Towards understanding the functional role of the glycosyltransferases involved in the biosynthesis of Moraxella catarrhalis lipooligosaccharide Ian R Peak1, I D Grice1, Isabelle Faglin1, Zoran Klipic1, Patrick M Collins1, Lucien van Schendel1, Paul G Hitchen2, Howard R Morris3, Anne Dell2 and Jennifer C Wilson1 Institute for Glycomics, Griffith University, Gold Coast Campus, Queensland, Australia Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, UK M-SCAN Mass Spectrometry Research and Training Centre, Silwood Park, Ascot, UK Keywords glycosyltransferase; lipooligosaccharide biosynthesis; Moraxella catarrhalis; MS; NMR spectroscopy Correspondence J C Wilson, Institute for Glycomics, Griffith University, Gold Coast Campus, PMB 50, QLD 4215, Australia Fax: +61 555 28908 Tel: +61 555 28077 E-mail: Jennifer.wilson@griffith.edu.au Database Sequences have been deposited under the accession numbers DQ071425 (2951 locus), DQ071426 (3292 locus) and DQ071427– DQ071431 (lgt2 alleles) (Received 24 August 2006, revised 29 January 2007, accepted 16 February 2007) doi:10.1111/j.1742-4658.2007.05746.x The glycosyltransferase enzymes (Lgts) responsible for the biosynthesis of the lipooligosaccharide-derived oligosaccharide structures from Moraxella catarrhalis have been investigated This upper respiratory tract pathogen is responsible for a spectrum of illnesses, including otitis media (middle ear infection) in children, and contributes to exacerbations of chronic obstructive pulmonary disease in elderly patients To investigate the function of the glycosyltransferase enzymes involved in the biosynthesis of lipooligosaccharide of M catarrhalis and to gain some insight into the mechanism of serotype specificity for this microorganism, mutant strains of M catarrhalis were produced Examination by NMR and MS of the oligosaccharide structures produced by double-mutant strains (2951lgt1 ⁄ 4D and 2951lgt5 ⁄ 4D) and a single-mutant strain (2951lgt2D) of the bacterium has allowed us to propose a model for the serotype-specific expression of lipooligosaccharide in M catarrhalis According to this model, the presence ⁄ absence of Lgt4 and the Lgt2 allele determines the lipooligosaccharide structure produced by a strain Furthermore, it is concluded that Lgt4 functions as an N-acetylglucosylamine transferase responsible for the addition of an a-d-GlcNAc (1 fi 2) glycosidic linkage to the (1 fi 4) branch, and also that there is competition between the glycosyltransferases Lgt1 and Lgt4 That is, in the presence of an active Lgt4, GlcNAc is preferentially added to the (1 fi 4) chain of the growing oligosaccharide, instead of Glc In serotype B strains, which lack Lgt4, Lgt1 adds a Glc at this position This implies that active Lgt4 has a much higher affinity ⁄ specificity for the b-(1 fi 4)-linked Glc on the (1 fi 4) branch than does Lgt1 Glycosyltransferases are enzymes that synthesize the carbohydrate structures of the lipooligosaccharides (LOSs) that are abundant on the surface of Gramnegative bacteria These carbohydrate-rich structures have been implicated in the pathogenic mechanisms of many bacteria Generally, each glycosyltransferase is exquisitely unique, in that it has its own donor, accep- tor and linkage specificity, and a vast array of these enzymes are required to assemble these complex structures [1–3] Recently, there has been some progress towards identifying