Domains of ERRc that mediate homodimerization and interaction with factors stimulating DNA binding Moritz Hentschke, Ute Su¨ sens and Uwe Borgmeyer Zentrum fu ¨ r Molekulare Neurobiologie Hamburg (ZMNH), Universita ¨ t Hamburg, Germany The estrogen receptor-related receptor c (ERRc/ERR3/ NR3B3) is an orphan member of the nuclear receptor superfamily closely related to the estrogen receptors. To explore the DNA binding characteristics, the protein–DNA interaction was studied in electrophoretic mobility shift assays (EMSAs). In vitro translated ERRc binds as a homodimer to direct repeats (DR) without spacing of the nuclear receptor half-site 5¢-AGGTCA-3¢ (DR-0), to exten- ded half-sites, and to the inverted estrogen response element. Using ERRc deletion constructs, binding was found to be dependent on the presence of sequences in the ligand binding domain (LBD). A far-Western analysis revealed that ERRc forms dimers even in the absence of DNA. Two elements, located in the hinge region and in the LBD, respectively, are necessary for DNA-independent dimerization. DNA bind- ing of bacterial expressed ERRc requires additional factors present in the serum and in cellular extracts. Fusion proteins of the germ cell nuclear factor (GCNF/NR6A1) with ERRc showed that the characteristic feature to be stimulated by additional factors can be transferred to a heterologous protein. The stimulating activity was further characterized and its target sequence narrowed down to a small element in the hinge region. Keywords: orphan nuclear receptor; transcription factor; estrogen receptor-related; DNA binding; dimerization. The nuclear receptors (NR) comprise a family of transcrip- tional regulators involved in a wide variety of biological processes, such as embryonic development, differentiation, and homeostasis. This family includes ligand-dependent transcription factors for steroid hormones, estrogens, thy- roid hormones, retinoids, vitamin D, and other hydropho- bic compounds [1]. In addition, several members are orphan receptors for which ligands have yet to be identified [2,3]. Nuclear receptors exhibit a modular structure with func- tionally separable domains (A/B, C, D and EF) [4]. The most highly conserved region of these proteins is the DNA- binding domain (DBD, C-domain), which contains two zinc-binding modules that fold to form a single structural domain [5]. They confer binding to a core recognition motif, or a NR half-site, resembling the sequence 5¢-AGGTCA-3¢. Most receptors bind as homodimers or heterodimers to palindromes or to direct-repeated sequences of the AGGTCA motif [6]. However, a subset of orphan receptors bind an extended NR half-site with the core sequence 5¢-TCAAGGTCA-3¢as monomers. The C-terminal exten- sion (CTE) of the DBD contributes to the specific interac- tion by base specific contacts in the minor grove of the DNA. The C-terminal domain (EF) has an intrinsic ligand- binding function, a ligand-dependent transactivation func- tion (AF-2), and a dimerization interface. The variable, N-terminal domain (A/B) is important in transcriptional regulation of some nuclear receptors, and a short variable domain (D) with a nuclear localization motif is thought to be the hinge between C and EF. Based on the evolution of the conserved DBD and of the ligand-binding domain (LBD), the superfamily has been divided into six subfamilies and 26 groups of receptors [7]. Subfamily 3 comprises three groups, the estrogen receptors ERa and ERb [8,9], the estrogen receptor-related receptors (ERRs) and one receptor each for the three steroid hormone classes: glucocorticoids, mineralocorticoids, progestin, and androgen [10]. ERRa and ERRb were initially isolated because of their homo- logy to ERa [11]. Although structurally related, no natural ligand is known for the ERRs. Both receptors bind to extended NR half-sites and to classical estrogen receptor response elements (EREs), inverted repeats of the NR half-site separated by three base pairs [12–14]. Both types of sequence element function as response elements of ERa as well, suggesting a functional relationship between these receptors [15]. Putative common target genes of ERs and ERRs, such as lactoferrin, aromatase and osteopontin [15–19], and common coactivators [14] further strengthen the view of a functional interference of these receptors. Although monomeric binding of ERRa has been suggested [12,20], homodimer binding was demonstrated by cotranslation of ERRa and truncated ERRa, generating an intermediate band in electrophoretic mobility shift assay (EMSA) [13,15,19]. Transfection studies revealed ERR-dependent activation of promoters with EREs or extended half-sites. Activation of the reporter genes occurred in the absence of any exogen- ous added ligand. Interestingly, studies by Vannacker et al. Correspondence to U. Borgmeyer, ZMNH, Universita ¨ tsklinikum Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany. Fax: + 49 40 42803 5101, Tel.: + 49 40 42803 6622, E-mail: uwe.borgmeyer@zmnh.uni-hamburg.de Abbreviations: CTE, C-terminal extension; DBD, DNA binding domain; DR, direct repeat; ERR, estrogen receptor-related receptor; EMSA, electrophoretic mobility shift assay; ERE, estrogen response element; GCNF, germ cell nuclear factor; GST, glutathione S-transferase; LBD, ligand-binding domain, NR, nuclear receptor. Note: a web site is available from http://www.zmnh.uni-hamburg.de (Received 25 April 2002, revised 26 June 2002, accepted 10 July 2002) Eur. J. Biochem. 269, 4086–4097 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03102.x show the requirement of a serum factor for transcriptional activation [13]. By several means, a novel nuclear receptor was isolated from human and mouse cDNA libraries [21–24]. Because sequence comparisons reveal high homology to ERRa and ERRb, the receptor was given the systematic name NR3B3, and the trivial names ERRc and ERR3. ERRc is much more closely related to ERRb than to ERRa. However, the DBDs of all ERRs are more than 90% conserved. In the adult mouse, ERRc is highly expressed in heart, brain, kidney and skeletal muscle [25]. We have previously described its spatial pattern of expression during embryonic development and in the mature mouse brain [26]. In the adult brain, high transcript levels were observed in the isocortex, the olfactory system, cranial nerve nuclei, and major parts of the coordination centers, a pattern that is established in the embryo. During development expression is prominent in the nervous system [27]. The gene is preferentially transcribed in already differentiating areas of the nervous system establishing many features of the adult expression pattern. This expression pattern