Effect of 5-lipoxygenase inhibitor MK591 on early molecular and signaling events induced by staphylococcal enterotoxin B in human peripheral blood mononuclear cells Chanaka Mendis1, Katherine Campbell1, Rina Das2, David Yang3 and Marti Jett2 Department of Chemistry and Engineering Physics, University of Wisconsin-Platteville, WI, USA Department of Molecular Pathology, Walter Reed Army Institute of Research, Silver Spring, MD, USA Department of Chemistry, Georgetown University, Washington, DC, USA Keywords cross-talk; MK591; pathway interconnectors; signal transduction; staphylococcal enterotoxin B Correspondence C Mendis, Department of Chemistry and Engineering Physics, University of Wisconsin-Platteville, 308, Ottensman Hall, University Plaza, Platteville, WI, USA Fax: +1 608 342 1559 Tel: +1 608 342 1692 E-mail: mendisc@uwplatt.edu (Received December 2007, revised April 2008, accepted 11 April 2008) doi:10.1111/j.1742-4658.2008.06462.x Staphylococcal enterotoxin B (SEB) has been the focus of a number of studies due to its ability to promote septic shock and a massive impact on the human immune system Even though symptoms and pathology associated with SEB is well known, early molecular events that lead to lethality are still poorly understood Our approach was to utilize SEB induced human peripheral blood mononuclear cells (PBMCs) as a prototype module to further investigate the complexity of signaling cascades that may ultimately lead to lethal shock Our study revealed the activation of multiple divergent intracellular pathways within minutes of SEB induction including components that interconnect investigated pathways A series of performed inhibitor studies identified a specific inhibitor of 5-LO (MK591), which has the ability to block JNK, MAPK, p38kinase and 5-LO signaling-cascades and drastically reducing the activity of pro-inflammatory cytokine TNF-a Further evaluation of MK591 utilizing cell proliferation assays in PBMCs, human proximal tubule cells and in vivo studies (monkey) showed a decrease in cell proliferation The inhibitory effect of MK591 was reconfirmed at a genetic level through the utilization of a set of SEB specific genes Signaling activities, inhibitor studies, cellular analysis and gene expression analysis in unison illustrated the significance of pathway interconnectors such as 5-LO as well as inhibiting such inter-connectors (using MK591) in SEB induced human PBMCs Staphylococcal enterotoxin B (SEB) is one of the many exotoxins produce by Staphylococcus aureus and is implicated in inducing diarrhea, vomiting, muscle numbness, possible involvement in autoimmune disorders and lethal shock [1] The massive impact of T cell activation, proliferation, and cytokine production by CD4+ T cells via specific Vb elements of T cell antigen receptor [2] has prompted a number of investigations to focus on the intricate signaling activities of SEB Even though the molecular events of SEB-induced lethal shock in human peripheral blood mononuclear cell (PBMCs) are not very apparent, the actual response of lethal shock is expected to herald by changes in signaling pathways [3,4] In mammalian cells, a variety of stimuli generate intracellular responses that converge on a limited number of components of multiple pathways [5] Mitogen-activated protein kinase (MAPK) cascades together with arachidonic Abbreviations 5-LO, 5-lipoxygenase; HIF, hypoxia-inducible factor; IL, interleukin; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; p38kinase, p38-mitogen activated protein kinase; PBMC, peripheral blood mononuclear cell; REPTC, renal epithelial proximal tubular cell; SEB, staphylococcal enterotoxin B; TNF, tumor necrosis factor 3088 FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS C Mendis et al acid metabolic cascades comprise one of the major signaling systems efficiently utilized by cells to transmit and integrate a plethora of intracellular activities [6] Although the well regulated signal transduction is crucial for typical cell behavior, aberrant signaling often leads to diverse pathological consequences Even though cross-talk is not a novel concept, the induction of multiple signal cascades and the inter-connectivity of SEB-induced cascades in human PBMCs have not been examined in detail To gather evidence vital in identifying early signaling events triggered by super-antigen SEB in lethal shock, we examined the SEB-induced signaling and cross-talk activities of 5-lipoxygenase (5-LO), MAPK, c-Jun N-terminal kinase (JNK) and p38-mitogen activated protein kinase (p38kinase) pathways A number of signaling cascades have been documented in which a series of proteins activate and regulate one another in a sequential and cooperative fashion [7,8] One such protein kinase cascade known as MAPK is activated in cells responsive to various stimuli, predominantly growth factors [9] MAPKs have a molecular mass of 40–44 kDa and are activated by the phosphorylation of both threonine and tyrosine residues conserved in the threonine-glutamate-tyrosine motif [10] P38kinases are induced by a plethora of activators including and not limited to UV light, heat, osmotic shock, inflammatory cytokines [tumor necrosis factor (TNF)-a and interleukin (IL)-1] and growth factors (colony-stimulating factor-1) [11–13] Similar to p38kinase and MAPK, JNK contains a dual phosphorylation motif and is induced by stress-inducing agents or pro-inflammatory cytokines [14] The arachidonic acid signaling pathway, which has been studied in great detail, is known to up-regulate inflammatory responses and 5- and 15-hydroxyeicosatetraenoic acid metabolites in human T cells and human lymphocytes, respectively [6] Products of the arachidonic acid metabolizing enzyme 5-LO have been shown to stimulate the growth of several types of cancers, whereas 