A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ Fanjie Meng, Thomas M Suchyna and Frederick Sachs Center for Single Molecule Biophysics, Department of Physiology and Biophysics, State University of New York at Buffalo, NY, USA Keywords Cerulean; fluorescence resonance energy transfer; relative orientation factor; Venus; a-helix linker Correspondence F Sachs, Center for Single Molecule Biophysics, Department of Physiology and Biophysics, State University of New York at Buffalo, 3435 Main Street, Buffalo, NY, 14214 USA Fax: +1 716 829 2569 Tel: +1 716 829 3289 ext 105 E-mail: sachs@buffalo.edu (Received 15 December 2007, revised April 2008, accepted 11 April 2008) doi:10.1111/j.1742-4658.2008.06461.x To measure mechanical stress in real time, we designed a fluorescence resonance energy transfer (FRET) cassette, denoted stFRET, which could be inserted into structural protein hosts The probe was composed of a green fluorescence protein pair, Cerulean and Venus, linked with a stable a-helix We measured the FRET efficiency of the free cassette protein as a function of the length of the linker, the angles of the fluorophores, temperature and urea denaturation, and protease treatment The linking helix was stable to 80 °C, unfolded in m urea, and rapidly digested by proteases, but in all cases the fluorophores were unaffected We modified the a-helix linker by adding and subtracting residues to vary the angles and distance between the donor and acceptor, and assuming that the cassette was a rigid body, we calculated its geometry We tested the strain sensitivity of stFRET by linking both ends to a rubber sheet subjected to equibiaxial stretch FRET decreased proportionally to the substrate strain The naked cassette expressed well in human embryonic kidney-293 cells and, surprisingly, was concentrated in the nucleus However, when the cassette was located into host proteins such a-actinin, nonerythrocyte spectrin and filamin A, the labeled hosts expressed well and distributed normally in cell lines such as 3T3, where they were stressed at the leading edge of migrating cells and relaxed at the trailing edge When collagen-19 was labeled near its middle with stFRET, it expressed well in Caenorhabditis elegans, distributing similarly to hosts labeled with a terminal green fluorescent protein, and the worms behaved normally Mechanical stress is one of the most influential physical factors in biology and one of the least characterized Whereas it is obvious from molecular dynamics [1–4] and force spectroscopy [5–12] that forces deform molecules, the mechanics of cells are much more complicated, involving the interaction of heterogeneous polymers and membranes and their interaction with both two-dimensional heterogeneous liquid membranes [13,14] and three-dimensional cytoplasmic solutions, where signaling factors can vary in time and space [15–17] Mechanical interactions at the levels of cells, organs and organisms are responsible for such familiar physiological functions as motor function, hearing [18], touch [19], and the regulation of blood pressure [20], but the interactions are also deeply embedded in the biochemistry of the cell, affecting such varied processes as the phenotype of stem cells [21], DNA transcription [22,23], translation of cellular components by motor proteins such as kinesin [5], stress-induced changes of structure, such as occur in shear stress modulation of the cytoskeleton of the endothelia [24,25], and more general interactions due Abbreviations CFP, cyan fluorescent protein; COL-19, collagen-19; D ⁄ A ratio, donor emission to acceptor emission ratio; DIC, differential interference contrast; E, fluorescence resonance energy transfer energy transfer efficiency; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; HEK, human embryonic kidney; YPF, yellow fluorescent protein 3072 FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al to the physical chemistry of concentrated protein solutions [26] To dissect which stresses affect which functions, we need labels that are sensitive to mechanical stress and that can be attached to specific proteins To meet that need, we designed a cassette (denoted stFRET) that can be inserted into structural proteins and reports molecular strain via changes in fluorescence resonance energy transfer (FRET), and, with appropriate calibration, molecular stress The cassette consists of the green fluorescent protein (GFP) monomers Cerulean and Venus [27–31], linked by a stable a-helix [32] This article characterizes the properties of the probes, and shows that they can be efficiently incorporated into structural proteins such as collagen-19 (COL-19), nonerythrocyte spectrin, a-actinin and filamin A within living cells, and that the FRET from this cassette changes with stress in situ The efficiency of energy transfer for a FRET pair is E µ ⁄ [1 + (R ⁄ RO)6], where R is the distance between the dipoles and RO is the characteristic distance for 50% energy transfer [33] The maximal sensitivity for changes in R occurs at R = RO For Venus and Cerulean, RO is $ nm [34], so we linked them with a nm a-helix The efficiency is affected by the angle between the transition dipoles as well as the distance between them, and we estimated the probe geometry by varying the number of residues in the linker Removing one residue caused a large change in angle with a small change in distance, and adding or removing a full turn produced a change in distance with no change in angle We used six mutants to solve for the three relevant angles of the dipoles, assuming that the cassette was rigid stFRET was stable over temperature and mild urea denaturing conditions, but with m urea, the linker unfolded and the fluorophores remained stable Thus, stFRET is robust stFRET expressed well in various biological systems, including 3T3 and human embryonic kidney (HEK)293 cells and in Caenorhabditis elegans After insertion into a variety of structural host proteins such as collagen, filamin, actinin and spectrin, it distributed in the same manner as the same hosts with terminal GFP tags stFRET changed FRET with the spontaneous movement of motile cells, decreasing efficiency in regions under tension and increasing it in regions expected to be free of significant stress By axially stretching C elegans, we could demonstrate acute reversible changes in FRET associated with tension and relaxation stFRET opens the door to studying in real time many physiological processes that are modulated or driven by mechanical stress Mechanical stress sensor Results General configuration and FRET spectra of stFRET and its variants Figure is a diagram of stFRET geometry as deduced from the procedure described in Modeling and calibration in the Experimental procedures Figure 2A shows the general configuration of six stFRET variants The inward arrows show the excitation wavelength, and the outward arrows show the emission wavelength Width of arrows