the genes expressing the glycosyltransferase enzymes involved in LOS biosynthesis in Moraxella catarrhalis, a human upper respiratory Abbreviations APT, attached proton test; BHI, Brain Heart Infusion; DSS, 2,2-dimethylsilapentane-S-sulphonic acid; LOS, lipooligosaccharide; OS, oligosaccharide; TMS, trimethylsilyl 2024 FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS I R Peak et al tract pathogen [4–6] Along with Haemophilus influenzae and Streptococcus pneumoniae, this microorganism is responsible for acute otitis media (middle ear infection) in infants [7] M catarrhalis also contributes to a spectrum of respiratory tract conditions occurring in adult patients and causing or exacerbating sinusitis, pneumonia and chronic obstructive pulmonary disease [7–9] There are three major LOS serotypes of M catarrhalis, A, B and C, which differ in the carbohydrate content of the oligosaccharide component of their LOS These serotypes represent 61%, 28.8% and 5.3% of clinical isolates in one study [10] Structural analysis has revealed the oligosaccharide structure of each of the serotypes [11–14] Several glycosyltransferase-encoding genes have been identified for serotypes A and B, but the exact function of some of the glycosyltransferase enzymes remain unclear [4–6] Furthermore, the mechanism of LOS biosynthesis with regard to serotype specificity remains to be elucidated for this microorganism Herein are described two double-mutant strains of M catarrhalis 2951, namely, 2951lgt1 ⁄ 4D and 2951lgt5 ⁄ 4D In addition, a singlemutant strain 2951lgt2D is also described The oligosaccharide structures produced by these mutant strains have provided significant insights into the sequential addition of carbohydrate moieties to the final LOS structure Furthermore, examination of these oligosaccharide structures has revealed the following: (a) lgt4 encodes an N-acetylglucosamine transferase; and (b) removal of the lgt4 gene leads to replacement of a GlcNAc with a Glc These findings have prompted us to conclude that there is competition between glycosyltransferases Lgt1 and Lgt4 Results In order to investigate the function of the glycosyltransferase enzymes involved in the biosynthesis of LOS of M catarrhalis, and to gain some insights into the mechanism of serotype specificity for this microorganism, mutant strains of M catarrhalis were produced Mutation of genes encoding the glycosyltransferase enzymes that assemble the LOS of M catarrhalis leads to mutant bacteria that produce truncated oligosaccharide structures Examination of the truncated oligosaccharide structures has allowed us to infer a function for the role of the glycosyltransferase enzymes in LOS biosynthesis The oligosaccharide structures isolated from these mutant bacteria are designated 2951lgt2D, 2951lgt1 ⁄ 4D, and 2951lgt5 ⁄ 4D Moraxella catarrhalis LOS biosynthesis Analysis of the genes encoding the glycosyltransferase enzymes responsible for LOS biosynthesis for serotype A M catarrhalis Table gives the strains and plasmids utilized in this study Table summarizes the oligonucleotide primers used to amplify or sequence the glycosyltransferase genes lgt2 Sequence analysis of lgt2 from CCUG 3292 (serotype B) revealed that it is 765 bp in length, and is identical to that of the reported serotype B strain 7169 (described as lgt2B ⁄ C by Edwards et al [5]) The corresponding gene from serotype