTGGAAGTCTTGCCCCAC 3’ m29r m28r 5’ CAGGACTTTAACCGTGTGGGGCAAG 3’ 5’ CAGTCTCTGAGCTCCACCCAAGCCC 3’ 151 m27r m26r m25r m24r m23r m22r m21r m20r m19r m18r m17r m16r m15r m14r m13r m12r m11r m10r m9r m8r m7r m6r m5r m4r m3r m2r m1r 5’ CTTTGTTCTGACAGCGAATCACGTG 3’ 5’ GTGGAGGCGGGGCATGCCCTCACTT 3’ 5’ CATTACTGCTGCTGAGAACACTGGC 3’ 5’ AGTGAGGCGCGCTTCGTGGCAAGGG 3’ 5’ TTTTAATCCAGCAGTAAGGGAGCAG 5’ ATTGTGGATTTCTGCTTGTCTGTGG 3’ 5’ GTGCTTTGTGGTCACTTGTGCCCAC 3’ 5’ CTTAGATCCCATGTCTCCCCAGAGC 3’ 5’ GTCCTGCAGAGGCGGGCAGCCCCCC 3’ 5’ CCCCCCACCCCCACCCCCAGCTCAG 3’ 5’ ACCCTGGGGACAGCAGAGGAGAGGC 3’ 5’ GGTTCTTGATCTTTCCAGCTGTGGT 3’ 5’ TGGGGCCTGCGTGAGAATTCAGCTC 3’ 5’ AAACCTTATGGTTCTGTAACTACCC 3’ 5’ TGGCCAAGACCCTGCCTTCTAGGCC 3’ 5’ TGCCCCCTCAACCTCTGAGGTCACA 3’ 5’ AGCCCCCTCTCAGATATGGAAGTGA 3’ 5’ CTAGTTCCCCTGCCTCCTAGCCTGC 3’ 5’ TAGGCTCCTCAGTCCCCTGTTAGGC 3’ 5’ CCTTTCCCACAGAAGTCCACCGTTG 3’ 5’ TGGACTTCCAAATTCTTCTCTTAAG 3’ 5’ CAGGCCCAGCCCAGTTGAAATGGAA 3’ 5’ GCTAATGGGAGATGGCAGCCCATAG 3’ 5’ CCCTCGGTCCCCGAGCAGCCTGCTG 3’ 5’ TTTTTGCTACAAAATGCCAAGATCC 3’ 5’ GTTCCCGGTGCCTTTCCTCCCTCCC 3’ 5’ CGACAATTAGACACCAGTCAAGTTT 3’ h1f h2f h3f h4f h5f h6f h7f h8f h9f h10f h11f h12f h13f h14f h15f h16f h17f h18f 5’ TCTAAGTGCCAGAAATGGGACGGGG 3’ 5’ GCATTGTGGGACTGGAAGATCGCGC 3’ 5’ GGACCTGTGGCTTGTTGCGCTCAGA 3’ 5’ CCCAGGAAGACGTGTCCCGGCTACC 3’ 5’ GGACAGAGCGGGTGCTGTTCTGGCT 3’ 5’ CACCCTGGAGGGGCTGGAAGAGGGA 3’ 5’ ACAAAGGCTCTGAGGACGTGGAAAC 3’ 5’ CAGCTTCCCGCTCCCAGCCTGGGCT 3’ 5’ CTACAGCAGGCTGCACCTCAGGGGA 3’ 5’ CAAAATTCAAAAAGACGAGGATGAG 3’ 5’ AAATACAGACAAGGGTCTGAGCGGG 3’ 5’ CACAGGAAGCGGGCAGTGCACACTG 3’ 5’ CTTCCTGACCCCTGAAAGGAGGTTT 3’ 5’ ACACTTAGAAGTTGAGGGAGCGGAG 3’ 5’ CTGGGGGGAGGGGGCCCTGGGGAGC 3’ 5’ AAGGGCCAACATGTTTCCAAGGAGC 3’ 5’ CCCAGGAGGCCACTGGCACGCTCAG 3’ 5’ GAGCCCAAGCTGCCGGGACTGGGCT 3’ 152 h19f h20f h21f h22f h23f h24f h25f h26f 5’ GCCAGCATGACCGTCCCTGGTGTCC 3’ 5’ GCCAGCATGACCGTCCCTGGTGTCC 3’ 5’ GCTGGGTCTGACCCAGCAGCTCTAC 3’ 5’ CCTGTGCAATAAAACATGTCAGGGC 3’ 5’ ACCCCACAAGCGGACAGGGGATCTT 3’ 5’ CCCAGGGCCACAGAAATGACATGAA 3’ 5’ AGAAGCTCTTAACCTCTATCTCCTA 3’ 5’ GAAGCAAAAGTATCTGAGACAGGTC 3’ h26r h25r h24r h23r h22r h21r h20r h19r h18r h17r h16r h15r h14r h13r h12r h11r h10r h9r h8r h7r h6r h5r h4r h3r h2r h1r 5’ AGAGCGAAACTCGATCTCAAAAAAA 3’ 5’ GATTAAGTTGTTTGAGACCTGTCTC 3’ 5’ CTTTTGCTTCACCGATAGGAGATAG 3’ 5’ ATGACATGAACAAAGAGAAGCTCTT 3’ 5’ TGGCCCTGGGCTCTCAAGATCCCCT 3’ 5’ CTTGTGGGGTCCCCAGCCCTGACAT 3’ 5’ ATTGCACAGGCAGGAGTAGAGCTGC 3’ 5’ CAGACCCAGCCCTGGGGACACCAGG 3’ 5’ TCATGCTGGCATTCAAGCCCAGTCC 3’ 5’ GCTTGGGCTCCTCTTCTGAGCGTGC 3’ 5’ GCCTCCTGGGGGCCAGCTCCTTGGA 3’ 5’ GTTGGCCCTTCAGCTGCTCCCCAGG 3’ 5’ CTCCCCCCAGGCCCGCTCCGCTCCC 3’ 5’ TTCTAAGTGTGGCTCAAACCTCCTT 3’ 5’ GGTCAGGAAGCCATTCAGTGTGCAC 3’ 5’ GCTTCCTGTGGTCATCCCGCTCAGA 3’ 5’ GTCTGTATTTGCTCCCTCATCCTCG 3’ 5’ TTGAATTTTGAAAGATCCCCTGAGG 3’ 