denotes light intensity Figure 2B shows the alignment of the DNA sequence of the linker with five modified versions (the predicted geometrical changes are shown in Table 1) As shown in Table 1, according to the general property of a-helices, one amino acid deletion produces a change ()100°) in angle with negli˚ gible change ()1.5 A) in length A five residue deletion of the helix rotates the structure by 360° but shrinks the helix by 2.7 nm Deletion or addition of two and a half turns of the helix twists the structure by )180° or +180° and decreases or increases the length by 1.35 nm Figure 2C gives the amino acid sequence and the segments of the helix linker that we modified Deletion of 18 amino acids eliminates five turns of the helix, and a nine amino acid deletion eliminates two and half turns Figure 3A shows the emission spectrum of stFRET with excitation at 433 nm There are peaks at 475 nm Fig Geometry of stFRET D and A are donor and acceptor dipole vectors, and r is the length of the linker The three angles (hA, hD, U) are the unknown parameters RA–D is the distance between acceptor and donor chromophores Table Changes in stFRET geometry caused by adding and deleting amino acids Positive symbols indicate an increasing amount, and negative symbol indicate a decreasing amount No amino acids added or subtracted Change in length of linker (nm) Change in angle of linker (radians) )1 )2 +9 )9 )18 )0.15 )0.3 +1.35 )1.35 )2.7 5p ⁄ 10p ⁄ p p FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3073 Mechanical stress sensor F Meng et al A B Fig Construction of stFRET protein and five variants (A) Schematic structure of stFRET Cyan is the donor, Cerulean; yellow is the acceptor, Venus The height of the b-can structure is 4.2 nm The black helix is the linker, and it nominal length is 5.0 nm Incoming arrows indicate excitation, and outgoing arrows indicate emission, with the wavelength marked next to them; the width of the arrows is proportional to the light intensity (B) Alignment of the primary and modified linker DNA sequences (C) Modifications to the linker with DNA and amino acid sequences C and 527 nm, with the 475 nm emission from the donor Cerulean and 527 nm from the acceptor Venus having robust energy transfer A 100 lm solution of unlinked donor and acceptor (1 : mixture, green filled squares and line with 433 nm excitation) had a small emission at 527 nm due to the bleed-through from Cerulean, the donor (blue filled inverted triangle and line) and some direct excitation of the acceptor Venus by 433 nm (black triangle and line) The donor and acceptor mixture had E = and donor emission to acceptor emission ratio (D ⁄ A ratio) = 2.47 ± 0.05 (Fig 3B) However, for stFRET, E = 44 ± 2.5% and D ⁄ A 3074 ratio = 0.47 ± 0.02, showing efficient energy transfer (for E and D ⁄ A ratio calculation, see Experimental procedures) Calibration of three angles and j2 Confident in the origin of stFRET energy transfer, we purified the other five variants and measured their fluorescence (Fig 4A) All mutants exhibited robust FRET (Table 2) stFRET itself had 44 ± 2.5% energy transfer, and the 5T construct had the highest efficiency, E = 56 ± 4.5%, the 2.5T construct increased FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al E to 47 ± 2.1%, whereas the 2.5I construct decreased E to 37 ± 0.9% FT1AA and FT2AA, presumably only having their angles changed, decreased E to 29 ± 7.1% and 38 ± 4.3%, respectively (Fig 4B) Table summarizes the apparent change of angles and distances obtained by modifying the linker and the corresponding energy transfer efficiency If we assume that a single residue alters the linker length by a translation of 0.15 nm and 100°, and that the structure is rigid, we can use the data in Table to solve for the probe geometry (see Experimental procedures) The numerical solutions gave hA = 3.83, hD = )0.78 and U = 1.97 radians, and j2 = 0.86, which is 30% higher than ⁄ 3, the j2 value that one would obtain assuming random rotation of the donor and acceptor (Fig 1) However, it should be pointed out that a value of j2 $ ⁄ does not necessarily imply that the probes are moving randomly Stability of the linker as perturbed by urea, temperature, and proteinase K We did a number of tests to assess linker integrity If the linker was an a-helix, then melting would increase the end–end spacing and the efficiency would decrease With urea as a denaturant [35,36], Fig 5A shows that the efficiency of stFRET declined with concentration up to m, and the previously quenched donor emission recovered Remarkably, the fluorophore spectra were almost unaffected by urea, with < 10–15% change in amplitude (Fig 5C,D) Figure 5B shows that 1–8 m urea caused the D ⁄ A ratio to increase from 0.46 to 1.21, as expected if the helix unfolded into a random coil allowing the donor and acceptor to move further apart and reducing energy transfer (Fig 5E) As a second test of the helix stability, we tried to melt stFRET at elevated temperatures, but the protein proved stable up to 80 °C Figure 6A shows the temperature dependence of fluorescence of 100 lm stFRET protein excited at 433 nm from room temperature to 80 °C Donor and acceptor emission both declined somewhat as the temperature increased, probably due to a direct change in quantum efficiency, but there was no significant change in transfer efficiency from 60 °C to 80 °C, the upper limit of our measurements, so that the linker structure can be considered to be quite robust As a final test of linker integrity, we digested stFRET with proteases that cut the linker but left the fluorophores intact Figure shows that proteinase K led to a rapid fall in efficiency that was complete within The D ⁄ A ratio changed from 0.42 to Mechanical stress sensor 1.95 over 30 (Fig 7B), as compared to a change from 0.46 to only 1.21 when the protein was treated with m urea (Fig 5B) Similar behavior was found for all six constructs (data not shown) The donor and acceptor fluorophore spectra were unaffected by proteinase K after 30 of digestion (Fig 7C,D) Figures 5E and 7E are diagrammatic models summarizing the energy transfer between donor and acceptor under different treatments (the width of the arrows represents signal intensity) In vitro measurement of strain sensitivity To verify the strain responsiveness, we bonded the ends of derivatized stFRET to a silicone rubber sheet using StreptagII–Streptactin and stretched the sheet equibiaxially on the fluorescence microscope When the C-terminal and N-terminal ends of stFRET were derivatized so that it would be stretched with the sheet, there was a reversible $ 11% decrease in the D ⁄ A ratio (Fig 8) As a control, we measured FRET from stFRET that was derivatized at one end only so that it was simply immobilized but not stretched and there was no significant change in FRET with strain (Fig 8) Nonspecific binding of double-tagged stFRET to an untreated silicone surface also produced