5-LO activating protein inhibitor MK-886 has shown to inhibit cell growth in a dose- and time-dependent manner in a gastric cancer cell line [15] Recent evidence of arachidonic acid signaling activities has indicated possible cross-talk of 5-LO and cyclooxygenase-2 through the cysteinyl leukotriene receptor in endothelial cells [16] Superantigens are known to activate large families of T cells based on expression of the Vb chain of the T cell receptor, which in turn increases cell proliferation and pro-inflammatory cytokine secretion [1] The present study aimed to investige the early signaling events induced by SEB in human PBMCs to determine the pathway inter-connectors We hypothesized that Effects of SEB on human PBMCs such signaling inter-connectors can be effectively targeted to terminate ⁄ reduce aberrant signaling and cellular activities that may ultimately lead to SEB-induced lethal shock Our goal was to evaluate multiple signaling cascades induced by SEB and target pathway interconnector 5-LO to inhibit unwanted cellular activities As multiple investigations have effectively utilized systematic examination of gene expression profiles by stimulants to reveal qualitative and quantitative differences that may ultimately lead to possible mechanisms of action [17,18], we further evaluated the inhibitory effect of 5-LO specific inhibitor (MK591) at a genetic level by analyzing the gene expression pattern of a set of SEB specific genes that explain some of the SEB-induced symptoms via gene functions Results Effect of SEB on multiple signal transduction pathways in human PBMCs Even though the ability of SEB to induce lethal shock is known, the mechanism of its action remains unclear In the present study, we analyzed the activation of various proteins kinases in response to SEB aiming to better understand the intricacy of signaling activities Effect on MAPK Human PBMCs at a cell density of 2.5 millionỈmL)1 were treated with 100 ngỈmL)1 of SEB for different time periods and MAPK phosphorylation was quantitated as described in the Experimental procedures When stimulated with SEB, MAPK phosphorylation (activation) was visible by as early as min, showed maximum activity after (2.8-fold) and finally returned to control levels by 60 (Figs and 2) Effect on p38kinase Human PBMCs were treated with SEB and the activation of p38kinase was measured as described in the Experimental procedures An initial burst of activation of this stress-induced kinase was seen by as early as after exposure (two-fold), followed by a slight increase up to (2.25-fold) and reached control levels by 60 (Figs and 2) Effect on JNK As SEB is known to induce a stress response in human PBMCs, we examined the effect of SEB on the activity of stress-induced kinase (JNK), also known as stress FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS 3089 Effects of SEB on human PBMCs C Mendis et al Fig Comparison of signaling pathway activation profiles A comparison of the time-dependent activation of 5-LO, MAPK, JNK and p38kinase is shown Activation of samples at multiple time points (1, 5, 30 and 60 min) was quantitated using NIH IMAGE software and data are shown as triplicates with the respective SD values Fig SEB-induced activation of signaling cascades in human PBMCs Human PBMCs at 2.5 · 106 cellsỈmL)1 were treated with SEB and the activation of each of the key elements was quantitated by immunoassays as described in the Experimental procedures Phosphorylation of all samples except JNK were analyzed using immunoassays whereas JNK was quantitated using both kinase and immune-assays; 0, 1, 5, 30 and 60 refer to the time (min) PBMCs were exposed to SEB 0, PBMCs not exposed to SEB but subjected all other experiment parameters (control sample) activated protein kinase, using two different techniques (immunoblots and kinase assays) Our immunoassay results indicated a rapid five-fold activation of JNK within of SEB exposure (Figs and 2) A twofold JNK activity was observed even at 60 Even though SEB-induced samples analyzed for JNK activation using kinase assays did show higher activation than control levels, high background levels interfered with any proper quantification of the activity (Fig 1) Effect on 5-LO Our experiments confirmed a time-dependent activation of 5-LO, showing a maximum activity of two-fold within and sustaining activity levels slightly above control levels at 60 (Figs and 2) Comparison of SEB triggered signaling cascades Comparison of multiple signal transduction pathways revealed that all investigated pathways showed a relatively similar time-dependent protein activation pattern, with a few differences unique to each key pathway (Fig 2) All four analyzed components 3090 (p38kinase, 5-LO, JNK and MAPK) showed maximum activity by At min, JNK activity was at least two-fold higher than the activity of the rest of the components and continued to show activity over control levels (compared to other components) throughout the study period (0–60 min) JNK and 5-LO showed 2.25-fold and 1.5-fold activity, respectively, at 60 Effect of various inhibitors on SEB triggered signaling cascades Previous experiments carried out in our laboratory have shown the involvement of eicosanoids in SEBinduced shock in human lymphoid cells In the present study, we expanded the investigation to include inhibitors of various signal transduction pathways such as lipoxygenase inhibitors (MK886, MK591 and curcumin), p38kinase inhibitor (SB203580), JNK inhibitor (SP600125) and MAPK inhibitor (PD98059) to observe the effect in human PBMCs As all investigated protein phosphorylation data indicated a maximum expression at min, we chose as the time point to investigate further the effect of all inhibitors All inhibitors of the lipoxygenase pathway were able to block SEBinduced MAPK