suggests func- tions of the receptor not shared with its two close homologues. Different isoforms have been described in mouse and human, differing in the length of their N-terminal domains [24,25,28]. Binding to an extended NR half-site has been performed with in vitro translated ERRc2 [28]. The authors conclude that ERRc2 binds as a monomer to extended half-sites. Hong et al. (1999) dem- onstrated ERRc-dependent activation of reporter genes controlled by estrogen response elements in the absence of any added ligand. An AF-2 activation domain bound by the coactivator GRIP1 primarily mediates the transcriptional activation [24]. Recent studies demonstrated binding and antagonistic function of the synthetic estrogen receptor modulators 4-hydroxytamoxifen to ERRc [29,30]. The crystal structure of the human ERRc LBD bound to the SRC-coactivator peptide has been resolved. In the crystal, the LBD adopts a transcriptionally active conformation suggesting that putative steroidal ligands would function as antagonist [31]. Here, we describe the binding characteristics of mERRc2. The receptor binds to DR-0, extended half-sites, and to classical EREs. Interestingly, efficient binding depends on additional factors present in the serum and in cellular extracts. We present a sequence in the hinge region as the target site of these activities. ERRc binds as dimer to DNA. Dimerization depends on sequence elements, pre- sent in the DBD, in the hinge region and in the LBD. The C-terminal dimerization motifs function independent of DNA. MATERIALS AND METHODS Plasmid constructs Full-length ERRc2 cDNA was amplified by PCR with Pfu polymerase (Stratagene) from a mouse embryonic day 15 brain cDNA. The forward primer, c2-start (5¢-AAAG CTTGCCGCCACC ATGGATTCGGTAGAACTTTGC CT-3¢), includes HindIII and NcoI restriction sites, a Kozak consensus site [32], the translational start codon of ERRc2 (underlined) and additional 20 nucleotides of the coding sequence. The reverse primer, c2-stop (5¢-GGAT CC TCAGACCTTGGCCTCCAGCATTTC-3¢), includes a BamHI restriction site, the translational stop codon (underlined) and 21 nucleotides complementary to the coding sequence. The product was cloned into the SrfIsite of pCMV-Script vector (Stratagene) to generate pCMV- ERRc2. The correct integration was verified by sequencing. The SalI linearized plasmid pCMV-ERRc2servedasa template to generate epitope-tagged and truncated con- structs of ERRc. All products were cloned into the pGEM-T Easy vector for sequence verification. To generate in vitro translation plasmids, the inserts were isolated and cloned into pSPUTK vector (Stratagene) through either NcoIandSalI, or NcoIandBamHI sites. Inserts of clones with internal NcoIorBamHI sites were isolated by partial digestion. For the N-terminal truncation, DN-ERRc, c2-stop and the forward primer DN(5¢-ACC ATGGTAG ATCCCCAGACCAAGTGTGAA-3¢)wereusedinthe amplification. It includes an NcoI restriction site, a new translational start codon (underlined) and a 21-nucleotide sequence coding for amino acids 111–117 of ERRc2(all numbers according to GenBank accession number AF117254). For the C-terminal truncations the start primer c2-VSVG-start (5¢-ACC ATGGAGTACACCGACATCG AGATGAACAGGCTGGGCAAGGATTCGGTAGAA CTTTGCCTGCCT-3¢ that includes a translational start codon (underlined), a sequence coding for an epitope of the vesicular stomatitis virus glycoprotein (VSV-G) and the reverse primers: D10 5¢-AGTCGAC TCAAAGTTTGT GCATGGGCACTTTGCC-3¢ (ERRc-448), D50 5¢-AGT CGAC TCACATGTGCTGGCCAGCCTCGTAATC-3¢ (ERRc-408), D82 5¢-AGTCGAC TCAATTAGCAAGAG CTATTGCTTT-3¢ (ERRc-376), D127 5¢-AGTCGA C TCATATATAATCGTCTGCATAGAC-3¢ (ERRc- 331), D173 5¢-AGTCGAC TCAATGTTTTGCCCATCCA ATGAT-3¢ (ERRc-285), D240 5¢-AGTCGAC TCAGTTC TCAGCATCTATTCTGCGCTT-3¢ (ERRc-218), were used in the amplification, respectively. The reverse primers, named according to the extent of the resulting protein truncation, contain SalI restriction sites, translational stop codons (underlined) and 21–24 nucleotides complementary to the ERRc coding sequence. The position of the C-terminal amino acid of proteins derived from the respective products is given in parentheses. Fusion proteins GE-1, GE-2, and GE-3 of N-terminal parts of murine germ cell nuclear factor (mGCNF) and C-terminal parts of ERRc were generated by in vitro translation. The respective NcoI/SalI- and SalI/BamHI-fragments were generated by PCR and cloned in a double ligation reaction in the pSPUTK vector, digested with NcoIandBamHI. The following oligonucleotides were used: GCNF-start 5¢-ACCATGGAGCGGGACGAACGGCC ACCTAGC-3¢, c2-stop, G2r 5¢-A GTCGACTTCTTCT TCTGATATCTGGACTGG-3¢(GCNF 1–167), E2f 5¢- A GTCGACAGAATAGATGCTGAGAACAGCCCA-3¢ (ERRc 213–458), G3r 5¢-A GTCGACCAGACTGTAG GACTGAGGGTCCAG-3¢(GCNF 1–271), and E3f 5¢- A GTCGACCATTTGTTGGTGGCTGAACCAGAG-3¢ (ERRc 240–458). The SalI restriction sites are underlined and the respective amino acids encoded by the amplified fragment are given in parentheses. For GE-1, NcoI/AflII- and AflII/BamHI-fragments were generated and cloned into pSPUTK. The oligonucleotides GCNF-start, c2-stop, G1r 5¢-A CTTAAGCATGCCCA Ó FEBS 2002 DNA binding of ERRc (Eur. J. Biochem. 269) 4087 TCTGGAGACACTTGAG-3¢ (GCNF 1–140), and E1f 5¢-A CTTAAGGAAGGGGTCCGTCTTGACAGAGTG-3¢ (ERRc 196–458) were used for the amplification. The AflII restriction sites are underlined. A schematic view of the constructs is given in Fig. 4A. Generation of antibodies The peptide AcNH 2 -YDDCSSTIVEDPQTK-CONH 2 rep- resenting amino acids 101–115 of ERRc2 was synthesized and cross-linked via the C-terminal lysine to keyhole limpet hemocyanin. Eurogentec performed all procedures, inclu- ding the immunization of rabbits. The serum of the second boost was used. Bacterial expression of ERRc The NcoI–HindIII insert of pCMV-ERRc2 containing the whole coding sequence was cloned into pGEX-KG expres- sion vector (Amersham Biosciences). The resulting plasmid pGEX-KG-ERRc2 coding for a fusion protein of glutathi- one S-transferase (GST) and ERRc was transformed into Escherichia coli BL21. Cells were grown in 500 mL Lennox L broth base containing 200 lgÆmL )1 ampicillin to an D 600 of 0.8–1.0. Subsequently, cells were induced under constant shaking with 1 m M isopropyl thio-b- D -galctoside for 3 h at 37 °C. The cells were harvested and resuspended in 10 mL ice cold phosphate-buffered saline (NaCl/P i ), lysed by sonication and centrifuged at 4 °Cwith20000g for 15 min. The GST fusion protein was purified from the supernatant using glutathione–Sepharose 4B beads accord- ing to the manufacturer’s instructions (Amersham Biosciences). Electrophoretic mobility shift assays (EMSAs) Single-stranded oligonucleotides were purchased (Meta- bion) and annealed in 10 m M Tris/HCl, pH 7.5, 60 m M NaClandstoredat)20 °C. Double-stranded oligonucleo- tides had 5¢ overhangs of four nucleotides on both strands. For EMSAs, double-stranded oligonucleotides were labeled using Klenow polymerase (Roche) with [a- 32 P]dATP (Amersham Biosciences) and unincorporated nucleotides were removed by gel filtration on Sephadex G25 spin columns (Roche). Labeled oligonucleotides were stored at 4 °Cin10m M Tris/HCl, pH 7.5, 1 m M EDTA, 60 m M NaCl. In vitro translation was performed using the SP6- polymerase TNT Reticulocyte Lysate System (Promega) according to the manufacturer’s instructions and stored at )70 °C. Binding reactions were performed in a total volume of 12 lLconsistingof20m M Hepes pH 7.4, 80 m M NaCl, 20 m M KCl, 2 m M dithiothreitol, 1 lg Cot-1 DNA and, if not stated otherwise, 1 lL of reticulocyte lysate or cellular extract. Complete Protease Inhibitor was added according to the manufacturer specifications (Roche). Binding reac- tions were incubated for 30 min followed by the addition of 2 lL of the labeled oligonucleotides and incubated further for 30 min at room temperature. For the supershift and for the analysis of the serum activity, 2 lL of serum diluted in NaCl/P i was added before loading and incubated for an additional 30 min. Complexes were resolved by nondena- turing PAGE in 0.5 · Tris/borate/EDTA (45 m M Tris base, 45 m M boric acid, 1 m M EDTA) at 4 °Cat20VÆcm )1 for 4 h. The gels were dried, analyzed with the Fujix BAS 2000 bioimaging system by the TINA TM software (Raytest) and exposed to BioMax MR film (Kodak). Oligonucleotides used were as follows: SIS 5¢-ctaca gaAGGTCAAGGTCAaatgaag-3¢; LFRE 5¢-gttgcaCCT TCAAGGTCAtctgaac-3¢;DR-05¢-agcttcAGGTCAAGG TCAgagagct-3¢;DR-0A5¢-agcttcACCTCAAGGTCAga gagct-3¢;ERE5¢-gttcAGGTCActgTGACCTgacctg-3¢. Sequences corresponding to half-sites are capitalized. The sequence of one strand is shown after the fill-in reaction. Serum treatment The serum was stored at )20 °C. Aliquots were incubated for 20 min at 22 °C, 65 °C, 70 °C, 75 °C, 80 °C, and 95 °C, respectively. Samples were centrifuged for 10 min at 13 000 g and the supernatant was used in EMSA. Treatment with 4 volumes of organic solvents was for 20 min at room temperature. Samples were centrifuged for 10 min at 13 000 g. The supernatant of the precipitation with ethanol, methanol, isopropanol, and acetone was dried in a speed-vac concentrator and suspended in 0.5 volumes NaCl/P i . The precipitates were dried at room temperature and resuspended in 1 volume of NaCl/P i . The organic phase of the extraction with ethanol and with chloroform were dried and resuspended in 0.5 volumes of NaCl/P i . Charcoal treatment was overnight. Cell lysates Cells were grown to approximately 80% confluence on 92 mm tissue culture dishes, washed twice with NaCl/P i , and harvested in 1.5 mL NaCl/P i by gently scraping with a rubber policeman. Cells were centrifuged with 300 g and the pellet was resuspended in lysis buffer (3 lLÆmg )1 ,20m M Tris/HCl, 100 m M NaCl). Cells were lysed by freeze–thaw, centrifuged (16 000 g) and the supernatant was stored at )80 °C. Far-Western based protein–protein interaction For the far-Western overlay binding assay 3 lLof reticulocyte lysate programmed to synthesize the indicated proteins was subjected to SDS/PAGE using 10% acryl- amide and transferred by semidry electroblotting to poly(vinylidene difluoride) (PVDF) membranes. Further incubations were carried out on an orbital shaker. The proteins were partially renatured by first incubating the membrane in 6 M guanidine/HCl, which was stepwise diluted in buffer A (25 m M Hepes, pH 7.5, 25 m M NaCl, 5m M MgCl 2 ,1m M dithiothreitol) to 0.187 M .After renaturation, the membrane was incubated at room temperature for at least 2 h in buffer A with 0.05% NP40 and 5% milk powder. The membranes were then overlaid overnight at 4 °CwithERRc,synthesizedby in vitro translation in the presence of [ 35 S]methionine (>1000 CiÆmmol )1 ; Amersham Biosciences) and diluted 1 : 400 in buffer B (20 m M Hepes, pH 7.5, 75 m M KCl, 0.1 m M EDTA, 2.5 m M MgCl 2 ,1m M dithiothreitol, 1% milk powder, 0.05% NP40). The membranes were then washed three times in buffer B, each wash lasting at least 10 min. Signals were detected with a Fujix BAS 2000 4088 M. Hentschke et al. (Eur. J. Biochem. 269) Ó FEBS 2002 bioimaging analyzer and autoradiographed with Kodak BioMax MR film. RESULTS Increased DNA binding of in vitro generated ERRc in the presence of serum In order to analyze the DNA interaction of ERRc, the full- length cDNA coding for ERRc2 was cloned into an in vitro translation vector and a rabbit antiserum was generated. The antiserum, aERR, was directed against the peptide AcNH 2 -YDDCSSTIVEDPQTK-CONH 2 , encoded by the exon that also codes for the amino acids of the first zinc- finger. Western blot analysis revealed that the antiserum recognizes in vitro expressed ERRc (not shown). The DNA-binding specificity was determined by incubation of in vitro translated ERRc and incubated with the GCNF response element SIS [33], and with the ERRa response element LFRE [16], both sharing the core sequence 5¢-TCAAGGTCA-3¢, followed by an electrophoretic mobility shift analysis (EMSA) (Fig. 1A,B). A weak complex was observed on both elements in the absence of the antiserum. Although the intensity of this complex varied slightly in the presence of serum, the most remark- able difference is a tremendous increase of two new protein–DNA complexes in the presence of serum. Appar- ently, these novel bands are ERRc–DNA complexes bound by one and two antibodies, respectively. The experiment offers three major conclusions. Firstly, two elements, the DR-0 element of the human bPDGF promoter (SIS) and an extended half-site of the lactoferrin promoter (LFRE) are bound by ERRc. These elements have previously been shown to be binding sites for GCNF, and for both, ERRa and GCNF, respectively [16,33,34]. Secondly, the antiserum recognizes the native protein when it is bound to DNA. Thirdly, the DNA binding activity is promoted by the presence of aERR. To distinguish between the effect of specific ERRc-antibodies and an undefined function of the serum, binding was performed in the presence or absence of the preimmune serum. Again, an increase of binding was observed; however, as expected, this was mainly due to an increase of the faint complex present in the absence of serum (Fig. 1C). In the presence Fig. 1. Binding of ERRc is modulated by the presence of serum. EMSA of in vitro translated ERRc withSIS,aDR-0elementandwithLFREan extended half-site. (A, B) Supershift of ERRc-SIS (A) and ERRc-LFRE (B) complexes by increasing