no significant change in FRET with strain Thus, stFRET is sensitive to strain, as expected from the solution assays and the design of the probe Eukaryotic expression and targeting property of stFRET Before inserting stFRET into host proteins, we placed the gene under a eukaryotic promoter (human cytomegalovirus) and transiently transfected HEK cells with stFRET alone Control transfections with Venus or Cerulean monomers showed no preferential localization and no obvious energy transfer (Fig 9A–F) Cells transfected with stFRET displayed significant energy transfer (Fig 9I) stFRET localized to the nucleus with an extremely high density in the nucleoli (Fig 9K) Nuclear targeting proteins have a consensus amino acid sequence of lysine ⁄ arginine [K ⁄ R(4–6)] or smaller clusters separated by 10–12 amino acids: [K ⁄ R(2)X(10–12)K ⁄ R(3)] [37] The linker has multiple arginine clusters similar to the nuclear targeting sequence, but simply removing one or the other fluorophores from stFRET produced a uniform cytoplasmic distribution showing that the linker’s sequence alone was not sufficient for targeting These unexpected nuclear targeting properties of stFRET may provide FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3075 Mechanical stress sensor F Meng et al A A B B C Fig FRET efficiency and D ⁄ A ratio (mean ± SD) (A) Spectra of stFRET, Cerulean and Venus monomers and Cerulean and Venus in a : mixture Venus + Cerulean mixture, green filled squares Donor Cerulean, blue inverted triangles and line Acceptor Venus, black triangles and line Pure stFRET protein, red filled circles and line (B) FRET efficiency and D ⁄ A ratio of stFRET with Cerulean and Venus in a : mixture Data were obtained with protein from three separate purifications CV is Cerulean and Venus in a : mixture FT, stFRET Excitation 433 nm; emission 460–550 nm a useful tool for understanding nuclear protein transport Host proteins of stFRET with normal expression showing stress sensitivity We inserted stFRET into various host proteins, including COL-19 (Fig 10G), nonerythrocyte spectrin (Fig 10E), filamin A (Fig 10C), and a-actinin (Fig 10A), and expression systems including HEK-293, 3T3 and C elegans, and the insertion locations were optimized to obtain protein distributions similar to those observed for the host protein C-terminus tagged with GFP or Cerulean (Fig 10B,D,F,H) Inserting stFRET into host proteins eliminated nuclear targeting The fluorescence of stFRET in cultured cells was 3076 Fig Modification of the linker change FRET efficiency of six constructs (A) Fluorescence spectra of stFRET and its five variants (scan parameters as in Fig 3) (B) FRET efficiency of the six constructs (C) SDS ⁄ PAGE gel of the purified proteins, and Cerulean and Venus monomers FT stands for stFRET; 5T and 2.5T are constructs with five-turn or 2.5-turn deletions from the linker; 2.5I is the construct with a 2.5-turn insert; FT1AA and FT2AA are the constructs with one amino acid or two amino acid deletions All values are means ± SD, and the data were obtained with proteins from three separate purifications located in the cytoplasm and ⁄ or the cell membrane, depending on the host (Fig 10A,C,E) We expressed the construct of the most abundant collagen in C elegans, COL-19, and the protein was properly assembled, showing the typical striated pattern, and the worms behaved normally When we stretched the worm with micromanipulators, the labeled COL-19 showed a decrease in FRET efficiency with stretch, and in convex regions as it actively wiggled (Fig 10G,H) Figure 11 indicates that stFRET integrated into actinin and filamin can sense tension in situ Migrating FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al Mechanical stress sensor Table Values of parameters in Eqn (8) of six stFRET variants as described in Fig Protein constructs Energy transfer efficiency (E) (%) r (linker length) (nm) Z (H ⁄ of b-Can) (nm) hA (unknown parameter 1) hD (unknown parameter 2) U (unknown parameter 3) stFRET 5T 2.5T 2.5I FT1AA FT2AA 44 56 47 37 29 38 5.0 5.0 5.0 5.0 5.0 5.0 2.1 No change hA No change hD No change U U U U U U ± ± ± ± ± ± 2.5 4.5 2.1 0.9 7.1 4.3 – 2.7 = 2.3 – 1.35 = 3.65 + 1.35 = 6.35 – 0.15 = 4.85 – 0.3 = 4.7 + + + + p p 5p ⁄ 10p ⁄ Fig Melting the linker (A) Spectra from stFRET treated with 1–8 M urea (scan parameters as in Fig 3B) (B) D ⁄ A ratio of stFRET after treatment with different concentrations of urea (means ± SD, n = in each treatment); increasing D ⁄ A ratio indicates the recovery of donor emission and decrease of energy transfer (C) Cerulean monomer fluorescence with urea treatments (scan parameters as in Fig 3) (D) Venus monomer fluorescence with urea (excitation at 515 nm and scan 520– 600 nm) (E) Urea melts the linker and leaves the donor and acceptor intact, decreasing FRET energy transfer as donor emission recoverers and D ⁄ A ratio increases (definitions as in Fig 2A) 3T3 cells have a characteristic leading and lagging edge, and Fig 11A–C shows the donor, acceptor and FRET images from three confocal microscopy chan- nels stFRET was distributed evenly across the cytoplasm as visualized with a 16-color pseudocolor map (Fig 11C,D) Transfection with actinin–stFRET FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3077 Mechanical stress sensor F Meng et al Figure 11K is the FRET efficiency image in which three domains were selected The efficiency in the redoutlined domain is twice as high as that in the blue and green domains (Fig 11L) These data suggest that tension in both actinin and filamin is lower in domains close to the lagging edge (where adhesion to the substrate is released), and higher at the leading edge where adhesions pull the cell forward A Discussion B Fig a-Helix linker in stFRET is resistant to temperature melting (A) stFRET spectra obtained at 60 °C for min, 60 °C for min, 70 °C for and 80 °C for (scan parameters as in Fig 3) (B) stFRET D ⁄ A ratio after different temperature treatments (means ± SD, n = in each treatment) Temperatures are given in degrees Celsius; roomtem, room temperature revealed that during migration, the lagging edge showed higher energy transfer than the leading edge (Fig 11E,F), i.e it was relaxed We measured the efficiency of various domains in the lagging and leading edges from 14 confocal image stacks The lagging edges (the red-outlined domain) nearly doubled the FRET efficiency as compared to the leading edge (blue- and green-outlined domains) Multiple cells had the same behavior, but because of the complexity of the various shapes it was difficult to arrive at any useful statistic for frequency We have shown a typical cell with different domains as an internal control The same phenomenon was observed in filamin–stFRETtransfected 3T3 cells (Fig 11G–L) Figure 11G–I shows three confocal image channels, and Fig 11J is the pseudocolor image of stFRET protein distribution 3078 Designed to be an in situ stress sensor, stFRET has