and p38kinase activation but only had a partial inhibitory effect on JNK activation (Table 1) MAPK inhibitor PD98059 had a negligible effect on SEB-induced p38kinase, JNK and 5-LO activation, whereas p38kinase inhibitor SB203580 clearly blocked the induced MAPK and JNK activity, but did not effect the 5-LO activity Interestingly, JNK inhibitor SP600125 (1,9-pyrazoloanthrone) demonstrated attenuation of SEB-induced MAPK expression yet had no effect on p38kinase or 5-LO activation FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS C Mendis et al Effects of SEB on human PBMCs Table Effect of various inhibitors on SEB-induced signaling pathways Human PBMCs (2.5 · 106 cellsỈmL)1) were treated with the respective inhibitor for 30 at 37 °C prior to a stimulation with SEB at 37 °C All inhibitors were used at 20 lM except SB203580 and SP600125, which were used at 10 lM All values are shown as a percent of control samples TNF-a induction is referred to as the activation of TNF-a when induced by100 ngỈmL)1 SEB for ND, not determined JNK SEB SB-203580 MK591 MK886 Curcumin SP600125 PD98059 500 178.4 212.5 173.5 168 74.2 337 p38kinase ± ± ± ± ± ± ± 29.5 18.6 78.5 19.5 22 2.5 25 MAPK 250 34 76 55 43 337 225 279 38.5 71.5 52.5 39.8 199 31.0 ± ± ± ± ± ± ± 15 2.2 5.3 3.5 6.2 4.3 23 Effect of inhibitors on SEB-induced PBMC proliferation Figure illustrates the concentration effect of SEB on human PBMC proliferation We observed that proliferation was directly proportional to SEB concentration in the range 10–110 ngỈmL)1 For SEB concentration in the range 0–10 ngỈmL)1, a slight drop in cell proliferation was observed whereas SEB concentrations higher than 110 ngỈmL)1 showed an increase in cell proliferation at a much lower rate Both MK591 and SB203580 were able to block SEB-induced cell proliferation (Table 2) Effect of SEB and 5-LO inhibitor MK591 on human renal epithelial proximal tubular cells (REPTC) proliferation SEB-treated REPTC proliferation was partially inhibited by MK591 (33%) whereas SB203580 had no effect on REPTC proliferation (Table 2) 200 175 65 ND ND 158 320 28.4 1.5 4.5 2.5 10 13 TNF-a induction 2200 150 190 220 ND 1550 1500 ± 35 ± 7.6 ± 25 ± 4.5 ± 13 ± ± ± ± 22.1 3.3 5.0 1.1 ± 40 ± 30 16 000 Effect of inhibitors on SEB-induced TNF-a induction 14 000 H labeled thymidine incorporation (in cpm) The investigation then focused on analyzing the effect of the same set of inhibitors on TNF-a induction (Table 1) The observed induction in SEB treated cells (22-fold) was drastically reduced in cells treated with various inhibitors Of the different inhibitors, SB203580 showed the highest inhibitory effect (1.5-fold) whereas MK886 and MK591 (5-LO inhibitors) showed a slightly lower inhibition than SB203580 Even though all the inhibitors (Table 1) used in this study had a somewhat inhibitory effect on TNF-a expression, the effect of both PD98059 and SP600125 was minimal compared to the other inhibitors ± ± ± ± ± ± ± 5-LO 12 000 10 000 8000 6000 4000 2000 0 50 100 150 200 250 SEB (ng·ml–1) Fig Concentration dependence of SEB on PBMC proliferation A typical SEB-induced time-dependent cell proliferation pattern is shown Human PBMCs at 2.5 · 106 cellsỈmL)1 density were incubated in 96-well plates in the presence of SEB at various concentrations (range: 1–200 ng) and incorporated radioactivity, which is directly proportional to cell proliferation, was quantitated as described in the Experimental procedures Table Effectiveness of MK591 on SEB stimulated cellular activities Each cell type was treated with MK591 for 30 at 37 °C prior to the stimulation with SEB at 37 °C All in vitro experiments were performed at concentrations of 10 lM SB203580 and 20 lM MK591 All in vivo experiments were performed at 10 mMỈkg)1 (SB203580) and at 20 mMỈkg)1 (MK591) and the values are shown as a percent of control samples ND, not determined Monkeys were exposed to saline or SEB (15 lgỈkg)1) by aerosol, with or without the treatment of the respective inhibitor and whole blood was collected after 30 of exposure All cell proliferation experiments were carried out as described previously [31] and TNF-a experiments were carried out as described in the Experimental procedures Stimulant T cell Proliferation T cell TNF-a in proliferation of REPTC proliferation in monkeys in PBMC (%) (%) monkeys (%) (%) SEB 100 SB203580 0.59 ± 0.04 MK591 14.67 ± 1.22 FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS 100 100 ± 3.6 67.5 ± 2.5 100 ND 45.2 ± 2.8 100 ND 38.5 ± 2.5 3091 Effects of SEB on human PBMCs C Mendis et al Effect of 5-LO inhibitor MK591 on monkeys challenged with SEB Findings of in vitro studies of human PBMCs were verified in PBMCs isolated from aerosol SEB challenged monkeys The animals were treated with a sublethal dose of the toxin, which caused incapacitation Each monkey was used as its own control in a saline sham experiment TNF-a and T cell proliferation was assayed from blood samples as early as 30 post exposure MK591 was able to inhibit the expression of TNF-a and T cell proliferation in vivo samples (Table 2) Effect of MK591 on the expression of a set of SEB specific genes To examine our hypothesis of effectively targeting a pathway inter-connector to block the SEB-induced signaling cascades, we evaluated MK591 at a genetic level by analyzing a set of SEB specific genes Genes that were chosen based on functional significance were analyzed by performing RT-PCR at h and 16 h (Table 3) Three genes [for cathepsin L, IL-17 and guanylate binding protein (GBP)-2] that are up regulated by SEB were all down regulated by MK591 at 16 h All three genes showed a reduction in the activation as early as h whereas the gene for IL-17 showed a fourfold down regulation at h CTAP-III, which is down regulated by SEB both at h and 16 h, showed an up regulation at 16 