amounts of antiserum a-ERR. Constant amounts of the binding element and of in vitro generated ERRc were subjected to electrophoresis in the absence (lanes 1), and in the presence of 0.004 lL (lanes 2), 0.008 lL (lanes 3), 0.016 lL (lanes 4), 0.03 lL(lanes5),0.06lL (lanes 6), 0.13 lL (lanes 7), 0.25 lL(lanes8),0.5lL (lanes 9), 1 lL (lanes 10), and 2 lL (lanes 11) of a-ERR. (C) Increasing amounts of the preimmune serum (PIS) result in an increase of the ERRc- SIS complex. The binding reaction was subjected to electrophoresis in the absence (lane 1), and in the presence of ERRc (lanes 2–12) with increasing amounts of PIS [0.004 lL(lane3)to2 lL (lane 12)]. (D) Binding was performed in the absence (lanes 1–7), and in the presence of 1 lL PIS (lanes 8–12) with increasing amounts of ERRc (0.06 lL in lanes 1 and 7; 0.13 lL in lanes 2 and 8; 0,25 lL in lanes 3 and 9; 0.5 lLinlanes4 and 10; 1 lL in lanes 5 and 11; 2 lL in lanes 6 and 12). The ERRc–DNA complexes are marked by an arrow, the ERRc–DNA complexes bound by a-ERR are indicated by arrowheads. SIS and LFRE indicate free DNA. Ó FEBS 2002 DNA binding of ERRc (Eur. J. Biochem. 269) 4089 of constant amounts of serum, less in vitro translated ERRc was necessary for DNA binding (Fig. 1D). Taken together, these experiments reveal that although a specific protein–DNA complex of in vitro generated ERRc is formed in the absence of serum, lower ERRc-concentra- tions are needed in the presence of serum. Increased binding activity in the presence of serum is heat sensitive Having identified serum as a stimulating factor, we next thought to elucidate the nature of this activity. To initiate the characterization of the stimulating serum effect, its sensitivity against heat was tested. Rabbit serum was treated for 20 min at various temperatures, centrifuged, and the supernatant was analyzed by EMSA (Fig. 2A). The stimu- lating effect, still present at a temperature of 75 °C, was absent after incubation at 80 °C. Precipitation of the proteins was not observed at 70 °C, some precipitation occurred at 75 °C, and massive precipitation was found at higher temperatures. Hence, the stimulating factor in the serum is either heat-sensitive, e.g. a protein, or associated with the precipitate. Characterization of the stimulating activity For further characterization of the stimulating factor, the serum was subjected to various treatments. Whereas a size exclusion assay with a Bio-Gel P30 spin column of an exclusion limit of about 40 000 Da demonstrated that the activity was in the fraction of the large molecules, a microdialysis with a nitrocellulose membrane with a pore size of 0.025 lm did not diminish the effect (not shown). After precipitation with ethanol, methanol, isopropanol or acetone, the activity was detected in the precipitate (Fig. 2B). Because the effect might be due to a small molecule tightly associated with a protein, the serum was subjected to several extraction methods. Extraction using ethanol, chloroform, or ether could not separate the activity from the hydrophilic phase. In addition, the activation factor did not quantita- tively interact with charcoal (Fig. 2B). Hence, the factor in the serum may be a protein, e.g. serum albumin, stabilizing a conformation with a higher DNA affinity, or a small molecule tightly associated with a protein. To distinguish an indirect mechanism mediated by constituents of the reticulocyte lysate from a direct effect on ERRc, binding of bacterial expressed GST–ERRc fusion protein was investigated. No binding of the affinity purified fusion protein was detected in the absence of serum. Again, addition of serum greatly enhanced binding to DR-0, thereby excluding indirect mechanisms (Fig. 3A). In addition, expression in E. coli allowed analyzing of a possible direct effect of the reticulocyte lysate on DNA binding. Indeed, the addition of lysate, programmed to synthesize the unrelated protein luciferase, stimulated binding of ERRc (Fig. 3A). Furthermore, Fig. 2. Characterization of the activating func- tion of the serum. (A) Binding of ERRc to SIS was analyzed in the presence (lanes 1–10) and in the absence of rabbit serum (lane 11). Prior to binding, the serum was subjected to increasing temperatures as indicated. (B) Binding of ERRc toSISintheabsence(lane1) and in the presence of bovine serum (lane 2–18). Serum was not treated (lanes 2, 18), or precipitated with ethanol (lanes 3, 4), meth- anol (lanes 5, 6), isopropanol (lanes 7, 8) or aceton (lanes 9, 10), as indicated. The preci- pitates(lanes3,5,7,9)andtherespective supernatants (lanes 4, 6, 8, 10) were tested. After organic extraction, with ethylacetate (lanes 11, 12), chloroform (lanes 13, 14), and diethylether (lanes 15, 16), the hydrophilic (lanes 11, 13, 15) and the organic phase (lanes 12, 14, 16) were analyzed. In lane 17 the binding reaction was supplemented with charcoal-treated serum. The ERRc–DNA complexes are marked by arrows, f indicates free DNA. 4090 M. Hentschke et al. (Eur. J. Biochem. 269) Ó FEBS 2002 bovine serum albumin and highly purified human serum albumin, both activated DNA binding of the bacterial expressed protein. (Fig. 3B). However, ovalbumin does not enhance DNA binding, suggesting that the effect is not a pure function of the protein concentration (data not shown). The detection of factors stimulating the DNA binding activity in reticulocyte lysate suggests that cellular constit- uents may have a stimulating activity. To address this issue, we tested whole cell extract derived from CV-1 cells, NIH/ 3T3 cells and P19 cells, respectively (Fig. 3C). All extracts stimulated the binding activity GST–ERRc fusion proteins suggesting a physiological function of the enhancement of DNA binding. A sequence element in the hinge region is essential for the stimulating effect As demonstrated above, limiting factors greatly enhanced the formation of ERRc–DNA complexes. As a conse- quence, it should be possible to map elements in the receptor as targets of these factors. To this end, the truncated protein ERRc-218 coding for the first 218 amino acids, and two fusion construct of the N-terminal part of GCNF with the C-terminal part of ERRc, GE-2 and GE-3 (Fig. 4A), were tested. GE-2 covers amino acids 1–167 of GCNF and 213–458 of ERRc, whereas GE-3 covers amino acids 1–271 of GCNF and 240–458 of ERRc.ASalI restriction site at the fusion codes for two additional amino acids, valine and aspartic acid. In both fusion proteins DNA binding is mediated by GCNF. The truncated in vitro translated protein ERRc-218, lacking amino acids forming the LBD and the C-terminal part of the hinge region, still binds to DNA, and the addition of serum results in