A strain 2951 (lgt2A) is also 765 bp long, but differs significantly from lgt2B ⁄ C: these alleles differ by only one nucleotide in the first 287 nucleotides, whereas the remainder of the gene is only 52% identical, giving an overall 70% identity The lgt2 gene was amplified and sequenced from several strains of different serotypes (described in Table 1), using primers UORF2:2205 (within the conserved 5¢ region of lgt2) and DORF3:3434 (within lgt1) Our results confirm a previous report [5] that all serotype B and C strains contain the lgt2B ⁄ C allele, whereas all serotype A strains contain the lgt2A allele The function of the lgt2A allele has not been previously described lgt1, lgt4, and lgt5 Amplification and sequencing of lgt1 from CCUG 3292 (using primers DORF3:2768 and UORF3:4093) revealed an identical sequence to that of lgt1 of strains 7169 (serotype B [4]), and ATCC 43617 (serotype B [5]) Amplification using these primers from strain 2951 produced a molecule approximately kbp larger than that from the serotype B strain CCUG 3292 Sequence analysis of this larger fragment revealed that it contains an lgt1 allele (984 bp, 95% identical to lgt1 of ATCC 43617 and 7169), and an additional ORF of 996 bp with similarity to glycosyltransferase-encoding genes The presence of this additional gene, lgt4, was previously reported in strains of serotypes A and C [5], and our PCR and sequence analysis results confirm that this gene is restricted to strains of serotypes A and C, although its function has not been described to date We have previously described an additional gene, lgt5, present in all serotypes, that encodes an a-(1 fi 4)-galactosyltransferase [6] FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS 2025 Moraxella catarrhalis LOS biosynthesis I R Peak et al Table Strains used in this study, and plasmids used for mutagenesis Strain Moraxella catarrhalis 2951 2951galE CCUG 3292 ATCC 25238 ATCC 25239 CCUG 26394 CCUG 26397 CCUG 26400 CCUG 26404 CCUG 26391 2951lgt2D 2951lgt1 ⁄ 4D 2951lgt5 ⁄ 4D Escherichia coli DH5a Plasmid ⁄ vector pBluescriptSK pGemT-Easy pUC4kan For mutation of lgt2 p2 : 3292 pRA1 p2Kan For mutation of lgt1 ⁄ pIF1.4 pIF1.4AN pK8 For mutation of lgt4 ⁄ p4:3292 p4:3292K Genotype, relevant phenotype, or comment Source ⁄ Reference Wild type, serotype A, LOS structure determined UDP-glucose-4-epimerase deficient Wild type, serotype B, LOS structure determined Wild type, serotype A, LOS structure determined Wild type, serotype A Wild type, serotype A, strain D6 Wild type, serotype B, strain F17 Wild type, serotype B, strain J9 Wild type, serotype C, strain W3 Wild type, serotype C, strain B3 lgt2::kanr, 2951 transformed with p2Kan lgt1::kanr, Dlgt4, 2951 transformed with pK8 lgt5::kanr, Dlgt4, 2951 transformed with p4:3292K [27] [27] CCUG ATCC ATCC CCUG [10] CCUG [10] CCUG [10] CCUG [10] CCUG [10] This study This study This study /80 dLacZDM15 recA1 endA1 gyrA96 thi-1 hsdR17 (rk–,mk+) supE44 relA1 deoRD(lacZYA-argF)U169 Invitrogen F1(+) ColE1 ori lacZa Ampr F1 ori lacZ Ampr pBR322 ori lacZ AmprKanr Stratagene Promega Pharmacia lgt23292 UORF2:2040 and DORF2:3120 in pGemT-Easy lgt23292 in pBluescript (PstI site deleted from vector) As pRA1, kanr in PstI site of lgt2 This study This study This study lgt13292 DORF3:2768 and UORF3:4093 in pGemT-Easy As pIF1.4, with StyI site removed from vector As pIF1.4AN, with kanr in StyI site