h with MK591 The effect of MK591 on proteoglycan V0 was minimal at both h and 16 h Discussion Despite many decades of extensive investigation, neither the exact pathomechanism, nor the intricate nature of SEB-induced signaling activities are well understood The mode of signal transduction is vital in properly understanding the multifunctional role of staphylococcal enterotoxin as a super-antigen [1] A recent study has revealed phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival [19] Although crucial to understanding cell survival, the investigation does not provide any information about the importance of targeting pathway inter-connectors The present study aimed to investigate a group of multiple signal transduction pathways in human PBMCs (i.e the first line of defense encountered by foreign substances) using a single stimulant (SEB) to better comprehend and visualize the complexity of signal transduction pathways Protein activation experiments indicated the ability of SEB to induce multiple signaling pathways as well as high activation levels of JNK This result lead us to hypothesize that SEB may utilize a single pathway to transmit majority of the signal but can use multiple cascades at varying strengths depending on the time, stimulant and availability of pathways The concept has many interesting consequences; specifically, whether an extracellular stimulant may lead to aberrant cellular behavior In such a case, it is important to look at all possible signal transduction pathways when deducing the key element or elements that may abolish such a signal To further investigate the activation of multiple signal transduction pathways and to explore the existence of pathway inter-connectors, we performed a series of inhibitor studies targeting MAPK, p38kinase, 5-LO and JNK Previous investigations carried out in our laboratory have indicated the inhibition of SEBinduced arachidonic acid and MAPK activation in human lymphoid cells by 5-LO inhibitors such as curcumin, NDGA and MK881 (C Mendis, R Das, D Yang and M Jett, unpublished results) whereas Table Effect of MK591 on the expression of a set of SEB specific genes A set of SEB specific genes previously identified by differential display-PCR and RT-PCR (18) were further examined using 5-LO inhibitor MK591 After designing specific primers for each gene of interest, RT-PCR reactions were performed on samples treated with SEB (100 ngỈmL)1) with or without the inhibitor (MK591) for h and 24 h as described in the Experimental procedures Identical total RNA samples were used for all analysis, and the bands of PCR products were digitized after normalizing with a house keeping gene (18S rRNA), and quantitated using NIH IMAGE software All reactions were repeated twice and the results are reported as mean ± SD values relative to the control CTAP-III, connective tissue activating protein III; CTSL, cathepsin L transcript variant1 mRNA; Prot-V0, chondroitin sulfate proteoglycan versican V0 splice-variant precursor peptide ND, not determined Gene name Sequence ID CTAP-III CTSL HIF-1 GBP-2 IL-17 IL-6 Prot-Vo BC028217 NM-001912 AF050127 M55543 NM_002190 M29150 U16306.1 3092 SEB (2 h) )1.73 6.13 2.3 7.57 2.2 52.26 ND ± ± ± ± ± ± SEB (16 h) 0.01 0.22 0.05 0.08 0.03 1.0 MK591 (2 h) MK591 (16 h) )2.21 4.9 2.79 3.26 4.97 31.6 )2 1.18 )1.01 1.00 )2.0 1.12 ND )2.45 1.42 )1.20 )1.45 )4.80 )4.75 ND )1.65 ± ± ± ± ± ± ± 0.03 0.15 0.03 0.07 0.23 0.26 0.2 ± ± ± ± ± 0.03 0.10 0.02 0.005 0.02 ± 0.06 ± ± ± ± ± 0.10 0.01 0.25 0.10 0.03 ± 0.02 FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS C Mendis et al Effects of SEB on human PBMCs cross-talk of p38kinase and MAPK has been observed in d-glucose-induced cell death [20] Our results demonstrated the ineffectiveness of targeting MAPK inhibitor PD98059 because the inhibitor had no effect on the activities of JNK, 5-LO or p38kinase, which is somewhat similar to the results obtained for PD98059 in IgG-opsonized sheep erythrocyte-stimulated polymorphonuclear leukocytes [21] The ability of p38kinase inhibitor SB203580 to selectively and markedly inhibit SEB stimulated MAPK and JNK activation suggested interconnectivity of p38kinase, MAPK and JNK pathways, but no indication of any effect on the 5-LO pathway Even though SEB-induced JNK phosphorylation far exceeded the activation of other pathways, JNK specific inhibitor SP600125 was only able to inhibit MAPK activation The above results led us to continue our inhibitor study targeting the 5-LO pathway, specifically MK591 Targeting the 5-LO pathway using MK591 attenuated all previously observed activation of the MAPK, p38kinase and JNK pathways The multiple pathway inhibitory effects of MK591 confirmed the importance of 5-LO as a pathway inter-connector in SEB-induced human PBMCs Similar results were observed in vascular smooth muscle cells, in which JNK-1 and MAPK were induced by arachidonic acid in a time- and concentration-dependent manner [22] Figure illustrates the inter-connectivity of signaling cascades that participat7e in SEB-induced human PBMCs Both human and animal models of endotoxininduced shock are similar, and both show an elevation of pro-inflammatory cytokines (e.g TNF-a levels) within a few hours of induction, followed by a decline to undetectable levels [23] Inflammatory cytokine TNF-a is produced in SEB-induced human PBMCs to a 50-fold greater extent than in untreated cells [24], modulating a wide variety of cellular processes such as organ dysfunction and systematic shock [25–28] High induction of TNF-a SEB in human PBMCs prompted us to utilize TNF-a as a cellular marker to further investigate the effect of MK591 TNF-a levels that were drastically elevated by 100 ngỈmL)1 SEB in human PBMCs were reduced back to control levels by 5-LO activating protein specific inhibitor MK591 (Table 1) Although intriguing, these results were based on in vitro experiments and did not reveal any information under physiological conditions Further investigation of MK591 using an in vivo model (monkey) did show a similar pattern to that observed in vitro experiments, but not at similar levels of inhibition One of the major characteristic of SEB-induced human PBMCs is the ability to show massive T cell proliferation Once exposed, PBMCs show a minimum 30% increase in T cell production We took advantage SEB complex 5-LO Fig Schematic diagram of the inhibitory effect of MK591 on SEB-induced human PBMCs The inter-connectivity of SEBinduced signaling cascades as well as the effectiveness of 5-LO inhibitor MK591 is shown, in addition to the inhibitory effect of MK591 on a set SEB specific proteins and genes All genes are indicated by a double outline around the name together with the corresponding functionally related symptom of SEB All proteins are indicated by a single outline around the name Symbol ‘X’ indicates inhibition of a protein or gene activity CTAP-III, connective tissue activating protein III; CA-L, cathepsin L transcript variant1 mRNA X X X p38 MAPK IL-17 X JNK X X Inflammation TNF-α X X HIF-1 X Respiratory distress CA-L Tissue degredation FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS GBP-2 X CTAP-III X Vasodilation Cell proliferation Vascular permability 3093 Effects of SEB on human PBMCs C Mendis et al of the high activation of T cells and used it as our second parameter to evaluate the effectiveness of MK591 Our results clearly indicated the ability of MK591 to efficiently inhibit SEB-induced T cell proliferation in vitro, and the 50% T cell inhibition observed in a monkey model further solidified the high potency of the inhibitor (Table and Fig 4) Evidence from experiments performed using animal models implicates the kidney in general, and the REPTCs in particular, as the major target of SEB uptake It is also clear that 70% of injected SEB is accumulated in proximal tubule cells within h [29–31] of stimulation Based on the evidence of kidney involvement in blood pressure regulation, it is not unreasonable to hypothesize that damage to the renal epithelium caused by a vascular shock-inducing agent, such as SEB (which possesses the ability to interact directly with the vascular toneregulating kidney cells), may contribute to the development of systemic shock (unpublished results) The functional significance of REPTCs prompted us to further investigate whether MK591 had any inhibitory effect on REPTCs; if this is the case, we believe that targeting 5-LO with MK591 may even help reduce systemic shock The ability of MK591 to effectively inhibit T cell as well as REPTC (by 33%) proliferation indicates for the first time the effectiveness of targeting a pathway inter-connector (5-LO) It is possible that the ability of the target to inter-connect multiple signal pathways allowed it to influence cellular activity in the two crucial cell types that are most effected by SEB stimulation SB203580, an inhibitor of pathway interconnector p38kinase, had a similar inhibitory effect on T cell proliferation but did not inhibit REPTCs, which is known to function as a major target of SEB uptake The result prompted us to focus further on evaluating MK591 as a possible inhibitor We then investigated the effect of MK591 on the expression pattern of a set of SEB specific genes that somewhat explained the symptoms induced by SEB via gene functions We believed that the gene analysis would further complement and validate the inhibitory effects observed for MK591 at a protein level [18] Some of the investigated genes are involved in functions such as inflammation (IL-6 and IL-17), tissue damage ⁄ cardiac dysfunction (cathepsin L), hypoxia inducible conditions [hypoxia-inducible factor (HIF)1], alterations to the physiology of blood vessels (proteoglycan V0) and vasodilatation (GBP-2) Our target MK591 was able to alter the expression of each of the above SEB specific genes at two time points (2 h and 16 h) as shown in Table 3, except proteoglycan V0 (which did not show alteration at both time points) and IL-6 (uncompleted experiments) All of the above 3094 genes have been thoroughly investigated and contribute to a profile that is specific for SEB [18] Even though RT-PCR is considered to be a semi-quantitative gene quantification method, the results observed are significant for two reasons The purpose of the analysis was, first, to verify whether MK591 was able to alter a SEB specific gene profile and, second, to evaluate the effectiveness of MK591 at both protein and genetic levels Our investigation showed the ability of SEB to utilize multiple signaling cascades to induce cell proliferation and TNF-a induction, which ultimately would result in symptoms such as inflammation, respiratory distress, tissue degradation, vascular permeability and vasodilation Our model (Fig 4) shows the effect of targeting multi-pathway inter-connector 5-LO by a specific inhibitor (MK591) and summarizes the alterations observed at the genetic level and the inhibitory effects observed at the protein level The model signifies the importance of targeting components such as 5-LO that have the ability to inter-connect multiple signaling cascades such as JNK, p38kinase and MAPK We believe that targeting 5-LO may have a wider impact on SEB-induced cellular events than targeting a component such as p38kinase, which influences only JNK and MAPK and not 5-LO The inability of p38kinase inhibitor to block 5-LO activity may have played a role in the inability of SB203580 to effectively block proliferation of REPTC Potential signal blockers have to be examined thoroughly because time and again these targets have proven to be unsuccessful in clinical