increased binding (Fig. 4B). Consequently, the LBD is not necessary for the activating function of the serum. Hence, an allosteric conformational switch by binding of a steroid ligand bound to a carrier in the serum is very unlikely. At least some of the target sequences must be located either in the A/B domain, the DBD, or the hinge region. As expected, binding of GCNF is not increased by serum addition. The same is true for GE-3 in which most of the LBD of GCNF is replaced by that of ERRc,further demonstrating that the LBD is not involved in the activation. We conclude that the LBD is neither essential for the activation, nor does its fusion to a homologous protein result in a transfer of the activity. However, the binding of GE-2, in which the C-terminal part of the hinge and the LBD of GCNF are replaced by the corresponding domains of ERRc, is greatly stimulated by serum (Fig. 4B). Accordingly, the ERRc-hinge region confers the activation. ERRc-218 and GE-2, both affected by the addition of serum, have a sequence overlap of six amino acids. These results suggest a central role of the common sequence, ÔNH 2 -RIDAEN-COOHÕ, in the stimulating effect. Three of these amino acids are charged, further implying that the stimulating effect is not induced by lipophilic ligand receptor interaction. A comparison with the homologous receptors ERRa,ERRb,ERa,andERb and a data base search in the nonredundant protein data base revealed that the ÔRIDAENÕ element is unique for ERRc. ERRc binds as a homodimer to DNA Dimerization is essential for the function of most nuclear receptors. Previously, ERRc wasreportedtobindasa monomer to DNA [28]. However, a recent report assumes that ERRc binds also as a dimer to DNA [35]. For ERRa and ERRb, monomeric and dimeric binding has been demonstrated [3]. The repeat nature of the binding site, and thefactthatERRc–DNA complexes have a mobility very similar to a GCNF homodimer and to a PPARc/RXRc heterodimer (not shown), suggest that ERRc binds to DNA preferentially as a dimer. To address the dimerization properties of ERRc in solution, we constructed the mutant DN-ERRc in which the entire N-terminal domain of ERRc is deleted (Fig. 4A). This mutant still binds to DR-0 and forms protein–DNA Fig. 3. Binding of a bacterial expressed GST– ERRc fusion protein depends on factors present in serum and in cellular extracts. The purified GST–ERRc fusion protein was tested for binding to the SIS element. Only the upper half of the autoradiograph is shown. (A) Binding without additional factors, and in the presence of fetal bovine serum (FCS) and reticulocyte lysate (RL), as indicated. (B) Binding in the presence of bovine serum albumin (BSA) and human serum albumin (HSA), respectively. (C) Whole cell extracts of the kidney derived cell line CV-1, of NIH/3T3 fibroblasts, and of the embryonal carcinoma cell line P19, were incubated with the SIS ele- ment in the absence and in the presence of the GST–ERRc fusion protein, as indicated. Ó FEBS 2002 DNA binding of ERRc (Eur. J. Biochem. 269) 4091 complexes with a mobility higher than that of the wild-type receptor (Fig. 5, compare lanes 1 and 2). The mixing of ERRc with DN-ERRc results in the formation of DNA- bound ERRc/DN-ERRc heterodimers, which migrate with a mobility intermediate between those of the homodimeric ERRc and DN-ERRc complexes. (Fig. 5). Dimeriziation is detected on DR-0, and also in weaker complexes formed on the extended half-site DR-0 A, and on ERE, an inverted repeat with a spacing of three base pairs, the classical estrogen response element. DNA binding of C-terminal deletion mutants Dimerization motifs are commonly found in the DBDs including the CTE and in the C-terminus of nuclear receptors [36–38]. To identify sequence elements in the LBD that contribute to DNA binding, a series of C-terminal truncated ERRc polypeptides comprising the first 218–448 amino acids of the 458 amino acid full-length protein were generated (Fig. 4A). An SDS/PAGE analysis of the proteins generated by in vitro translation in the presence of [ 35 S]methionine demonstrated their synthesis in similar amounts (not shown). Binding to DR-0 was tested in comparison to the full-length protein, to DN-ERRc,to GE-2, and to GE-3. ERRc-448, lacking the C-terminal nine amino acids, the sequence harboring the H12 a helical region still binds to DNA [31] (Fig. 6). Although the protein migrates faster during denaturing gel electrophoresis, the protein–DNA complex has a slightly reduced mobility when compared to the full-length ERRc. This may be either due to a conformational change or to differences in the surface charge distribution of the truncated receptor. Further truncation of additional 41 amino acids in mutant ERRc-408 gives rise to a much weaker complex indicating a reduced DNA affinity that may be the result of an impaired folding or a reduced dimerization function. Again, the complexes migrate slightly slower when compared to Fig. 5. ERRc binds as a homodimer to DNA. Binding of the full-length ERRc (lanes 1, 4, 7), the N-terminal truncated protein DN-ERRc (lanes 2, 5, 8) and a mixture of both proteins (lanes 3, 6, 9) were subjectedtoanEMSAwiththeindicatedDNAelements(SIS:aDR-0 element of the bPDGF promoter; DR-0A: an extended half-site; ERE, an estrogen response element of the vitellogenin promoter). The position of the ERRc–DNA complexes (double arrow) of the DN-ERRc–DNA complexes (arrow), and of the heterodimer (arrowhead) are indicated. Fig. 4. Localization of the ERRc domain involved in the enhanced DNA binding. (A) Schematic view of truncated ERRc andfusionproteinsof GCNF and ERRc used in this study. The position of the N-terminal A/B-domain, the DBD (C-domain), the hinge region (D- D omain), and the LBD (EF domain) are indicated. For the truncated protein, the first and last amino acid is indicated with respect to the full-length protein. In the chimeras GE-1, GE-2, and GE-3 the numbering refers to the amino acids of GCNF and ERRc, respectively. (B) Binding of the truncated protein ERRc-218, of the fusion proteins GE-2 and GE-3, and of GCNF to SIS in the presence and in the absence of a rabbit serum (RS), as indicated. The positions of the complexes of SIS with ERRc-218 (double arrow), GE-2 (open arrowhead), GE-3 (filled arrowhead), and GCNF (arrow) are indicated. 4092 M. Hentschke et al. (Eur. J. Biochem. 