SO SÁNH SỰ ĐA DẠNG DI TRUYỀN CỦA TÔM CÀNG XANH VIỆT NAM VÀ TRUNG QUỐC doc

8 359 2
  • Loading ...
1/8 trang

Thông tin tài liệu

Ngày đăng: 25/03/2014, 08:20

TẠP CHÍ KHOA HỌC, Đại học Huế, Tập 75A, Số 6, (2012), 135-142 135 SO SÁNH SỰ ĐA DẠNG DI TRUYỀN CỦA TÔM CÀNG XANH VIỆT NAM TRUNG QUỐC Nguyễn Thành Tâm1, Phạm Thanh Liêm2 1Khoa Sinh học ứng dụng, Trường Đại học Tây Đô 2Khoa Thủy sản, Trường Đại học Cần Thơ Tóm tắt. Trong những năm qua, sản lượng tôm càng xanh nuôi ngày càng giảm. Thêm vào đó, những năm gần đây tôm càng xanh Trung Quốc được nhập vào Việt Nam ngày càng nhiều. Để đánh giá sự khác biệt di truyền giữa hai quần đàn tôm càng xanh Việt Nam Trung Quốc làm cơ sở cho việc quản lý, bảo tồn nguồn gen tôm càng xanh tại Việt Nam. Nghiên cứu này đã so sánh sự đa dạng di truyền giữa tôm càng xanh Việt Nam tôm càng xanh Trung Quốc. Sử dụng phương pháp Microsatellite RAPD để kiểm tra sự khác biệt di truyền của hai quần đàn tôm càng xanh Việt Nam Trung Quốc cùng với 6 cặp mồi Microsatellite 5 mồi ngẫu nhiên RAPD. Kết quả cho thấy chỉ có 1 vệt băng cho tất cả 6 mồi Microsatellite giữa tôm càng xanh Việt Nam Trung Quốc. Tuy nhiên, khi phân tích RAPD cho thấy có sự khác biệt di truyền giữa 2 quần đàn tôm. Trung bình là 14,9 alen (TCXTQ) 12,9 alen (TCXVN). Trung bình dị hợp tử, giá trị đa dạng di truyền PIC lần lượt là 0,156; 0,84 – 0,88 (TCXTQ) 0,179; 0,86 – 0,88 (TCXVN), chỉ số Shanmon là 0,242 (TCXTQ), 0,279 (TCXVN). Tôm càng xanh Trung Quốc trong nghiên cứu này có thể là loài Macrobrachium rosenbergii đã trải qua quá trình thuần dưỡng lâu dài. 1. Đặt vấn đề Tôm càng xanh (Macrobrachium rosenbergii) là loài có kích thước lớn nhất trong các loài tôm nước ngọt, là một trong những loài nuôi có giá trị kinh tế quan trọng trong ngành thủy sản thế giới nói chung, Việt Nam Trung Quốc nói riêng. Hầu hết những nghiên cứu về tôm càng xanh chủ yếu nhằm mục đích giải quyết những khó khăn về tôm bố mẹ, nuôi trồng, sản xuất giống nhân tạo để phát triển hơn nữa về loài tôm này. Mặc dù những thông tin di truyền về tôm càng xanh rất là quan trọng để nâng cao chất lượng tôm trong ương nuôi sản xuất giống cũng như trong công tác phân loại các loài tôm nước ngọt trên thế giới, nhưng những thông tin này còn rất hạn chế. Xuất phát từ những vấn đề nêu trên kết hợp với những yêu cầu rất cần thiết trong việc đánh giá sự đa dạng di truyền giữa các quần đàn tôm càng xanh Việt Nam Trung Quốc. Trên cơ sở nghiên cứu về mặt di truyền học cho phép đề tài so sánh sự đa dạng di truyền của tôm càng xanh Việt Nam Trung Quốc được thực hiện. 136 So sánh sự đa dạng di truyền của tôm càng xanh… 2. Vật liệu phương pháp nghiên cứu 2.1. Đối tượng nghiên cứu Tôm càng xanh Việt Nam (thu từ các ghe đánh bắt trên sông) tôm càng xanh Trung Quốc (thu từ cơ sở nhập tôm giống từ Trung Quốc sang Việt Nam). 