trials This can be due to a number of reasons, including the inability of the targets to completely block the signaling cascades due to the leaking effect or the ability of the signal to use alternative signaling cascades upon the inhibition of the primary signaling pathway We are confident that the ability of our target to function as a pathway inter-connector may have a positive influence on blocking the SEB-induced signaling activities Furthermore, it is important to reconfirm the inhibition of signaling activities observed for SEB to somewhat similar toxins such as lipopolysaccharides to better understand whether the inter-connector has a universal function We have previously compared the gene expression pattern of SEB and lipopolysaccharides and know that each profile is remarkably different than the other, even though both tend to induce similar symptoms in exposed patients [18] We are currently analyzing the protein activation pattern of the two toxins to differentiate specific signaling activities as well as identify similar signaling activities (data not included) FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS C Mendis et al Knowledge on the early molecular events investigated in the present study will have a tremendous impact on determining the effects of SEB on human PBMCs and may complicate the finding of a therapeutic target even more However, the emergence of effectively targeting convergence points (5-LO) in this intricate web of pathways has helped with respect to finding targets that may have potential therapeutic significance The early identification of these key elements will also help in determining the potential exposure to SEB before a patient experiences significant damage and, undoubtedly, will be key in designing strategies to block or even limit aberrant signaling cascades by inhibiting pathway inter-connectors such as 5-LO Even though, collectively, the above data comprise an attempt to elucidate the complexity of signal transduction pathways induced by SEB, the cross-talk of pathways, and the effectiveness of inhibiting a pathway inter-connector utilizing trademark cellular and genetic activation patterns associated with SEB, further work is essential, both in vivo and in vitro, to pinpoint the efficiency and the effectiveness of MK591 Experimental procedures Cells and cell cultures Effects of SEB on human PBMCs vitamin solution (Gibco BRL, Grand Island, NY, USA) The cultures were maintained for up to seven passages and used for experiments after the second passage Cells were harvested and total RNA were isolated using Trizol reagent (Life Technologies) according to manufacturer’s instructions Exposure of monkeys to aerosol challenge with SEB Administration of SEB ⁄ saline (control), collection of blood samples and processing of blood samples were performed as described previously [31] Monkeys were exposed to saline or SEB (15 lgỈkg)1) by aerosol, with or without the treatment of inhibitor SB203580 (10 mmỈkg)1) and MK591 (20 mmỈkg)1), and whole blood was collected 30 after exposure PBMCs fractionated through a Ficoll gradient were then utilized in proliferation assays, TNF-a assays and total RNA isolations Toxin SEB from S aureus strain 10-275 purified by the method of [32] was provided in the lyophilized form by the US Army Research Institute of Infectious Diseases (Fert Detrick, Frederick, MD, USA) The stock solution was prepared in sterile, pyrogen-free deionized water at a concentration of mgỈmL)1 and stored at –80 °C When used, the stock solution was diluted with cell culture medium to the desired concentration Exposure of human PBMCs to SEB in vitro Human PBMCs were collected from leukopacks from normal donors as described previously [31] Human PBMCs with or without SEB and ⁄ or inhibitors of interest were used at a final density of 2.5 · 106 cellsỈmL)1 in RPMI 1640 medium supplemented with 10% human AB serum Prior to treatment with 100 ngỈmL)1 of SEB for different time periods (1, 5, 30 and 60 for protein extraction and h and 16 h for RNA extraction), PBMCs were incubated with an inhibitor of interest at room temperature for 30 at 20 lm, except SP600125 and SB203580, which were used at 10 lm under 5% CO2 at 37 °C Total RNA were isolated using Trizol reagent (Life Technologies, Grand Island, NY, USA) according to manufacturer’s instructions 0; PBMCs not exposed to SEB but subjected to all other experiment parameters Exposure of REPTC to SEB in vitro Primary cultures of normal REPTCs from a 34-year-old African-American male donor were obtained from Clonetics (Walkersville, MD, USA) The cultures were maintained in 75 cm2 or 162 cm2 tissue culture flasks (Corning Corp., Corning, NY, USA) at 37 °C in 5% CO2 atmosphere in renal epithelial growth medium (Clonetics), supplemented with 20 unitsỈmL)1 penicillin G sodium, 20 lgỈmL)1 streptomycin sulfate, 20 lgỈmL)1 kanamycin sulfate, and minimal essential Immunoblotting and western blotting The cells were lysed after a brief sonication and incubated in the lysis buffer containing 20 mm Hepes, 10 mm EGTA, 40 mm b-glycerophosphate, 2.5 mm MgCl2, mm dithiothreitol, 150 mm NaCl, mm sodium orthovanadate, mm phenylmethanesulfonyl fluoride, 10 lgỈmL)1 leupeptin, 10 lgỈmL)1 aprotinin, 1% NP40 and 0.5% deoxycholate Equal amounts of protein were either resolved on 10% SDS ⁄ PAGE gels (Novex, Cleveland, OH, USA) or immunoprecipitated overnight with an antibody of interest at °C, incubated with protein-G sepharose at °C for h, washed twice in lysis buffer and resolved on 10% SDS ⁄ PAGE gels (Novex) Analyzed gels were transferred to poly(vinylidene difluoride) membranes (Invitrogen, Grand Island NY, USA), probed with a specific antibody of interest (Santa Cruz Biotechnology, Santa Cruz, CA, USA), except JNK inhibitor which was purchased from Calbiochem (La Jolla, CA, USA) All immune assays were detected using an ECL detection kit (Amersham, Piscataway, NJ, USA), and quantitated using nih image software, version 1.3 (NIH Image, Bethesda MD, USA) All immunoblots and western blots were repeated at least three times to check for reproducibility and data are reported the mean ± SE FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS 3095 Effects of SEB on human PBMCs C Mendis et al Proliferation assays Human PBMCs were isolated and purified as described previously [31], except that human PBMCs were used at 2.5 · 106 cellsỈmL)1 in RPMI 1640 medium supplemented with 10% human AB serum with or without the inhibitors MK591 (20 lm) and SB203580 (10 lm) at SEB concentrations in the range 1–200 ngỈmL)1 The cultures were incubated for 15 h with lCu of methyl-[3H]thymidine per sample Incorporated radioactivity was determined using a microplate scintillation counter (Packard, Meriden, CT, USA) All proliferation assays were repeated at least three times for reproducibility Human REPTCs were also used at 2.5 · 106 cellsỈmL)1 All in vivo experiments subjected to TNF-a assays were carried out at 10 mmỈkg)1 (SB203580) and at 20 mmỈkg)1 (MK591) Kinase assays Cell extracts were immunoprecipitated with p-JNK antibody (Santa Cruz Biotechnology) and washed with a kinase buffer containing 20 mm Hepes (pH 7.6), 20 mm MgCl2, 20 mm b-glycerophosphate, mm sodium orthovanadate, mm dithiothreitol and 20 lm ATP Kinase assays were performed using lg of GST-c-Jun as substrate and lCi Y [32P]ATP and quantitated using nih image software All assays were performed at least three times to verify reproducibility ELISA immunoassays Specific kits to quantitate TNF-a was purchased from R&D systems and performed using equal amounts of proteins obtained from human PBMCs or REPTCs with or without treatment of 100 ngỈmL)1 SEB and an inhibitor according to the manufacturer’s instructions (Quantikine R&D systems, Minneapolis, MN, USA) All in vitro experiments subjected to TNF-a assays were performed at concentrations of 10 lm SB203580 and 20 lm MK591 All in vivo experiments subjected to TNF-a assays were carried out at 10 mmỈkg)1 (SB203580) and at 20 mmỈkg)1 (MK591) Proteins were quantified using a Ceres UV 900-Hdi plate reader (Bio-Tek Instruments Inc., Winooski, VT, USA) All samples other than the control samples were incubated with SEB for RT-PCR RT-PCR analyses were performed using a Superscript amplification kit (Life Technologies, Gaithersburg, MD, USA) Housekeeping gene primers (18S) were obtained from Clontech Corp (Palo Alto, CA, USA) and all primers were designed using a primer-design software program named primer3 cDNA were amplified using AmpliTaq polymerase 3096 (Applied Biosystems, Branchburg, NJ, USA) Genes were analyzed on 1% agarose gels, visualized through an inhouse imager and quantified using imagej (NIH Image) All custom primers except 18S were purchased from Invitrogen (Carlsbad, CA, USA) All primers were designed to have an annealing temperature of 60 °C and were subjected to PCR for 35 cycles in a thermocycler (PerkinElmer, Waltham, MA, USA) All sequences are indicated in the 5¢ to 3¢ direction and are abbreviated after the gene name as ‘L’ or ‘R’ for reverse or forward, respectively CTAP-III-L; CAGCAA CTCACCCTCACTCA, CTAP-III-R; GTTTGTCCTTTGG TGGAGGA, CTSL-L; CATTTGCAGGCTCCTTTAGC, CTSL-R; GGGCAAAGGTTTCCTCTTTC, HIF-1-L; GAAAGCGCAAGTCCTCAAAG, HIF-1-R; TGGGTAG GAGATGGAGATGC, GBP-2-L; GGTCCAGTTGCTGA AAGAGC, GBP-2-R; TGACAGGAAGGCTCTGGTCT, IL-6-L; TACCCCCAGGAGAAGATTCC, IL-6-R; TTT TCTGCCAGTGCCTCTTT, PROT-VO-L; CCTTTCTGG GGAAGAACTCC, PROT-VO-R; GGTCACATAGGAAG CGTGGT, IL-17-L; ATTTGCCGAAGAGCCCTCAG, AND IL-17-R; TTCCAAAGATGTAGCCGCCC Acknowledgements We like to extend our gratitude to Michael Hartl and Carla Sanchez [Walter Reed Army Institute of Research (WRAIR), Silver Spring, MD, USA] for their technical expertise in carrying out protein expression analysis, Boris Ionin (WRAIR) for his assistance in working with REPTC and a monkey model and Mark Hiner (University of Wisconsin Platteville) for his assistance in optimizing the gene quantitative analysis technique We would also like to thank the University of Wisconsin-Platteville for its internal funding opportunities (SAIF and PURF grants) and Professor James Hamilton of the UWP Chemistry and Engineering Department for developing an imager to quantitate gene expression Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adheres to principles stated in the Guide for the Care and Use of Laboratory Animals, NRC Publication, 1996 edition The opinions, interpretations, conclusions and recommendations are those of the author and are not necessarily endorsed by the US Army References Jett M, Ionin B, Das R & Neil R (2001) The staphylococcal enterotoxins The Encyclopedia of Molecular Medicine New York, NY: John Wiley & Sons, Inc., 5: p 1089–1106 FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS C Mendis et al Torres BA, Perrin GQ, Mujtaba MG, Subramaniam PS, Anderson AK & Johnson HM (2002) Superantigen enhancement of specific immunity: antibody production and signaling pathways J Immunol 169, 2907–2914 Marrack P & Kappler J (1990) The staphylococcal enterotoxins and their relatives Science 248, 705–711 Cole B & Wells J (1990) Immunosuppressive properties of the mycoplasma arthritis T-cell mitogen in vivo: inhibition of proliferative responses to T-cell mitogens Infect Immun 58, 228–236 Saxena M, Williams S, Tasken K & Mustelin T (1999) Crosstalk between cAMP-dependent kinase and MAP kinase through a protein tyrosine phosphatase Nat Cell Biol 1, 305–311 Avis MI, Jett M, Boyle T, Vos DM, Moody T, Treston MA, Martinez A & Mulshine L (1996) Growth control of lung cancer by interruption of 5-lipoxygenase-mediated growth factor signaling J Clin Invest 