269) Ó FEBS 2002 full-length proteins. All three proteins form an additional weak and faster migrating complex, apparently a monomer. The intensity of this band is not affected by the truncations, indicating that reduced binding of the dimer is due to inefficient dimerization. The truncated ERRc-408 lacks the a helices 10–12. Helices 9 and 10 have been implicated in dimerization of various nuclear receptors. A crystal struc- ture of the RXRa LBD revealed a dimer interface formed mainly by helix 10 and, to a lesser extent, helix 9 and the loop between helix 7 and helix 8 [39]. A weak dimer is formed by ERRc-376, a truncated protein lacking helix 9. Further truncation of helices 6–8 in ERRc-331, and helices 4–8 in ERRc-285 results in much smaller, weak complexes. In contrast, the smallest truncated protein, ERRc-218, lacking the whole LBD and part of the hinge region shows a robust complex (Fig. 6). This protein consists of the DBD and includes 25 amino acids of the D domain and therefore the CTE. Several conclusions can be drawn from the binding analysis. According to the conserved a helical sandwich structure, as determined for ERa [40,41] and more recently for ERRc [31], a dimerization function can be assigned to a region containing ahelices 10 and 11. The increase of binding by the additional deletion of the a helices 1–3 and of the C-terminal part of the hinge region (compare ERRc-218 and ERRc-285) suggests that these elements offer some steric hindrance for dimerization or DNA binding. An additional dimerization function can be assigned to the N-terminal 218 amino acids. In analogy to other nuclear receptors, this function is proposed to be located in the DBD including the CTE [36,37]. Taken together, these results imply homophilic interaction of ERRc on various NR response elements mediated by at least two dimerization modules. Dimerization function of ERRc Two nuclear receptor dimerization interfaces have been defined, one within the DBD and one within the LBD. A two step-model for dimeric binding of RXR heterodimers has been proposed. First, heterodimers would be formed through their dimerization interfaces contained in the LBD, and in a second step the DBDs would be able to bind with high affinity to DNA [42]. In order to analyze to what extent dimerization of the truncated proteins is impaired in the absence of DNA, C-terminal deletion proteins ERRc-448 to ERRc-218 were separated by SDS/PAGE and subjected to a far-Western analysis, a method based on direct protein- interaction. Only ERRc-448 was identified as binding partner of the full-length protein labeled by incorporation of [ 35 S]methionine (Fig. 7A). Further truncation of 41 amino acids abolishes the homophilic interaction. This result is in agreement with the DNA-binding analysis: highly reduced binding of the truncated proteins is most likely the result of the deletion of a dimerization function, whichcanbelocatedtothea helical region 10–11. On the other hand, the smallest deletion mutant tested, ERRc-218, binds to DNA but does not dimerize with the full-length protein under far-Western conditions (Fig. 7A). The dimer- ization of this mutant may be dependent on the presence of the DNA-response element. As in solution, the full-length protein binds to DN-ERRc, the N-terminal truncated protein. The chimeric protein GE-1 (GCNF1-140/ ERRc196–458) containing the 263 C-terminal amino acids of ERRc is efficiently bound by labeled ERRc (Fig. 7B). This interaction indicates that the dimerization motifs in the C-terminus function independently of the motifs in the DBD. Decreasing amounts of ERRc-specific residues in GE-2 and GE-3 are accompanied by reduced and abolished interaction, respectively. Hence, additional amino acids in the D and helix 1 region are important for dimerization. For DNA-independent dimerization, both elements, one located between 219 and 239 and the second between amino acids 409 and 448 are necessary. DISCUSSION In this study, we show that ERRc binds to a DR-0 element, but also to extended half-sites. ERRs have a conserved DBD. Therefore, it is not surprising that they all bind to elements with the extended half-site element TCAAGGTCA. In addition, a weak complex was detected on ERE, an inverted response element. There are conflicting results in the literature as to whether ERRs bind as monomers or dimers. Our results show that ERRc binds preferentially as a dimer to all of these elements. This has Fig. 6. Binding of truncated and chimeric receptors to a DR-0 element. The full-length protein (lane 1), C-terminal deletions (lanes 2–7), the N-terminal deletion DN-ERRc (lane 8), and fusion proteins GE-2 and GE-3 (lanes 9 and 10) were tested in EMSA. Equal amounts of primed reticulocyte lysate and labeled SIS-binding site were used in each lane. The positions of the DNA complexes with ERRc (filled arrow), ERRc-218 (open arrow), DN-ERRc (double arrow), GE-2 (open arrowhead) and GE-3 (closed arrowhead)are indicated. The position ERRc monomers bound to DNA in lanes 1–3 is indicated by the bracket. Ó FEBS 2002 DNA binding of ERRc (Eur. J. Biochem. 269) 4093 been demonstrated by mixing of an N-terminal truncated protein with the full-length protein. An intermediate band in an EMSA is confirmation of dimerization. Additionally, protein–DNA complexes of the orphan receptor GCNF that binds to DR-0 as a dimer show a very similar migration [43]. An important future question is the identification of functional binding sites and the analysis of a possible cross- talk of receptors with a similar binding site specificity. To further characterize functional domains of the protein, binding of C-terminal truncated proteins to SIS, a DR-0 element of the bPDGF promoter was analyzed by EMSA. Surprisingly, binding of some of the truncated protein gave rise to a slower migrating complex. This phenomenon has also been observed for truncated GCNF bound to DR-0 [44]. Because the analysis was performed under nondena- turing conditions, a reasonable explanation is a less compact structure of the truncated protein, or differences in the surface charge distribution of the truncated receptor. A faster migrating weak complex that appears to be a monomer shows a similar behavior (Fig. 6, lanes 1–3). However, in contrast to the dimer, the intensity of this band is not affected by the deletion, suggesting a reduced dimerization function. The truncated protein ERRc-218, which contains the DBD including its C-terminal extension binds to DNA, suggesting that ERRc has a DNA– dependent dimerization interface. The weak complexes formed by ERRc-408, ERRc-376, ERRc-331, and ERRc- 285 further strengthens the assumption that these trunca- tions have a distorted DNA-independent dimerization. As an independent approach we subjected various deletion mutants and fusion proteins to a direct analysis of protein–protein interaction by far-Western blots. The interaction of the mutated proteins with the radioactive full- length ERRc supported the results of the EMSA. It is important to note that