of lgt1 This study This study This study UORF4:3684 and DORF4:5047 in pGemT-Easy As p4:3292, with kanr in XbaI site of lgt5 This study This study Table Oligonucleotide sequence used to amplify and ⁄ or sequence the glycosyltransferase genes Oligonucleotide sequence (5¢– to 3¢) Primers used to amplify and ⁄ or sequence lgt2 UORF2:2040 CATGGCATCGATGGGCTATAC UORF2:2205 GTAACACCCACTGATATTAGC DORF2:3120 AGTGGGGCTTTTGTCAGACAG Primers used to amplify and ⁄ or sequence lgt1 UORF3:4093 ATCACCAATCCATAATGCATG DORF3:2768 ATGTAATCAGCATCGAAGACG DORF3:3434 GCGTATTAAGAACTTACAAGG 2951:DORF3A AACTCAACAAGATAGTCAAAC 2951:UORF3A ATGATAAAGTACTCAATGGTG Primers used to amplify and ⁄ or sequence lgt4 + lgt5 UORF4:3684 TCAATTTGCTCATGTAATGGC 2951:UORF4A ACAGGACAGCCCAAATATAAG 2951:UOrf4B AAAAGGTGTCGTAATCTCACC 2951:DOrf4B GTGAGATTACGACACCTTTTG DORF4:4515 TTTCTAGATTTATACCATGGTG DORF4:4132 AAAAGAAGACAAACAAGCAGC DORF4:5047 TTATCGGTACATATTGATTGG 2026 Comment Forward or reverse with respect to orientation of submitted sequences Within lgt3 Within lgt2 Within lgt1 R R F Within Within Within Within Within F R R F R lgt5 lgt2 lgt1 lgt22951 lgt4 Within lgt1 Within lgt4 Within lgt4 Within lgt4 Within lgt5 Within lgt5 Downstream of lgt5 F F F R R R R FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS I R Peak et al Structural analysis of the oligosaccharide derived from single-mutant (2951lgt2D) and double-mutant (2951lgt1 ⁄ 4D and 2951lgt5 ⁄ 4D) strains of serotype A M catarrhalis The genes lgt1, lgt2 and lgt5 were cloned from strain CCUG 3292, and disrupted by insertion of Kanr into convenient restriction sites within each ORF (Fig 1) Linearized plasmid containing the mutant allele was transferred into strain 2951 by natural transformation Allelic replacement was confirmed by PCR Moraxella catarrhalis LOS biosynthesis B, and C) could be confirmed by 3J1,2 coupling constants from a 1H-NMR spectrum However, 3J1,2 coupling constants could not be determined for the anomeric protons of residues D and E, due to overlap, or for the anomeric proton of residue G, which overlaps with the signal from H5 of residue C Complete assignment of the Kdo residue was possible by examination of TOCSY correlations with the well-dispersed H3 and H8 methylene protons of Kdo Glycosidic linkages for each sugar residue in the oligosaccharide were confirmed by examination of 400 ms NOESY and 1H-13C-HSQC-NOESY spectra 2951lgt2D MS analysis of the LOS oligosaccharide showed that mutation of the gene encoding Lgt2 results in a truncated oligosaccharide as compared to the oligosaccharide produced by the wild-type bacteria (Fig 2) Negative-ion ESI-MS spectra for the 2951lgt2D oligosaccharide gave a molecular ion signal at m ⁄ z 1251, consistent with the calculated molecular mass for an oligosaccharide of composition Hex5ỈHexỈNAcỈKdo (1252 atomic mass unit) MALDI-MS analysis of the methylated oligosaccharide (75% acetonitrile fraction from Sep-pak C18 purification) yielded a molecular ion signal at 1611 m ⁄ z [M + Na]+, supporting this assignment GC-MS sugar analysis [trimethylsilyl (TMS) derivative] confirmed the presence of Glc, GlcNAc and Kdo, whereas GC-MS linkage analysis of the permethylated sample identified terminal Glc, terminal GlcNAc, 2-linked Glc, and 3,4,6-linked Glc (Table 3) For each of the oligosaccharides studied, NMR spectral assignment was aided by a combination of one-dimensional and