97, 806–813 Cobb MH, Boulton TG & Robbins DJ (1991) Extracellular signal-regulated kinases: ERKs in progress Cell Regul 2, 965–978 Blenis J (1993) Signal transduction via the MAP kinases: proceed at your own RSK Proc Natl Acad Sci USA 90, 5889–5892 Das R & Vonderhaar BK (1996) Activation of raf-1, MEK, and MAP kinase in prolactin responsive mammary cells Breast Cancer Res Treat 40, 141–149 10 Mertens S, Craxton M & Goedert M (1996) SAP kinase-3, a new member of the family of mammalian stress-activated protein kinases FEBS Lett 383, 273– 276 11 Rouse J, Cohen P, Trigon S, Morange M, AlonsoLlamazares A, Zamanillo D, Hunt T & Nebreda AR (1994) A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins Cell 78, 1027–1037 12 Han J, Lee D, Bibbs L & Ulevitch J (1994) A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells Science 265, 808–811 13 Freshney NW, Rawlinson L, Guesdon F, Jones E, Cowley S, Hsuan J & Saklatvala J (1994) Interleukin-1 activates a novel protein kinase cascade that results in the phosphorylation of Hsp27 Cell 78, 1039–1049 14 Kyriakis JM & Avruck J (1996) Sounding the alarm: protein kinase cascades activated by stress and inflammation J Biol Chem 271, 24313–24316 15 Fan XM, Tu SP, Lam SK, Wang WP, Wu J, Wong WM, Yuen MF, Lin MC, Kung HF & Wong BC (2004) Five-lipoxygenase-activating protein inhibitor MK-886 induces apoptosis in gastric cancer through upregulation of p27kip1 and bax J Gastroenterol Hepatol 19, 31–37 Effects of SEB on human PBMCs 16 Lotzer K, Jahn S, Kramer C, Hildner M, Nusing R, ă ă Funk CD & Habenicht AJ (2007) 5-Lipoxygenase ⁄ cyclooxygenase-2 cross-talk through cysteinyl lenkotriene receptor in endothelial cells Prostaglandins and other Lipid Mediators 84, 108–115 17 Boldrick JC, Alizadeh AA, Diehn M, Dudoit S, Liu CL, Belcher CE, Botstein D, Staudt LM, Brown PO & Relman DA (2002) Stereotyped and specific gene expression programs in human innate immune responses to bacteria Proc Natl Acad Sci USA 99, 972–977 18 Mendis C, Das R, Hammamieh R, Royaee A, Yang D, Peel S & Jett M (2005) Transcriptional response signature of human lymphoid cells to staphylococcal enterotoxin B Genes Immun 6, 84–94 19 Junttila MR, Li SP & Westermarck J (2008) Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival FASEB J 22, 954–965 20 Nakagami H, Morishita R, Yamamoto K, Yoshimura S, Taniyama Y, Aoki M, Matsubara H, Kim S, Kaneda Y & Ogihara T (2001) Phosphorylation of p38 mitogenactivated protein kinase downstream of bax-caspase-3 pathway leads to cell death induced by high D-glucose in human endothelial cells Diabetes 50, 1472–1481 21 Lenczowski JM, Dominguez L, Elder AM, King LB, Zacharchuk CM & Ashwell JD (1997) Lack of a role for Jun kinase and AP-1 in Fas-induced apoptosis Mol Cell Biol 17, 170–181 22 Hii CS, Ferrante A, Edwards YS, Huang ZH, Hartfield PJ, Rathjen DA, Poulos A & Murray AW (1995) Activation of mitogen-activated protein kinase by arachidonic acid in rat liver epithelial WB cells by a protein kinase C-dependent mechanism J Biol Chem 270, 4201– 4204 23 Martich GD, Danner RL, Ceska M & Suffredini AF (1991) Detection of interleukin and tumor necrosis factor in normal humans after intravenous endotoxin: the effect of antiinflammatory agents J Exp Med 173, 1021–1024 24 Yan Z, Yang DC, Neill R & Jett M (1999) Production of tumor necrosis factor alpha in human T lymphocytes by staphylococcal enterotoxin B correlates with toxininduced proliferation and is regulated through protein kinase C Infect Immun 67, 6611–6618 25 Hale ML, Margolin SB, Krakauer T, Roy CJ & Stiles BG (2002) Pirfenidone blocks the in vitro and in vivo effects of staphylococcal enterotoxin B Infect Immun 70, 2989–2994 26 Fast DJ, Schlievert PM & Nelson RD (1989) Toxic shock syndrome-associated staphylococcal and streptococcal pyrogenic toxins are potent inducers of tumor necrosis factor production Infect Immun 57, 291–294 27 Miethke T, Duschek K, Wahl C, Heeg K & Wagner H (1993) Pathogenesis of the toxic shock syndrome: T cell FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS 3097 Effects of SEB on human PBMCs C Mendis et al mediated lethal shock caused by the superantigen TSST-1 Eur J Immunol 23, 1494–1500 28 Chan KF, Siegel MR & Lenardo JM (2000) Signaling by the TNF receptor superfamily and T cell homeostasis Immunity 13, 419–422 29 Rapoport MI, Hodoral LF & Beisel WR (1967) Influence of thorotrast blockade and acute renal artery ligation on disappearance of staphylococcal enterotoxin B from blood J Bacteriol 93, 779–783 30 Normann SJ, Jaeger RF & Johnsey RT (1969) Pathology of experimental enterotoxemia The in vivo localiza- 3098 tion of staphylococcal enterotoxin B Lab Invest 20, 17–25 31 Jett M, Neil R, Welch C, Boyle T, Bernton E, Hoover D, Lowell G, Hunt RE, Chatterjee S & Gemski P (1994) Identification of staphylococcal enterotoxin B sequences important for induction of lymphocyte proliferation by using synthetic peptide fragments of the toxin Infect Immun 62, 3408–3415 32 Schantz EJ, Roessler WG, Wagman J, Spero L, Dunnery DA & Bergdoll MS (1965) Purification of staphylococcal enterotoxin B Biochemistry 4, 1011–1016 FEBS Journal 275 (2008) 3088–3098 ª 2008 The Authors Journal compilation ª 2008 FEBS ... the early signaling events induced by SEB in human PBMCs to determine the pathway inter-connectors We hypothesized that Effects of SEB on human PBMCs such signaling inter-connectors can be effectively... partial inhibitory effect on JNK activation (Table 1) MAPK inhibitor PD98059 had a negligible effect on SEB -induced p38kinase, JNK and 5-LO activation, whereas p38kinase inhibitor SB203580 clearly blocked... showed an increase in cell proliferation at a much lower rate Both MK591 and SB203580 were able to block SEB -induced cell proliferation (Table 2) Effect of SEB and 5-LO inhibitor MK591 on human renal