robust and predictable energy transfer both in vitro and in vivo We were able to explore the geometry of stFRET by perturbing the linker length and terminal angles using the known properties of a-helices FRET efficiency changed in a predictable manner with the postulated geometry, suggesting that the fluorophores are not free to rotate A recent molecular dynamics simulation study of FRET in lysozyme found that j and RO could be correlated by as much as 0.8, so that FRET measurements that assume random rotational freedom are likely to be in error [38] The ability to change angle and distance by varying the linker can be used in vivo to examine the effect of host proteins on probe geometry Regardless of the coupling of the fluorophores to the linker, all of the host proteins that we studied were coiled-coiled dimers or trimers, so that the fluorophores of stFRET would not be able to rotate freely Figure 2A shows the predicted mean structure of free stFRET The three unknown angles of Eqn (8) (see Experimental procedures) were solved using data for the six mutants using the least squares equation solver in maple The solutions were stable to perturbations of the starting values, suggesting that we were measuring a constrained system Our final solution was hA = 3.83, hD = )0.78, and U = 1.97, yielding j2 = 0.86 There will be bending and flexing motions of the structure in solution, but we obtained consistent answers from the overdetermined set of equations, suggesting that the calculated mean values are at least self-consistent The geometric values that we have calculated would represent mean values weighted by the efficiency Fluctuations that bring the dipoles closer are more heavily weighted than those that move them further away, although the probability of occupancy of these conformations is another weighting factor A detailed molecular dynamics simulation would be useful, but is not essential for the use of stFRET as a probe of molecular stress, as the most important variables are the differences in efficiency, i.e the gradients of stress FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al Mechanical stress sensor A B C D Fig Two units of proteinase K (1 unitỈlL)1) digests the linker but not Cerulean or Venus (A, C, D) Spectra of stFRET protein (A), Cerulean (C) and Venus (D) digested for 20 s, min, min, min, min, 10 min, 15 and 30 at room temperature with 200 lL of 100 lM protein (B) Time course of D ⁄ A ratio for proteinase K digestion of stFRET (E) Proteinase K cleaved the linker and eliminated FRET in stFRET protein PK, proteinase K; S, seconds; M, minutes; n = The robust nature of stFRET was clear from the melting experiments stFRET was thermally stable up to at least 80 °C, with the FRET efficiency being virtually unchanged Melting the linker with urea (Fig 5) [39] left the fluorophores untouched (Fig 5C,D), but decreased the energy transfer, consistent with unfolding of the linker (Fig 5B,E) Two models have been proposed for urea-induced protein denaturation: the binding model, in which the denaturant binds weakly but specifically to sites exposed by the unfolded proteins [40], and a solvent exchange model, in which the interaction of the solvent and the denaturant is a onefor-one substitution reaction at particular sites [41] stFRET might serve as a useful probe to examine these alternatives The sensitivity of stFRET to protease cleavage has both positive and negative implications If proteases are accidentally present in situ, they could cleave E Proteinase K stFRET and provide misleading results We saw no evidence of protease activity in HEK or 3T3 cells or C elegans However, the presence of intracellular proteases has been associated with acute pancreatitis, proposed to arise from trypsin overactivation in large endocytotic vacuoles of acinar cells [42] Thus, to study pancreatitis, stFRET may be a useful probe (Fig 7) Having established the basic physical properties of stFRET, we expressed it in HEK cells (Fig 9) and evaluated the energy transfer by Xia’s method [43], using confocal microscopy The surprising localization of stFRET to the nucleus was proved not to be a result of the linker possessing a consensus nuclear targeting sequence, as deletion of either fluorophore from the construct destroyed localization This adaptability suggests that stFRET can serve as a useful probe of nuclear targeting FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3079 Mechanical stress sensor F Meng et al 100 mmHg 1s 3.0 FRET ratio 11% 2.5 2.0 1.5 Untreated - double Strep-Tag2 Strep-tactin treated - double Strep-Tag2 Strep-tactin treated - single Strep-Tag2 Fig Double Streptag II-tagged stFRET shows a decrease in FRET ratio when stretched on silicone rubber disks Single and double Streptag II-tagged stFRETs were allowed to bind to either untreated or Strep-tactin-modified silicone disks The FRET ratio was monitored in 10 spots on each disk during application of the suction stimulus shown Only the disks with Strep-tactin-treated surfaces and stFRET proteins with Streptag tags at both the C-terminus and N-terminus showed a significant change in FRET ratio when stretched Knowing how native stFRET itself distributes, we incorporated it into host proteins, including nonerythrocyte spectrin, filamin A and a-actinin (Fig 10A,C,E) in 3T3 cells, and COL-19 in C elegans (Fig 10G) The distribution of the probe depended upon where the cassette was placed within the host When it was inserted towards the middle, the fluorescence distribution appeared similar to that of the host protein tagged with GFP or cyan fluorescent protein (CFP) at the C-terminus (Fig 10B,D,F,H) Insertion of the cassette towards the termini of the host led to different spatial distributions There is no gold standard for the proper localization of proteins in cells, as fixation and exposure to various tracer ligands can produce changes in structure, but, to first order, the stFRET probes placed in the middle of the hosts appeared to cause minimal perturbation Under physiological conditions, FRET efficiency varied in different regions of the cells (Fig 11), and these seemed to be correlated with the anticipated distribution of stress Efficiency should be reduced when the host is under tension Actinin–stFRET and filamin–stFRET generally showed lower efficiency than free stFRET (Fig 3B), suggesting that those proteins were normally under tension (Fig 11E,F,K,L, green- A B C D E F G I J 3080 H K L Fig stFRET expressed in HEK-293 cells exhibits efficient FRET (A–C) Confocal reference image of Cerulean taken from the CFP channel (A) and the DIC channel (B), with the overlap in (C) (D–F) Reference image of Venus from the YFP (D) and DIC channels (E), with the overlap in (F) (G–K) Images of stFRET using the CFP channel (G), YFP channel (H), FRET channel (I) and DIC channel (J), with the overlap of these four channels in (K) (L) The vFRET index was calibrated pixel by pixel using