two-dimensional experiments, including 1H, 13C-attached proton test (APT), COSY, H-13C-HSQC and 1H-13C-HSQC-TOCSY and edited versions of these experiments Chemical shift assignments for 2951lgt2D are given in Table The sequence of the sugar residues was confirmed by examination of 400 ms NOESY and 1H-13C-HSQC-NOESY experimental results For the 2951lgt2D oligosaccharide, complete 1H chemical shift assignment of the highly branched a-d-glucose residue (residue C) was made possible by examination of the COSY spectra, as many of the ring protons for this residue lie outside the crowded 3.2–4.1 p.p.m region of the spectra For the other hexose residues, the anomeric and H2 protons could also be assigned using the COSY spectra H and 13C chemical shift assignments for the other ring protons and carbons were possible using the H-13C-HSQC-TOCSY spectra in combination with the 13C-APT and 1H-13C-HSQC spectra The anomeric configuration for three of the six hexoses (residues A, 2951lgt1 ⁄ 4D An lgt1 ⁄ double mutant was constructed by transforming the 2951 strain with the lgt13292::KAN construct As 3292 does not contain lgt4, this construct recombined in lgt1 and lgt5 (confirmed by PCR and sequencing), inactivating lgt1 as a result of the Kanr insertion, and also deleting lgt4 (Fig 1B): it was confirmed that the construct had not illegitimately recombined in lgt2, as lgt2 was amplified and sequenced from strain 2951lgt1 ⁄ 4D using primers UORF2:2040 and DORF2:3120 and found to be identical to lgt22951 Mutation of the genes encoding Lgt1 and Lgt4 results in a very truncated oligosaccharide (Fig 2) as compared to the oligosaccharide produced by the wildtype bacteria Negative-ion ESI-MS spectra for the 2951lgt1 ⁄ 4D oligosaccharide gave a molecular ion at m ⁄ z 886 consistent with the composition Hex4ỈKdo MALDI-MS analysis of the methylated oligosaccharide (75% acetonitrile fraction from Sep-pak C18 purification) gave a molecular ion at m ⁄ z 1161 [M + Na]+, supporting this assignment GC-MS sugar analysis confirmed the presence of Glc and Kdo The sample failed to give GC-MS linkage data; however, the NMR data described below are unequivocal H and 13C assignments for the 2951lgt1 ⁄ 4D oligosaccharide are given in Table Chemical shift assignment for this oligosaccharide was relatively straightforward, due to the excellent signal dispersion and the reduced number of sugar residues, as shown in Fig The chemical shift for each of the anomeric signals was significantly different from those chemical shifts for the same residue in the less truncated oligosaccharides 2951lgt2D and 2951lgt5 ⁄ 4D This has previously been noted for the synthetically prepared analog of the 2951lgt1 ⁄ 4D oligosaccharide [15] Complete assignment of residue C, the central a-d-Glc residue linked to the Kdo and three b-d-Glc residues via (1 fi 6), (1 fi 4) and (1 fi 3) glycosidic linkages, was achieved by examination of a COSY FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS 2027 Moraxella catarrhalis LOS biosynthesis I R Peak et al Fig Schematic representation of LOS biosynthetic locus of strains 3292 (serotype B) and 2951 (serotype A), including constructs for mutagenesis Large open arrows represent ORFs that are highly similar between strains Filled regions of arrows represent sequence diversity between strains Small arrows represent oligonucleotide primers used for amplification (A) Construction of plasmid for mutation of lgt2: lgt2B ⁄ C and flanking sequence were amplified from strain 3292 using primers UORF2:2040 and DORF2:3120, and disrupted by insertion of kanr into the PstI site Transformation of strain 2951 resulted in allelic replacement (B) Construction of plasmid for mutation of lgt1 and deletion of lgt4: lgt1 and flanking sequence were amplified from strain 3292 using primers UORF3:4093 and DORF3:2768, and disrupted by insertion of kanr into the StyI site Transformation of strain 2951 resulted in recombination within lgt5 and lgt1, resulting in deletion of lgt4 and disruption of lgt1 (C) Construction of plasmid for mutation of lgt5 and deletion of lgt4: lgt5 and flanking sequence were amplified from strain 3292 using primers DORF4:5047 and UORF4:3684, and disrupted by insertion of kanr into the NsiI site Transformation of strain 2951 resulted in recombination within lgt5 and lgt1, resulting in deletion of lgt4 and disruption of lgt5 spectrum, as shown in Fig The anomeric configuration of residue C was confirmed by the 3J1,2 coupling constant of 3.95 Hz The sequential assignment of resi2028 dues D, B and G, the three b-d-Glc residues (each with a 3J1,2 coupling constant of  Hz), was significantly aided by 1H,13C-HSQC-TOCSY and one-dimensional FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS I R Peak et al Moraxella catarrhalis LOS biosynthesis Fig Structures of wild-type serotype A oligosaccharide (strain 2951) and 2951lgt2D, 2951lgt1 ⁄ 4D and 2951lgt5 ⁄ 4D mutant oligosaccharides Letters refer to designated sugar residues selective TOCSY experiments Although the anomeric signals of each of the b-d-Glc residues were well resolved, it was necessary to resort to one-dimensional selective TOCSY experiments to assign the remaining ring protons of these residues (D, B and G), which are overlapped in both the 1H and 13C dimensions Complete assignment of the Kdo residue was possible from examination of TOCSY correlations with the welldispersed H3 and H8 methylene protons of Kdo An APT experiment was used to obtain the 13C shift of the C1 and C2 resonances of Kdo Examination of the 400 ms NOESY spectrum confirmed each of the glycosidic linkages for the 2951lgt1 ⁄ 4D oligosaccharide and the terminal location of each of the b-d-Glc residues D, B, and G As lgt1 has previously been shown to encode an a-(1 fi 2)-glucosyltransferase that adds residue A [4], we concluded that lgt4 encodes the a-(1 fi 2)-N-acetylglycosyltransferase FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS 2029 2030 The anomeric protons of residues D and E overlap, and so 3J1,2 coupling constants were not determined for these residues overlap, and so a a 3J1,2 coupling constant was not determined for residue G 3.90 H8a 3.78 3.82 H7 4.04 fi 5)-a-Kdop a 4.00 3.71 5.38 5.16 5.11 5.04 5.05 4.58 H3ax 2.00 (A) a-D-Glcp-(1 fi (B) fi 2)-b-D-Glcp-(1 fi (C) fi 3,4,6)-a-D-Glcp-(1 fi (D) b-D-Glcp-(1 fi (E) a-D-GlcNAcp-(1 fi (G) fi 2)-b-D-Glcp-(1 fi 3.35 3.36 3.89 3.34 3.99 3.46 H3eq 1.88 3.73 3.57 4.49 3.51 3.71 3.55 H4 4.14 3.39 3.43 3.91 3.32 3.55 3.37 H5 4.06 3.97 3.47 4.566 3.54 3.80 3.41 H6 3.84 4.10 3.96 2.16 H8b 3.61 3.6 7.2 4.2 NDa NDa NDb 99.3 100.1 102.4 104.9 101.6 105.3 C1 178.4 b The anomeric protons of residues G and H5 of residue C C7 71.1 C8 65.8 25.4 ⁄ 177.0 63.5 63.2 70.4 63.9 62.9 63.5 C6 74.1 74.7 78.1 72.5 78.9 74.8 78.1 C5 78.0 