5’ CCTGCTGTAGGCCTCAGCCCAGGCT 3’ 5’ CGGGAAGCTGGGGCTGTTTCCACGT 3’ 5’ GAGCCTTTGTGCCCCTCCCTCTTCC 3’ 5’ CTCCAGGGTGGTGGCAGCCAGAACA 3’ 5’ CGCTCTGTCCCCTCGGGTAGCCGGG 3’ 5’ TCTTCCTGGGCCAGCTCTGAGCGCA 3’ 5’ CCACAGGTCCAACGCGCGCGATCTT 3’ 5’ CCCACAATGCCCCCTCCCCGTCCCA 3’ Brn2f Brn2r 5’ CTCTGGGGTGGAACATCTATAAAAT 3’ 5’ GGTATCATTATCTAAATTTTATAGA 3’ Sim/Arntf Sim/Arntf 5’ GGAGGGGGCTGGGCCCTACGTGCTG 3’ 5’ ACAGGCTGTGTGAGACAGCACGTAG 3’ hVPCref hVPCrer 5’ CCCAGATGCCTGAATCACTGCTGAC 3’ 5’ GCCAGGTCCCCAGCCGTCAGCAGTG 3’ hVPEboxf 5’ CTGCACAGACAGGCCCACGTGTGTC 3’ 153 hVPEboxr 5’ ATTCAGGCATCTGGGGACACACGTG 3’ mInsPdx1f mInsPdx1r 5’ GGTCCCTTATTAAGACTATAATAAC 3’ 5’ CTACTTAGTCTTAGGGTTATTATAG 3’ oligos with mutations to define TF binding sites: h6.1 h6.2 h6.3 h6.4 h6.5 h6r 5’ CACCCTGGAccccCTGGAAGAGGGAGGGGCACAAAGGCTC 3’ 5’ CACCCTGGAGGGGgaccAAGAGGGAGGGGCACAAAGGCTC 3’ 5’ CACCCTGGAGGGGCTGGttctGGGAGGGGCACAAAGGCTC 3’ 5’ CACCCTGGAGGGGCTGGAAGAccctGGGGCACAAAGGCTC 3’ 5’ CACCCTGGAGGGGCTGGAAGAGGGAccccCACAAAGGCTC 3’ 5’ gagcctttgtg 3’ h15fWT h15.1r h15.2r h15.3r h15.4r h15rWT h15.5f h15.5f h15.5f h15.5f 5’ CTGGGGGGAGGGGGCCCTGG 3’ 5’ caaccCCCTTCAGCTGCTCCCCAGGGCCCC 3’ 5’ GTTGGgggaaCAGCTGCTCCCCAGGGCCCC 3’ 5’ GTTGGCCCTTgtcgaGCTCCCCAGGGCCCC 3’ 5’ GTTGGCCCTTCAGCTcgaggCCAGGGCCCC 3’ 5’ GTTGGCCCTTCAGCTGCTCC 3’ 5’ gacccGGGAGGGGGCCCTGGGGAGCAGCTG 3’ 5’ CTGGGccctcGGGGCCCTGGGGAGCAGCTG 3’ 5’ CTGGGGGGAGccccgCCTGGGGAGCAGCTG 3’ 5’ CTGGGGGGAGGGGGCggaccGGAGCAGCTG 3’ h12fWT h12.1r h12.2r h12.2r h12rWT h12.4f h12.4f h12.4f 5’ CACAGGAAGCGGGCAGTGCA 3’ 5’ GGTCAccttcCCATTCAGTGTGCACTGCCC 3’ 5’ GGTCAGGAAGggtaaCAGTGTGCACTGCCC 3’ 5’ GGTCAGGAAGCCATTgtcacTGCACTGCCC 3’ 5’ GGTCAGGAAGCCATTCAGTG 3’ 5’ CACAGcttcgGGGCAGTGCACACTGAATGG 3’ 5’ CACAGGAAGCcccgtGTGCACACTGAATGG 3’ 5’ CACAGGAAGCGGGCAcacgtCACTGAATGG 3’ the oligos for the walk over the two Sp1-like sites in m13 and m14 m13.1f m13.2f m13.3f m13.4f m13.5f m13.6f m13.7f m13.8f m13.9f m13.10f 5’ TGAGGGGGCAATCCTGGCCT 3’ 5’ GGGCAATCCTGGCCTAGAAG 3’ 5’ ATCCTGGCCTAGAAGGCAGG 3’ 5’ GGCCTAGAAGGCAGGGTCTT 3’ 5’ AGAAGGCAGGGTCTTGGCCA 3’ 5’ GCAGGGTCTTGGCCAGGGGA 3’ 5’ GTCTTGGCCAGGGGAGGGTA 3’ 5’ GGCCAGGGGAGGGTAGTTAC 3’ 5’ GGGGAGGGTAGTTACAGAAC 3’ 5’ GGGTAGTTACAGAACCATAA 3’ 154 m13.11f 5’ GTTACAGAACCATAAGGTTT 3’ m13.1r m13.2r m13.3r m13.4r m13.5r m13.6r m13.7r m13.8r m13.9r m13.10r m13.11r 5’ AGGCCAGGAT 3’ 5’ CTTCTAGGCC 3’ 5’ CCTGCCTTCT 3’ 5’ AAGACCCTGC 3’ 5’ TGGCCAAGAC 3’ 5’ TCCCCTGGCC 3’ 5’ TACCCTCCCC 3’ 5’ GTAACTACCC 3’ 5’ GTTCTGTAAC 3’ 5’ TTATGGTTCT 3’ 5’ AAACCTTATG 3’ m25 GCGCCTCACTTGGCTGCCAGTGTTCTCAGCAGCAGTAATG h12 CACAGGAAGCGGGCAGTGCACACTGAATGGCTTCCTCACC h12 CACAGGAAGCGGGCAGTGCACACTGAATGGCTTCCTCACC 155 Appendix IV Legend. The presumed oxytocin CRM was not bound by some candidate-upstream TFs. The region just upstream of the vasopressin