Xia’s method [43] Hollow black regions were excluded from the calculation because of intensity saturation stFRET is localized in the nucleus and especially concentrated in the nucleoli (arrowheads) FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al Mechanical stress sensor A B C D E F G H efficiency associated with increased tension in the leading edge as the cell was pulled forward To turn stFRET from a strain sensor into a stress sensor, we need to measure its force–distance properties At the current time, we only have estimates from published atomic force microscopy data on the stretching of the coiled-coil myosin II [44] Schweiger et al [45] obtained a three-phase force–distance relationship: a linear phase of $ mNỈm)1, a plateau of $ 25 pN, and a wormlike chain phase as the helices were stretched closer to the contour length The presence of a force plateau implies that if monomeric stFRET was subjected to a force of > 10–25 pN, it would unfold in an all-or-none manner for about nm, producing a large drop in FRET We not see this, probably in part because the in situ probes are not homomers, but are coiled coils where the stress is shared with labeled and unlabeled neighbors It may be possible to knock down the background hosts to at least create homogeneously labeled hosts In addition, stress is shared between different proteins within the cell, and at the current time, we are only probing one of those components stFRET can be applied to any biological system with large covalently bonded proteins It is possible to examine the role of stress in selected proteins within cells or even within free-ranging organisms With organ targeting in small organisms such as C elegans and zebrafish, it should be possible to develop highcontrast video images of specific parts of the organism during controlled or natural behavior We look forward to finding out how mechanical stress is coupled to biochemistry and to cell biology Experimental procedures Gene construction and protein purification Fig 10 Normal expression of stFRET in various host proteins a-Actinin–stFRET (A), a-actinin–GFP (B), filamin A–stFRET (C), filamin A–CFP (D), spectrin–stFRET (E) and spectrin–CFP (F) in 3T3 fibroblast cells; Collagen-19–stFRET (G) and COL-19–GFP (H) in C elegans (with assistance of R Gronostajski; Biochemistry Department, State University of New York at Buffalo, NY, USA) Arrowheads indicate the striated expression pattern and central line in the worm cuticle line and blue-line domains) However, as cells migrate, the stress in the leading and trailing edges changes Connections to the extracellular matrix in the lagging edge must be disengaged and the connections at the leading edge put under tension Figure 11E,F,K,L shows increased FRET efficiency in the lagging edge as the filopodia were released from the substrate and tension decreased (red-line domains), and decreased pEYFP-C1 Venus and pECFP-C1 Cerulean plasmids were generous gifts from D W Piston (Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, TN, USA) [45] The Cerulean gene was subcloned from pECFP-C1 with the primers 5¢-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG GAGC-3¢ and 5¢-CCAGATCGCGGCCGCCTTGTACAG CTCGTCATGCCGAGAG-3¢; EcoRI and ApaI restriction enzyme sites were introduced into the 5¢-end and 3¢-end of the Cerulean DNA fragment This DNA fragment was inserted into multiple cloning sites of pEYFP-C1 Venus by EcoRI and ApaI digestion and ligation The resulting vector has Venus followed closely by Cerulean, and between them there are two restriction enzyme sites, BglII and EcoRI, which then were employed to insert the a-helix linker The a-helix linker DNA, 5¢-GGCCTGCGCAAGCGCTTACG FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3081 Mechanical stress sensor F Meng et al A B C D E F G H I J K L Fig 11 stFRET senses the strain change in actinin and filamin Actinin–stFRET-transfected 3T3 fibroblast confocal images were taken in three channels: (A) CFP donor channel, (B) FRET channel, and (C) YFP acceptor channel Actinin–stFRET protein expression levels were displayed by applying the IMAGE J lookup table (LUT) 16-color color map to the YFP acceptor channel image Arrows show the leading edge, lagging edge, and the cell domains with missing filopodia (D) FRET efficiency was calculated by E = nF ⁄ (nF + ID), in which nF is the net FRET from the FRET channel, and ID is the donor intensity from the donor channel (E) The E-value was shown by the IMAGE J LUT 16-color color map (F) Three cell domains were selected for statistical analysis of E, and 14 confocal stacks of each domain were measured and analyzed (G–L) Histogram bars have the same colors as the related domains in (E) Filamin–stFRET confocal images Three scan channels (G, H, I) are as for actinin–stFRET images Arrangements and statistics of filamin–stFRET images (J, K, L) are as for actinin–stFRET images 3082 FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3¢, was synthesized by Operon (Huntsville, Alabama, USA) and amplified by PCR, and BglII and EcoRI sites were introduced into the 5¢-end and 3¢-end The final construct with a-helix connecting Venus and Cerulean was named stFRET and was ready for eukaryotic expression In order to purify the protein, stFRET gene was subcloned into the prokaryotic expression vector PinPoint Xa-3 (Promega, Madison, WI, USA), using BamHI and NotI restriction sites, which were introduced into FRET DNA fragment by using the following primers: 5¢-GCTTCAGCTGGGATCCGGTGGTATGGTGAG CAAGG-3¢; and 5¢-CCAGATCGCGGCCGCTTAGTGG TGATGATGGTGGTGATGATGCTTGTACAGCTCGT CC-3¢ Following the His8-tag, a TAA stop codon was inserted in front of the NotI site, to ensure that the His-tag was located in the C-terminus and was well exposed to the solution By modifying the linker in PinPoint–stFRET constructs, we created five other constructs and named them on the basis of the modification They are: 5T, with five turns of the peptide chain truncated off the a-helix; 2.5T, with 2.5 turns truncated off; 2.5I, with 2.5 turns of the linker duplicated and inserted back into the a -helix; and FT1AA and FT2AA, with one and two amino acid residues deleted from the linker The primers used for PCR were as follows: 5T sense primer, 5¢-GCGCAAGCGCTTACGAA AATTCGTGCCGAAACTTGCA-3¢; 5T antisense primer, 5¢-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC GAA-3¢; 2.5T sense primer, 5¢-GCGCAAGCGCTTACG ACTTAAAAAAATTGGTCAGAAAATCCAGG-3¢; 2.5T antisense primer, 5¢-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3¢; 2.5I sense primer, 5¢-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3¢; 2.5I antisense primer, 5¢-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ATTTTCTTTTCTTTAATCTTGTTTC-3¢; FT1AA sense primer, 5¢-GATTAAAGAAAAGCTTAAAATTGGTCA GAAAATCC-3¢; FT1AA antisense primer, 5¢-GGA TTTTCTGACCAATTTTAAGCTTTTCTTTAATC-3¢; FT2AA sense primer, 5¢-CAAGATTAAAGAAAAGCT TATTGGTCAGAAAATCC-3¢; FT2AA antisense primer, 