deletion of the N-terminal domain does not influence the dimerization properties of the receptor. However, the C-terminal LBD is important for homophile interactions. The deletion ERRc-408 lacking the helix 10/11 does not dimerize. The crystal structures of the LBDs of hRXRa,hRARc,hTRa, and hERa show that this dimerization is mediated mainly by helices 9 and 10 [39,40,45–47]. A recent analysis of the ERRc LBD shows that it adopts a canonical three-layered a helical sandwich structure and superimposes well with the hER LBD [31]. In addition, the analysis allowed the study of the interaction of a fusion protein with a heterologous DBD. Although ERRc does not bind to GCNF, the fusion protein GE-1, composed of the N-terminal GCNF portion with the DBD and the C-terminal portion of ERRc is bound by full- length ERRc. Therefore, the dimerization function in the C-terminus works independently of the dimerization func- tion in the DBD. In addition, the analysis shows that both, the C-terminal (Fig. 7A, compare lanes 2 and 3), and the N-terminal truncation of the C-terminus (Fig. 7B, compare Fig. 7. A Far-Western analysis deciphers the DNA binding-independent dimerization function of ERRc. (A) C-terminal deletion mutants of ERRc were separated by SDS/PAGE, blotted to a membrane filter, and probed for interaction with 35 S-radiolabeled ERRc (lanes 2–7). The probe, separated on the same gel is shown in lane 1. The arrow indicates the position of ERRc-448. (B) The full-length protein (lane 1), the proteins GE-1, GE-2, GE-3 (lanes 2–4), DN-ERRc (lane 5), and GCNF as a negative control (lane 6) were separated by SDS/PAGE and subjected to a Far-Western analysis as described in A. The arrow indicates the position of ERRc. (C) Schematic representation of ERRc. The position of the dimerization motifs is indicated by black bars, the numbers refer to the amino acids important for dimerization. 4094 M. Hentschke et al. (Eur. J. Biochem. 269) Ó FEBS 2002 lanes 3 and 4) abolish dimerization. Therefore, at least two dimerization interfaces in the C-terminus exist, one located between amino acid 213 and 239, and the second between amino acids 409 and 448. The C-terminal interface includes helix 10, whose function in dimerization is well established for several receptors. For the further N-terminal located interface, the presence of amino acids in the hinge region up to helix 1 in the LBD is important: the CTE is not essential. Interestingly, Tetel et al. reported that the minimal fragment mediating progesterone receptor homodimerization was the hinge-LBD construct [48]. In addition, GST pull down experiments reveal the importance of the D - D omain of the thyroid hormone receptor for homodimerization and hete- rodimerization with RXR. However, in the same experi- mental design, the EF domain of the RXR formed heterodimers with the thyroid hormone receptor [49]. The His-tagged ERRc LBD forms dimers in solution [31]. The discrepancy could be due to the fact that in our study the binding partner is immobilized, the GE-3 starts 11 amino acids further to the C-terminus, or that the GCNF fusion affects dimerization. On the other hand it is possible that the His-tag influences protein interaction [50]. The serum effect is very surprising because in vivo,ERRc should never be in a direct contact with the serum. However, it is possible that a serum factor enters the cell. Co-transfec- tion with ERRs and a reporter gene also suggest a function of serum in transcription activation [13]. Because we achieved activation of binding by purified serum albumin, it appears more likely that the endogenous activators differ from the serum factor. Preliminary results in our laboratory (M. Hentschke, unpublished observations) show that at least two active fractions can be separated by ion exchange chromatography and by gel filtration chromatography of crude P19 cell extracts. The identification of the active components in these fractions will be an important prere- quisite to analyze the mechanism underlying the phenom- enon. A specific effect should be dependent on the presence of sequence elements present in ERRc but not in GCNF. Therefore, we have focussed on the target protein, ERRc. Indeed, the C-terminal deletions reveal that even the binding of the smallest protein analyzed is activated by additional factors. However, neither binding of GCNF, nor of the chimera GE-3 is influenced by additional factors. However, binding of GE-2 with 27 additional amino acids is clearly stimulated by additional factors. Taken together these experiments reveal that amino acids 1–218, and amino acids 213–458 fused to GCNF can mediate this increase in DNA binding. Although, the importance for efficient binding of additional factors has been shown for additional nuclear receptors, to our knowledge this is the first example where a short sequence with a central function in mediating this effect has been identified for ERRs. The question arises as to whether there are other receptors whose binding depends on additional proteins. Indeed, there are several reports about cellular extracts, necessary for efficient binding of steroid hormone receptors [51,52]. The function of the high-mobility group box proteins, HMG-1 and HMG-2, members of the nonhistone chromatin proteins, has been analyzed in more detail. They are recruited to DNA by steroid hormone receptors and although very abundant, subsequently led to an increase in transcriptional activity in transient transfection assays [53–56], but have no effect on binding of several nonsteroid hormone receptors [54]. HMG-1/-2 appear to act by facilitating receptor interaction with target DNA sites [56]. The HMG box contacts the DNA in the minor groove introducing a strong bend [57]. Therefore, the HMG box proteins have been proposed to substitute for the lack of a minor groove-interacting surface in the DBD of the steroid hormone receptors [54,56]. However, they do not result in the supershift of the retarded bands that would be expected if HMGs were present in the complex. A deletion analysis of the androgen receptor indicated that that HMG-1 needs at least part of the CTE and of the hinge region for the stimulation of receptor DNA binding [58]. Whether the observed effect on DNA binding of ERRc can be mediated by HMG box proteins is presently unknown. HMG-1 is a very conserved and abundant protein, which interacts with many apparently unrelated proteins [59]. The recent iden- tification of SRY, a nuclear HMG box-containing protein as an interaction partner of the androgen receptor suggests that additional differential expressed HMG box proteins may be identified as interaction partner of nuclear receptors [60]. The analysis of the ERRc LBD structure revealed that the ligand free conformation is the transcriptionally active form suggesting that alternative mechanisms may be important to regulate the activity of this true orphan [31]. A systematic approach will be necessary to identify the most efficient interaction partners and to understand how these additional proteins succeed to increase DNA binding of ERRc and therefore modulate the activity of this orphan receptor. ACKNOWLEDGEMENTS We thank Prof Schaller for the support of this work. This project was supported by a fellowship to M. H. through the Graduiertenkolleg 255 and is part of his doctoral thesis. Special thanks go to Drs Irm Hermans-Borgmeyer and Sabine Hoffmeister-Ullerich for the fruitful discussion throughout the project, to Simon Hempel for help with the figures and to Cornelia Meyer, Mirja Bernhardt and Anja Nitzsche for assistance during their practical training. REFERENCES 1. Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schu ¨ tz, G.,Umesono,K.,Blumberg,B.,Kastner,P.,Mark,M., Chambon, P. & Evans, R.M. (1995) The nuclear receptor super- family: the second decade. Cell 83, 835–839. 2. Enmark, E. & Gustafsson, J.A. (1996) Orphan nuclear receptors – the first eight years. Mol. Endocrinol. 10, 1293–1307. 3. Gigue ` re, V. (1999) Orphan nuclear receptors: from gene to func- tion. Endocrinol. Rev. 20, 689–725. 4. Green, S. & Chambon, P. (1988) Nuclear receptors enhance our understanding of transcription regulation. Trends Genet. 4, 309– 314. 5. Renaud, J.P. & Moras, D. (2000) Structural studies on nuclear receptors. Cell. Mol. Life Sci. 57, 1748–1769. 6. Khorasanizadeh, S. & Rastinejad, F. (2001) Nuclear–receptor interactions on DNA-response elements. Trends Biochem. Sci. 26, 384–390. 7. Laudet, V. (1997) Evolution of the nuclear receptor superfamily: early diversification from an ancestral orphan receptor. J. Mol. Endocrinol. 19, 207–226. 8. Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J.M., Argos, P. & Chambon, P. (1986) Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320, 134– 139. Ó FEBS 2002 DNA binding of ERRc (Eur. J. Biochem. 269) 4095 [...]... interfaces formed between the DNA binding domains determine the cooperative binding of RXR/RAR and RXR/TR heterodimers to DR5 and DR4 elements EMBO J 13, 1414–1424 37 Zechel, C., Shen, X.-Q., Chen, J.-Y., Chen, Z.-P., Chambon, P & Gronemeyer, H (1994) The dimerization interfaces formed between the DNA binding domains of RXR, RAR and TR determine the binding specificity and polarity of the full-length receptors... on hormone and nonreceptor nuclear factor(s) Mol Endocrinol 3, 381–391 52 De Vos, P., Claessens, F., Celis, L., Peeters, B., Rombauts, W., Heyns, W & Verhoeven, G (1994) Nuclear extracts enhance the interaction of fusion proteins containing the DNA- binding domain of the androgen and glucocorticoid receptor with andro- DNA binding of ERRc (Eur J Biochem 269) 4097 53 54 55 56 57 58 59 60 gen and glucocorticoid... group proteins HMG-1 and -2 Steroid 64, 576–586 Thomas, J.O & Travers, A.A (2001) HMG1 and 2, and related ÔarchitecturalÕ DNA- binding proteins Trends Biochem Sci 26, 167–174 Verrijdt, G., Haelens, A., Schoenmakers, E., Rombauts, W & Claessens, F (2002) Comparative analysis of the influence of the high-mobility group box 1 protein on DNA binding and transcriptional activation by the androgen, glucocorticoid,... Identification of two hERR2-related novel nuclear receptors utilizing bioinformatics and inverse PCR Gene 228, 101–109 23 Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N & Ohara, O (1998) Prediction of the coding sequences of unidentified human genes XII The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro DNA. .. heterodimers and orphan receptors Cell 83, 841–850 43 Borgmeyer, U (1997) Dimeric binding of the mouse germ cell nuclear factor Eur J Biochem 244, 120–127 Ó FEBS 2002 44 Greschik, H., Wurtz, J.-M., Hublitz, P., Kohler, F., Moras, D & ¨ Schule, R (1999) Characterization of the DNA- binding and ¨ dimerization properties of the nuclear orphan receptor germ cell nuclear factor Mol Cell Biol 19, 690–703... Molecular basis of agonism and antagonism in the oestrogen receptor Nature 389, 753–758 41 Shiau, A.K., Barstad, D., Loria, P.M., Cheng, L., Kushner, P.J., Agard, D.A & Greene, G.L (1998) The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen Cell 95, 927–937 42 Mangelsdorf, D.J & Evans, R.M (1995) The RXR heterodimers and orphan receptors Cell... allosteric interactions among nuclear hormone receptors Cell 81, 541–550 39 Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H & Moras, D (1995) Crystal structure of the ligand -binding domain of the human nuclear receptor RXRa Nature 375, 377–382 40 Brzozowski, A.M., Pike, A.C., Dauter, Z., Hubbard, R.E., Bonn, T., Engstrom, O., Ohman, L., Greene, G.L., Gustafsson, J.A & Carlquist, M (1997) Molecular basis of. .. activation and coactivator binding by novel orphan nuclear receptor ERR3 J Biol Chem 274, 22618–22626 25 Susens, U., Hermans-Borgmeyer, I & Borgmeyer, U (2000) ¨ Alternative splicing and expression of the mouse estrogen receptor-related receptor (ERR)c Biochem Biophys Res Commun 267, 532–535 Ó FEBS 2002 26 Lorke, D.E., Susens, U., Borgmeyer, U & Hermans-Borgmeyer, ¨ I (2000) Differential expression of the... U (2000) ¨ Developmental expression of the estrogen receptor-related receptor (ERR) c during mouse embryogenesis Mech Dev 97, 197–199 28 Heard, D., Norby, P., Holloway, J & Vissing, H (2000) Human ERRgamma, a third member of the estrogen receptor-related receptor (ERR) subfamily of orphan nuclear receptors: tissuespecific isoforms are expressed during development and in the adult Mol Endocrinol 14,... structure of the RAR-gamma ligand -binding domain bound to all-trans retinoic acid Nature 378, 681–689 46 Wagner, R.L., Apriletti, J.W., McGrath, M.E., West, B.L., Baxter, J.D & Fletterick, R.J (1995) A structural role for hormone in the thyroid hormone receptor Nature 378, 690–697 47 Tanenbaum, D.M., Wang, Y., Williams, S.P & Sigler, P.B (1998) Crystallographic comparison of the estrogen and progesterone . Domains of ERRc that mediate homodimerization and interaction with factors stimulating DNA binding Moritz Hentschke, Ute Su¨ sens and Uwe Borgmeyer Zentrum fu ¨ r. (1994) Nuclear extracts enhance the interaction of fusion proteins containing the DNA- binding domain of the androgen and glucocorticoid receptor with andro- gen and glucocorticoid response elements acids, and two fusion construct of the N-terminal part of GCNF with the C-terminal part of ERRc, GE-2 and GE-3 (Fig. 4A), were tested. GE-2 covers amino acids 1–167 of GCNF and 213–458 of ERRc, whereas