72.0 72.2 76.5 72.7 72.4 72.3 C4 68.4 75.6 77.8 77.7 78.9 74.8 78.0 C3 37.1 74.7 83.7 76.4 76.4 56.4 78.0 C2 98.9 C6 C5 C4 C3 C2 C1 J1,2 (Hz) NH(C ¼ O)CH3 H6b In order to further investigate the function of lgt4, an lgt4 ⁄ double mutant was also produced To delete lgt4 from strain 2951, lgt1 and lgt5 were amplified from strain 3292, and Kanr was inserted into lgt5 As strain 3292 does not contain lgt4, this construct recombined in lgt1 and lgt5, inactivating lgt5 as a result of the Kanr insertion, and also deleting lgt4 (Fig 1C) Mutation of the genes encoding Lgt4 and Lgt5 results in a truncated oligosaccharide, as shown in Fig Compared to the wild-type 2951 oligosaccharide, or the recently published 2951lgt5D oligosaccharide [6], it was immediately obvious from the 2951lgt5 ⁄ 4D oligosaccharide NMR spectra that the a-d-GlcNAc residue on the (1 fi 4) branch was missing, due to the lack of peaks indicative of an N-acetamido peak at 2.19 p.p.m (1H) and 25.4 ⁄ 177.0 p.p.m (13C) MS sugar analysis supported this, indicating the presence of Glc, Gal and Kdo (in the approximate ratio : : 1) As expected, mutation of the lgt5 gene resulted in a truncation of the (1 fi 6) branch, and consequently the b-d-Gal was found in the terminal position because the a-d-Gal found in the wild-type 2951 oligosaccharide was missing What was most surprising, however, was that mutation of the lgt4 and lgt5 genes resulted in an oligosaccharide in which the a-d-GlcNAc residue on the (1 fi 4) branch was replaced by an a-d-Glc residue MALDI-MS analysis of the methylated oligosaccharide gave a molecular ion at m ⁄ z 1773.8 [M + Na]+ (75% acetonitrile fraction following Sep-pak C18 purification), consistent with the composition Hex7ỈKdo GC-MS sugar analysis (TMS derivative) indicated an oligosaccharide composed of Glc, Gal, and Kdo GC-MS linkage analysis of the permethylated sample H6a 2951lgt5 ⁄ 4D H5 205 205 190 233 H4 205 145, 145, 161, 162, H3 145, 205 161, 190 H2 Terminal Glcp 2-linked Glcp 3,4,6-linked Glcp Terminal GlcpỈNAc Terminal Glcp Terminal Galp 2-linked Glcp 4-linked Glcp 3,4,6-linked Glcp 129, 130, 333 159, 129, 129, 130, 118, 333 H1 118, 129, 118, 117, 118, 118, 129, 113, 118, Sugar residue 18.52 19.68 21.98 22.37 18.52 18.82 19.68 19.88 21.98 C Chemical shift (d, p.p.m.) 2951lgt5 ⁄ 4D OS Assignment 13 2951lgt2D OS Characteristic fragment ions H Chemical shift (d, p.p.m.) Sample Elution time (min) Table GC-MS analysis of partially methylated alditol acetates obtained from 2951lgt2D oligosaccharide (OS) and 2951lgt5 ⁄ 4D OS from serotype A M catarrhalis following Sep-pak C18 purification (75% acetonitrile fractions) NH(C ¼ O)CH3 I R Peak et al Table 1H and 13C chemical shifts (p.p.m.) for oligosaccharides isolated from the M catarrhalis 2951lgt2D mutant in D2O referenced to 2,2-dimethylsilapentane-S-sulphonic acid (DSS) (0.0 p.p.m.), at 298 K, on a Bruker Avance spectrometer operating at 600 and 150 MHz, respectively Moraxella catarrhalis LOS biosynthesis FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS I R Peak et al Moraxella catarrhalis LOS biosynthesis Table 1H and 13C chemical shifts (p.p.m.) for oligosaccharides isolated from the M catarrhalis 2951lgt1 ⁄ 4D mutant in D2O referenced to DSS (0.0 p.p.m.), at 298 K, on a Bruker Avance spectrometer operating at 600 and 150 MHz, respectively 13 H Chemical shift (d, p.p.m.) C Chemical shift (d, p.p.m.) Sugar