5¢-GGATTTTCTGACCAATAAGCTTTTCTTTAATCT TG-3¢ All the insertions and deletions were performed with a site-directed mutagenesis kit from Stratagene (La Jolla, CA, USA) As host proteins for stFRET, the COL-19 gene was subcloned into the Pinpoint Xa-3 vector, and the filamin A, a-actinin and nonerythrocytic spectrin genes were subcloned into the pEYFP-C1 vector in which the yellow fluorescent protein (YFP) gene was deleted Different sites in these host proteins were tested to maximally retain their function after integrating stFRET into them All constructs were confirmed by sequencing data from Roswell Park Cancer institute (Buffalo, NY, USA) Mechanical stress sensor Plasmid DNA of six proteins constructs and Venus and Cerulean monomers were transformed into Escherichia coli cells [BL21(DE3pLacI) from Novagen, Gibbstown, NJ, USA] for expression Proteins were purified as previously described [45] Five hundred milliliters of LB broth containing 50 mgỈmL)1 ampicillin was inoculated with mL of overnight cell culture from a single colony of each construct Cells were cultured at 37 °C and with 250 r.p.m orbital shaking until the attenuance value reached 0.6 Isopropyl thio-b-d-galactoside (1 mm final concentration) (Sigma, St Louis, MO, USA) was applied to the culture to induce protein expression, and the temperature was adjusted to 30 °C for overnight expression The cells were harvested by centrifugation at 4000 g for 10 at °C The pellets were stored at )20 °C for later use, or used immediately for the lysis step Five milliliters of bugbuster protein extraction reagent (Novagen) containing 25 unitsỈmL)1 Benzonase (Novagen), 1000 unitsỈmL)1 rLysozyme(Sigma), mm phenylmethylsulfonyl fluoride, 10 lgỈmL)1 pepstatin and 20 lgỈmL)1 leupeptin was used for protein extraction from each gram cell pellet Cells were kept at room temperature for 30 for the lysis Soluble proteins were separated by centrifuging for 30 at 10 000 g at °C Ni–nitrilotriacetic acid His-tag elution buffer (250 mm imidazole, 300 mm NaCl, 50 mm Na2HPO4, 0.2% Tween-20, pH 8.0) was added to the protein solution to give a final concentration of imidazole of 20 mm One milliliter of Ni–nitrilotriacetic acid His.bind slurry (Novagen) was used per mL of clear lysate, and gently mixed by shaking at °C for 60 The solution was loaded on a column and washed with 10 bed volumes of washing buffer (20 mm imidazole, 300 mm NaCl, 50 mm Na2HPO4, 0.2% Tween-20, pH 8.0) by gravity flow Proteins retained on the column were washed off with elution buffer The protein concentration was determined with a bicinchoninic acid protein kit (Pierce, Rockford, IL, USA) and measured with an ND-1000 spectrophotometer (Nanodrop, Wilmington, DE, USA) SDS ⁄ PAGE analysis was used to check the protein purity Proteins with > 95% purity were used for further assays; otherwise, proteins were dialyzed against Tris ⁄ HCl buffer (10 mm Tris ⁄ HCl, mm dithiothreitol, 50 mm NaCl, 0.2% Tween-20, pH 7.4), and then the Ni–nitrilotriacetic acid His-tag purification procedure was repeated to achieve a purity of 95% All purified proteins were finally exchanged into 10 mm Tris ⁄ HCl buffer with a Spectra ⁄ Pro Dispodyalyzer (Spectrum, relative molecular mass cut-off 10 000) for further spectroscopy measurements Cell culture and transfection HEK-293 and 3T3 fibroblast cells were cultured in DMEM (Gibco, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum and antibiotics Cells were spread on 3.5 mm coverslips and allowed to grow for 24 h, and 1.0 lg of plasmid DNA for each coverslip was delivered FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3083 Mechanical stress sensor F Meng et al into cells with a Fugene6 kit (Roche, Indianapolis, IN, USA) After 24–36 h of growth, cells displaying significant fluorescent protein expression were used for confocal microscopy Confocal microscopy and data analysis Cerulean-, Venus- and stFRET-transfected HEK cells were visualized with an LSM510 META confocal microscope (Carl Zeiss, Jena, Germany) 48 h after transfection Ar laser (458 and 514 nm) lines were employed for excitation of FRET donor and acceptor One multichannel stack of the confocal images of Cerulean, Venus and FRET was obtained with an oil-merged 63·, 1.4 numerical aperture apochromat objective lens (Carl Zeiss) and CFP, YFP or FRET filter sets; meanwhile, differential interference contrast (DIC) images were taken The sensitized emission method was used to collect the images from the donor channel, acceptor channel and FRET channel Data acquisition and processing were performed with FRET plus macro with Xia’s method [43] The normalized FRET index was calculated pixel by pixel with the equation NFRET ¼ IFRET À IYFP Â a À ICFP Â b pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi IYFP Â ICFP in which the numerator is the net fluorescence energy transfer nFRET and constants a and b are the ratios of bleedthrough of the YFP signal into the FRET channel and the CFP signal into the FRET channel [46] ð2Þ In Eqn (1), IDFree was obtained from a Cerulean ⁄ Venus : mixture, and IDA is the fluorescence intensity of the donor when it is linked to the acceptor; in Eqn (2), ID is the donor emission at 475 nm, and IA is the acceptor emission at 527 nm Excitation and emission wavelengths for data acquisition are shown in parentheses Modeling and calibration For an a-helix, deletion of one amino acid changes the length by 0.15 nm and the angle between the termini by 100° Assuming that the cassette was a rigid body, we made six mutants that would have known spacing and angles to calculate the probe geometry Figure is a diagram of stFRET geometry as deduced from the following proce! ! dure H C is the donor dipole vector and G B is the ! acceptor dipole vector RD–A (B C ) is the distance between ! donor and acceptor, and r (GH ) is the length of the linker hA is the angle between the acceptor and the linker axis, and hD is the angle between donor and linker axis hT is the angle between the acceptor and donor U is the dihedral angle between plane (D r) and plane (A r) In the dia! ! gram, B I is equal and parallel to F E , and both are perpen! ! ! ! dicular to line GH B F is parallel and equal to I E C E is ! also perpendicular to E I Let CH = GB = Z; then Z is the half-height of the Cerulean and Venus b-cans After some trigonometry and algebra, we found that: ỵ 2rZcoshD ỵ coshA ị ỵ r We used a uorescence spectrometer (Aminco, Bowman Series 2) to measure the fluorescence of purified proteins in solution All purified proteins were exchanged into 10 mm Tris ⁄ HCl buffer before processing The efficiency was usually measured at room temperature with 200 lL of 100 lm protein The spectrometer was set as follows: bandpass, nm, nm step size, and emission scan range 450–550 nm for measuring FRET, 450–500 nm for Cerulean monomer, and 520–600 nm for Venus monomer Cerulean excitation was at 433 nm and Venus excitation was at 515 nm FRET efficiency We used two