promoter is known to contain cAMP response elements (CREs; the oxytocin promoter probably also contains a CRE), and E-boxes. Brn2 and the Sim1/Arnt2 dimer might be genetically upstream of oxytocin and vasopressin transcription, as suggested (Burbach et al. 2001). Pdx1 is a homeobox-containing TF. In the earliest screens, I checked whether binding sites for these TFs were present on any of the oligos. While the gels are slightly warped (when being transferred to 3MM paper), it can easily be seen that there are no shifts on the human or mouse oligos comparable to those on the Ebox, PdxI, Sim/Arnt or Brn2 oligos. Shifts were performed with a rat thymus nuclear extract. Shifts A, B and C are indicated, though Shift B is only very weakly visible on m15, m16 and h7. 156 [...]... sensitive regulatory machinery is to sequence changes, which will, in turn, depend how it works and how the machinery itself evolves 2 In this introduction, I describe in some detail the oxytocin and vasopressin peptides, and the structure and evolution of the genes encoding them Then I discuss the known characteristics of regulatory DNA, and the approaches used to identify and characterize regulatory DNA, ... increase the number of cells, and differentiate them over evolutionary time (Carroll 2000; Carroll 2001) This seems to me to emphasize plasticity in the ancestral oxytocin/ vasopressin enhancer, and homology between the modern oxytocin and vasopressin enhancers 1.2 Structure of oxytocin and vasopressin related genes 9 The genes encoding oxytocin and vasopressin are homologous in the sequence and organization... primarily in regulatory DNA rather than protein coding sequences This is an important theoretical contribution to the study of syntax in regulatory DNA xv Chapter 1 Introduction 1 Chapter 1 Introduction The work described in this thesis is intended to improve our understanding of the regulation of the transcription of the oxytocin and vasopressin genes The information necessary for correctly regulating the. .. “magnocellular”) The transcription of oxytocin and vasopressin genes in these neurons are massive; mRNA copy number is variously estimated at around 20,000 to 500,000 per cell (Burbach et al 2001) Oxytocin and vasopressin are released from the posterior lobe of the pituitary, which is largely composed of axon terminals of specialized ‘neurosecretory’ neurons The expression patterns of oxytocin and vasopressin genes, ... gene 1.3 Regulatory DNA 1.3.1 Definitions related to regulatory DNA The terms gene, promoter and enhancer are often used vaguely The definitions of these terms as used in this thesis are given below: A ‘gene’ is the unit of heritability, i.e., a genetic locus, or a region of chromosome