residue H1 H2 H3 H4 H5 H6a H6b (B) b-D-Glcp-(1 fi (C) fi 3,4,6)-a-D-Glcp(D) b-D-Glcp-(1 fi (G) b-D-Glcp-(1 fi 4.68 5.13 4.93 4.48 H3ax 2.03 3.33 3.80 3.36 3.30 H3eq 1.86 3.49 4.26 3.49 3.49 H4 4.13 3.38 3.95 3.38 3.38 H5 4.08 3.44 4.41 3.43 3.43 H6 3.83 3.90 4.17 3.90 3.90 H7 4.03 3.71 4.02 3.71 3.71 H8a 3.78 7.9 3.9 8.0 8.0 H8b 3.61 fi 5)-a-Kdop C D B J1,2 (Hz) C1 C2 C3 C4 C5 C6 103.8 102.2 104.1 105.0 C1 179.3 75.8 75.0 76.0 75.8 C2 99.2 78.4 79.2 78.6 78.5 C3 37.0 72.2 75.6 72.2 72.4 C4 68.7 78.4 72.6 78.6 78.5 C5 78.0 63.5 70.0 63.5 63.5 C6 74.0 C7 71.3 C8 65.8 G H6R-H6S C3-C4 C2-C3 H5-H6R/S C1 C4-C5 C1-C2 Fig 1H,1H-COSY NMR spectrum (600 MHz, 298 K, D2O) 2951lgt1 ⁄ 4D mutant oligosaccharide Fig Anomeric region of the 1H-NMR spectrum (600 MHz, 298 K, D2O) 2951lgt1 ⁄ 4D mutant OS Letters refer to designated sugar residues as shown for 2951lgt1 ⁄ 4D in Fig identified terminal Glc, terminal Gal, 2-linked Glc, 4-linked Glc, and 3,4,6-linked Glc (Table 3) H and 13C assignments for the 2951lgt5 ⁄ 4D oligosaccharide are given in Table The anomeric configuration for each sugar residue was obtained from the 3J1,2 coupling constants, as shown in Table Chemical shift assignment for this oligosaccharide was more challenging than for the other oligosaccharides, due to the poor dispersion of signals in the 3.2–4.1 p.p.m region of the spectra Although the 1H signals of the anomeric protons of the 2951lgt5 ⁄ 4D oligosaccharide were well dispersed, the 13C signals were not, as can be seen in the anomeric region of the 1H-13C-HSQC spectrum shown in Fig In fact, the 13C anomeric signal for residues D, G and H overlapped, as did those of E and B For this reason, it was necessary to perform a series of selective one-dimensional TOCSY experiments, irradiating each of the anomeric signals in turn to obtain the H chemicals shifts of the corresponding remaining ring protons Again, assignment of the Kdo residue was possible from examination of TOCSY correlations in the 120 ms 1H-13C-HSQC-TOCSY spectrum from the dispersed H3 and H8 methylene protons of Kdo, and an APT experiment was used to elucidate the 13C shift of the C1 and C2 resonance of Kdo For the highly branched, central a-d-Glc residue C, the locations of the H3 ⁄ C3 and H5 ⁄ C5 correlations were conspicuous in the 1H-13C-HSQC spectrum Examination of the anomeric 13C line of residue C in the 120 ms 1H-13C-HSQC-TOCSY spectrum revealed the location of the remaining ring protons FEBS Journal 274 (2007) 2024–2037 ª 2007 The Authors Journal compilation ª 2007 FEBS 2031 Moraxella catarrhalis LOS biosynthesis I R Peak et al Table 1H and 13C chemical shifts (p.p.m.) for oligosaccharides isolated from the M catarrhalis 2951lgt5 ⁄ 4D mutant in D2O referenced to DSS (0 p.p.m.), at 298 K, on a Bruker Avance spectrometer operating at 600 and 150 MHz, respectively ND, not determined 13 H Chemical shift (d, p.p.m.) C Chemical shift (d, p.p.m.) Sugar residue H1 H2 H3 H4 H5 H6a H6b (A) fi 4)-a-D-Glcp-(1 fi (B) fi 2)-b-D-Glcp-(1 fi (C) fi 3,4,6)-a-D-Glcp(D) b-D-Glcp-(1 fi (E) a-D-Glcp-(1 fi (G) fi 2)-b-D-Glcp-(1 fi (H) b-D-Galp-(1 fi 5.42 5.06 5.11 4.90 5.27 4.60 4.44 H3ax 2.03 3.63 3.44 3.87 3.39 3.47 3.46 3.51 H3eq 1.89 3.87 3.57 4.38 3.50 3.67 3.54 3.64 H4 4.13 3.66 3.41 4.01 3.38 3.44 3.41 3.89 H5 4.06 4.10 3.60 4.56 3.51 3.98 3.50 ND H6 3.82 3.76 3.70 4.05 3.73 3.77 3.72 ND H7 4.02 3.99 3.82 4.16 3.94 4.2 7.2