indexes of energy transfer; first [47]: IDFreeð475Emission;433ExcitationÞ À IDAð475Emission;433ExcitationÞ IDFreeð475Emission;433ExcitationÞ ð1Þ in which IDFree is the signal intensity of free donor, and IDA is the donor fluorescence intensity when connected to acceptor, and second [48]: 3084 IDð475Emission;433ExcitationÞ IA527Emission;433Excitationị RAD ẳ 2Z sinhA sinhD cos/ þ coshA coshD Þ In vitro fluorescence energy transfer measurement Eẳ D=ARatio ẳ 3ị The relative orientation factor j2 and coshT are defined in [49] as: j2 ¼ ðcoshT À 3coshD coshA ị2 4ị coshT ẳ sinhD sinhA cos/ỵcoshD coshA ð5Þ The distance Ro, at which E = 50%, is given implicitly by [50]: Z 9000ln10ịj2 /d R6 ẳ f kịekịk4 dk ẳ j2 C 6ị o 128p5 Nn4 where C is a constant characteristic of the spectral properties of Cerulean and Venus and Ro = 4.9 nm [34], so that C = Ro6 ⁄ (2 ⁄ 3) = 4.96 ⁄ (2 ⁄ 3) As E¼ R6 o R6 ỵ RAD o 7ị substituting Eqns (3,4,5,6) into Eqn (7) yielded: FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al EstFRET ¼ Mechanical stress sensor ðsinhD sinhA cos/À2coshD coshA Þ2 C ðsinhD sinhA cos/À2coshD coshA Þ2 C ỵ ẵZsinhD ị2 ỵ ZsinhA ị2 2Z2 sinhD sinhA cos/ỵr ỵ ZcoshA ỵZcoshD ị2 8ị There are only three unknowns in Eqn (8), hA, hD and U, which determine the orientation factor j2 as well as the global configuration of the protein With six linker mutants, we had six equations to calculate the three unknowns, which we did with a least squares solution in maple Testing of the linker in purified stFRET Purified proteins were subjected to proteinase K digestion, temperature and or urea melting One unit of proteinase K (500 unitsỈmL)1) was used to digest 200 lL of protein solution (100 lm) in Hepes buffer (100 mm Hepes, 100 mm NaCl, 10 mm Na2HPO4, pH 7.4) for 20 s, min, min, min, 10 or 30 Cerulean and Venus monomers were also treated with proteinase K under the same conditions as used for controls For urea treatment, we used 10 lL of protein (10 mgỈmL)1 in 10 mm Tris ⁄ HCl buffer) diluted into 200 lL of m, m, m, m, m, m, m, m of Hepes buffer or Hepes buffer only, and incubation at room temperature for 10 Thermal melting was done by heating the stFRET solutions to 60 °C, 70 °C and 80 °C for 2–5 and immediately measuring the fluorescence energy transfer with a spectrometer Stretching stFRET on a silicone rubber sheet Silicone rubber disks with amino modified surfaces (Flexcell International, Hillsborogh, NC, USA) were converted to carboxyl groups with 0.1 mm methyl N-succinimidyl adipate in NaCl ⁄ Pi for h at room temperature These groups were converted to crosslinkers by treating them with mm 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride and mm N-hydroxysuccinimide in 0.1 m Mes buffer (pH 6) for 15 Strep-tactin (a streptavidin variant; IBA, St Louis, MO, USA) at mgỈmL)1 in NaCl ⁄ Pi was then crosslinked to the surface for h at room temperature Derivatized stFRET proteins were constructed with Streptag II linked to the C-terminaus for single-tagged stFRET and to the C-terminus and N-terminus for doubletagged stFRET These proteins were allowed to bind overnight to untreated and to Strep-tactin-modified disks in NaCl ⁄ Pi ⁄ 0.05% Tween-20 ⁄ 1% BSA The disks were then washed three times for h with NaCl ⁄ Pi ⁄ 0.05% Tween20 ⁄ 1% BSA Membranes were placed on a modified StageFlexer (Flexcell International, Hillsborogh, NC, USA), which allowed us to apply equibiaxial strain to the disks with suction from an HSPC-1 Pressure Clamp (ALA Instruments, Westbury, NY, USA) controlled by Axon Instruments pclamp software (Molecular Devices, Sunnydale, CA, USA) Application of )200 mmHg of suction produced 10–15% strain (strained diameter ⁄ initial diameter) CFP–YFP emission intensities were monitored on an Axiovert 135 microscope (Zeiss) equipped with a DualView DV-CC beam splitter (Photometrics, Ottobrunn, Germany) with CFP–YFP splitter optics and an iXon DV887 EM cooled CCD camera (Andor, UK) The FRET ratio was determined using imagej software (NIH) to analyze and process the video data of the stretched membrane FRET ratio = (I535 – I535 CFP Bleed) ⁄ I470, where I470 = emission intensity at 470 nm, I535 = emission intensity at 535 nm, and I535 CFP Bleed = calculated fractional bleed of CFP fluorescence (0.9 · I470) into the 535 nm channel The equibiaxial strain was measured by placing fiducial marks on the rubber and measuring the resulting strain Acknowledgements We acknowledge the assistance of the Confocal Microscope and Flow Cytometry Facility in the School of Medicine and Biomedical Sciences, University at Buffalo, and Mr Jeff Niggel for assistance with the spectrofluorometer We thank Dr Richard M Gronostajski and Dr Elena Lazakovitch for helping us to make transgenic worms This work was supported by the NIH References Ortiz V, Nielsen SO, Klein ML & Discher DE (2005) Unfolding a linker between helical repeats J Mol Biol 349, 638–647 Craig D, Gao M, Schulten K & Vogel V (2004) Structural insights into how the MIDAS ion stabilizes integrin binding to an RGD peptide under force Structure 12, 2049–2058 Kosztin I, Bruinsma R, O’Lague P & Schulten K (2002) Mechanical force generation by G proteins Proc Natl Acad Sci USA 99, 3575–3580 Marszalek PE, Lu H, Li H, Carrion-Vazquez M, Oberhauser AF, Schulten K & Fernandez JM (1999) Mechanical unfolding intermediates in titin modules Nature 402, 100–103 FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3085 Mechanical stress sensor F Meng et al Carter NJ & Cross RA (2006) Kinesin’s moonwalk Curr Opin Cell Biol 18, 61–67 Gosse C & Croquette V (2002) Magnetic tweezers: micromanipulation and force measurement at the molecular level Biophys J 82, 3314–3329 Wang MD, Yin H, Landick R, Gelles J & Block SM (1997) Stretching DNA with optical tweezers Biophys J 72, 1335–1346 Brown AEX, Litvinov RI, Discher DE & Weisel JW (2007) Forced unfolding of coiled-coils in fibrinogen by single-molecule AFM Biophys J 92, L39–L41 Lu ZY, Nowak W, Lee GR, Marszalek PE & Yang WT (2004) Elastic properties of single amylose chains in water: a quantum mechanical and AFM study J Am Chem Soc 126, 9033–9041 10 Walther KA, Brujic J, Li H & Fernandez JM (2006) Sub-angstrom conformational changes of a single molecule captured by AFM variance analysis Biophys J 90, 3806–3812 11 Sarkar A, Caamano S & Fernandez JM (2005) The elasticity of individual titin PEVK exons measured by single molecule atomic force microscopy J Biol Chem 280, 6261–6264 12 Li H & Fernandez JM (2003) Mechanical design of the first proximal Ig domain of human cardiac titin revealed by single molecule force spectroscopy J Mol Biol 334, 75–86 13 Lele TP, Sero JE, Matthews BD, Kumar S, Xia S, Montoya-Zavala M, Polte T, Overby D, Wang N & Ingber DE (2007) Tools to study cell mechanics and mechanotransduction Cell Mechanics 83, 443–472 14 Matthews BD, Thodeti CK & Ingber DE (2007) Activation of mechanosensitive ion channels by forces transmitted through integrins and the cytoskeleton