that is ‘expressed’ in the phenotype of the individual A protein-coding gene includes the exons and introns, 5’ and 3’... On the other hand, the main role of vasopressin is maintenance of blood osmolarity and volume homeostasis (Orloff and Handler 1967) Oxytocin is also known to stimulate Na+ excretion in the kidney (Verbalis et al 1991) Peptides related to oxytocin and vasopressin have been identified in a wide range of animal taxa (Table 1) Whereas all jawed vertebrates have at least one homologue each of oxytocin and. .. oxytocin and vasopressin related genes (Acher 1980) The close linkage of the oxytocic -vasopressin related genes in mammals and Fugu supports this hypothesis The peptides encoded by the newly duplicated genes would 11 have had the same function initially and undergone 'subfunctionalization' (Force et al 1999) subsequently to give rise to two genes that shared the expression domains and functions of the parent... parts of the brain (variable between species), and the myoepithelium of the mammary gland (Kimura et al 1992; Gorbulev et al 1993; Rozen et al 1995) 8 1.1.3 Evolution of the oxytocin and vasopressin neurons As briefly summarized above, oxytocin and vasopressin have homologous receptors, overlapping functions and target tissues that look functionally homologous on an evolutionary timescale The oxytocin and. .. enhancer The results of the oxytocin and vasopressin transgenes have been summarized in Figures 1.3 and 1.4, respectively 1.4.1.1 Oxytocin transgenes The smallest transgene that correctly expresses oxytocin is a fragment of the bovine oxytocin gene (Figure 1.3, viii) which extends from 0.6 kb upstream of the tss to 1.9 kb downstream of the polyA signal (bOT3.5, (Ho et al 1995)), indicating that there... neurons The oxytocin and vasopressin destined for circulation is produced in magnocellular neurons of the hypothalamus The cell bodies of these magnocellular (neurosecretory) oxytocinergic and vasopressinergic neurons lie in two pairs of hypothalamic nuclei, the supraoptic nuclei (SON) and paraventricular nuclei (PVN) In the mouse, the supraoptic nuclei are ~ 100 µm in diameter, and ~ 800 µm in length These . COMPARATIVE GENETIC ANALYSIS OF THE TRANSCRIPTIONAL REGULATORY DNA OF THE OXYTOCIN AND VASOPRESSIN GENES Patrick Gilligan (M.Sc. University of Waikato) A THESIS. xiv Summary In the work described in this thesis, I investigate regulatory DNA (enhancers, or cis- regulatory modules) of the oxytocin and vasopressin genes. Oxytocin and vasopressin, the first-discovered. 1 Introduction The work described in this thesis is intended to improve our understanding of the regulation of the transcription of the oxytocin and vasopressin genes. The information necessary