Mechanosensitive Ion Channels A 58, 59–85 15 Discher DE, Boal DH & Boey SK (1998) Simulations of the erythrocyte cytoskeleton at large deformation II Micropipette aspiration Biophys J 75, 1584–1597 16 Boey SK, Boal DH & Discher DE (1998) Simulations of the erythrocyte cytoskeleton at large deformation I Microscopic models Biophys J 75, 1573–1583 17 Discher DE, Mohandes N & Evans EA (1994) Molecular maps of red cell deformation: hidden elasticity and in situ connectivity Science 266, 1032–1036 18 Hudspeth AJ, Choe Y, Mehta AD & Martin P (2000) Putting ion channels to work: mechanoelectrical transduction, adaptation, and amplification by hair cells Proc Natl Acad Sci USA 97, 11765–11772 19 Gillespie PG & Walker RG (2001) Molecular basis of mechanosensory transduction Nature 413, 194–202 20 Acher R (2002) Water homeostasis in the living: molecular organization, osmoregulatory reflexes and evolution Ann D Endocrinol 63, 197–218 21 Pajerowski JD, Dahl KN, Zhong FL, Sammak PJ & Discher DE (2007) Physical plasticity of the nucleus in 3086 22 23 24 25 26 27 28 29 30 31 32 33 34 35 stem cell differentiation Proc Natl Acad Sci USA 104, 15619–15624 Rief M, Clausen-Schaumann H & Gaub HE (1999) Sequence-dependent mechanics of single DNA molecules Nat Struct Biol 6, 346–349 Clausen-Schaumann H, Rief M, Tolksdorf C & Gaub HE (2000) Mechanical stability of single DNA molecules Biophys J 78, 1997–2007 Inai T, Mancuso MR, McDonald DM, Kobayashi J, Nakamura K & Shibata Y (2004) Shear stress-induced upregulation of connexin 43 expression in endothelial cells on upstream surfaces of rat cardiac valves Histochem Cell Biol 122, 477–483 Papadaki M & Eskin SG (1997) Effects of fluid shear stress on gene regulation of vascular cells Biotechnol Prog 13, 209–221 Garcia-Perez AI, Lopez-Beltran EA, Kluner P, Luque J, Ballesteros P & Cerdan S (1999) Molecular crowding and viscosity as determinants of translational diffusion of metabolites in subcellular organelles Arch Biochem Biophys 362, 329–338 Erickson MG, Alseikhan BA, Peterson BZ & Yue DT (2001) Preassociation of calmodulin with voltage-gated Ca(2+) channels revealed by FRET in single living cells Neuron 31, 973–985 Tolar P, Sohn HW & Pierce SK (2005) The initiation of antigen-induced B cell antigen receptor signaling viewed in living cells by fluorescence resonance energy transfer Nat Immunol 6, 1168–1176 Joo C, McKinney SA, Nakamura M, Rasnik I, Myong S & Ha T (2006) Real-time observation of RecA filament dynamics with single monomer resolution Cell 126, 515–527 Qiao W, Mooney M, Bird AJ, Winge DR & Eide DJ (2006) Zinc binding to a regulatory zinc-sensing domain monitored in vivo by using FRET Proc Natl Acad Sci USA 103, 8674–8679 Ha T, Rasnik I, Cheng W, Babcock HP, Gauss GH, Lohman TM & Chu S (2002) Initiation and re-initiation of DNA unwinding by the Escherichia coli Rep helicase Nature 419, 638–641 Chen C, Brock R, Luh F, Chou PJ, Larrick JW, Huang RF & Huang TH (1995) The solution structure of the active domain of CAP18 – a lipopolysaccharide binding protein from rabbit leukocytes FEBS Lett 370, 46–52 Forster T (1949) Experimentelle und theoretische Ună tersuchung des zwischenmolekularen Ubergangs von Elektronenanregungsenergie Z Naturforsch A 4, 321– 327 Patterson GH, Piston DW & Barisas BG (2000) Forster distances between green fluorescent protein pairs Anal Biochem 284, 438–440 Courtenay ES, Capp MW, Saecker RM & Record MT Jr (2000) Thermodynamic analysis of interactions between denaturants and protein surface exposed on FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works F Meng et al 36 37 38 39 40 41 42 unfolding: interpretation of urea and guanidinium chloride m-values and their correlation with changes in accessible surface area (ASA) using preferential interaction coefficients and the local-bulk domain model Proteins (Suppl 4), 72–85 Tezuka-Kawakami T, Gell C, Brockwell DJ, Radford SE & Smith DA (2006) Urea-induced unfolding of the immunity protein Im9 monitored by spFRET Biophys J 91, L42–L44 Christophe D, Christophe-Hobertus C & Pichon B (2000) Nuclear targeting of proteins: how many different signals? Cell Signalling 12, 337–341 Vanbeek DB, Zwier MC, Shorb JM & Krueger BP (2007) Fretting about FRET: correlation between {kappa} and R Biophys J 92, 4168–4178 Scholtz JM, Barrick D, York EJ, Stewart JM & Baldwin RL (1995) Urea unfolding of peptide helices as a model for interpreting protein unfolding Proc Natl Acad Sci USA 92, 185–189 Schellman JA (1987) Selective binding and solvent denaturation Biopolymers 26, 549–559 Schellman JA (1990) A simple model for solvation in mixed solvents Applications to the stabilization and destabilization of macromolecular structures Biophys Chem 37, 121–140 Sherwood MW, Prior IA, Voronina SG, Barrow SL, Woodsmith JD, Gerasimenko OV, Petersen OH & Tepikin AV (2007) Activation of trypsinogen in large endocytic vacuoles of pancreatic acinar cells Proc Natl Acad Sci USA 104, 5674–5679 Mechanical stress sensor 43 Xia Z & Liu Y (2001) Reliable and global measurement of fluorescence resonance energy transfer using fluorescence microscopes Biophys J 81, 2395–2402 44 Schwaiger I, Sattler C, Hostetter DR & Rief M (2002) The myosin coiled-coil is a truly elastic protein structure Nat Materials 1, 232–235 45 Rizzo MA, Springer GH, Granada B & Piston DW (2004) An improved cyan fluorescent protein variant useful for FRET Nat Biotechnol 22, 445–449 46 Youvan DC, Silva CM, Bylina EJ, Coleman WJ, Dilworth MR & Yang MM (1997) Calibration of fluorescence resonance energy transfer in microscopy using genetically engineered GFP derivatives on nickel chelating beads Biotechnol Alia 3, 1–18 47 Gordon GW, Berry G, Liang XH, Levine B & Herman B (1998) Quantitative fluorescence resonance energy transfer measurements using fluorescence microscopy Biophys J 74, 2702–2713 48 Yudushkin IA, Schleifenbaum A, Kinkhabwala A, Neel BG, Schultz C & Bastiaens PI (2007) Live-cell imaging of enzyme–substrate interaction reveals spatial regulation of PTP1B Science (NY) 315, 115–119 49 Dale RE, Eisinger J & Blumberg WE (1979) The orientational freedom of molecular probes The orientation factor in intramolecular energy transfer Biophys J 26, 161–193 50 Forster VT (1948) Zwischenmolekulare energiewanderung und fluoreszenz Ann Phys 6, 54–75 FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS No claim to original US government works 3087 ... 5¢-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3¢; 2.5I sense primer, 5¢-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3¢; 2.5I antisense primer, 5¢-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA... claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3¢, was synthesized by Operon (Huntsville, Alabama, USA) and... CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ATTTTCTTTTCTTTAATCTTGTTTC-3¢; FT1AA sense primer, 5¢-GATTAAAGAAAAGCTTAAAATTGGTCA GAAAATCC-3¢; FT1AA antisense primer, 5¢-GGA TTTTCTGACCAATTTTAAGCTTTTCTTTAATC-3¢;