2.2. Phương pháp nghiên cứu Thu mẫu phân tích Thu 30 cá thể tôm càng xanh trong một quần đàn. Mẫu thu có trọng lượng 20 – 50 g/mẫu. Tiến hành thu phân tích mẫu tôm càng xanh trong cùng ngày. Phân tích hình thái học Theo phương pháp mô tả các chỉ tiêu hình thái học giáp xác của Trương Quốc Phú Nguyễn Văn Thường (2009). Phân tích di truyền - Tách chiết ADN ADN của 60 mẫu tôm càng xanh Việt Nam Trung Quốc được ly trích dựa trên phương pháp ly trích ADN bằng Phenol – Chloroform theo mô tả của Taggart et al. (1992) đã được chuẩn hóa nhằm thu được ADN tổng số có chất lượng phù hợp với yêu cầu phân tích của phương pháp. - Phân tích Microsatellite Phản ứng PCR được thực hiện trong 15 μl hỗn hợp: 10 ng ADN khuôn; 0,3 μM mồi xuôi mồi ngược (sử dụng 6 cặp mồi xuôi mồi ngược cho phân tích Microsatellite Mbr-1 “F: CCACCA TCAATTCTCACTTACC, R: CCTTTTCACATCGTTTCCAGTC; Mbr-2 “F: TTCCCGACCAATTTCTCTTTCTC, R:GGCAAAAATGATCTTGGATTCAC; Mbr-5 “F:CAAGGCTCGTGTCTCTTGTTTC, R:GCTTGTACTTGTTC AGCTTTTGC; Mbr-7 “F: TAAAAGAGTCGCCAAATGAGCA, R: TTGGGAATTGTTGACCTCCAAG; Mbr-8 “F: AACCAGCCGACTTAGACTGTGC, R: CGCCATTTGCGTCTATCTCTTAC Mbr-10 “F: TGACGATGA TGAGGAATGAAGC, R: TTCAGGCTATATCAAGCAACAG ); 0,2 mM mỗi dNDP; 2 mM MgCl2; 50 mM KCl, 10 mM Tris–HCl (pH 9,0); 0,1% Triton X-100 1 đơn vị Taq ADN polymerase (Promega). Các công đoạn trong PCR: đầu tiên là làm biến tính ADN ở 94 oC trong 3 phút, sau 35 chu kỳ ở 94 oC trong 30 giây, sau 45 giây ở nhiệt độ 60 oC (gắn mồi), 72 oC ổn định trong 1 phút (giai đoạn kéo dài), sau 1 chu kỳ ở 72 oC trong 7 phút (giai đoạn kéo dài cuối cùng). - Phân tích RAPD Phản ứng PCR được thực hiện trong 10 μl hỗn hợp: 10 ng ADN khuôn; 50 pM cho mỗi mồi (sử dụng 5 mồi ngẫu nhiên: G03 “CAG GCC CTT C”, G05 “AGT CAG CCA C”, G06 “AGT CAG CCA C; G011 “AAT CGG GCT G G012 “GTG ATC NGUYỄN THÀNH TÂM, PHẠM THANH LIÊM 137 GCA G); 0,5 mM mỗi dATP, dTTP, dCTP, dGTP; 2,5 mM MgCl2; 1X PCR buffer, 1,5 đơn vị Taq ADN polymerase (Promega) nước cất tiệt trùng. Các công đoạn trong phản ứng khuếch đại ADN trong phản ứng PCR: đầu tiên là làm biến tính ADN ở 96 oC trong 3 phút, sau 40 chu kỳ ở 96 oC trong 10 giây, nhiệt độ độ gắn mồi 42 oC trong 10 giây, 72 oC ổn định trong 30 giây (giai đoạn kéo dài), sau 1 chu kỳ ở 72 oC trong 5 phút (giai đoạn kéo dài cuối cùng). Phân tích xử lý số liệu - Phương pháp phân tích kết quả Microsatellite Sự khác biệt di truyền giữa hai quần đàn tôm bao gồm: tần suất xuất hiện alen, số trung bình alen trên mỗi locus, trung bình dị hợp tử được xác định dựa trên phần mềm Microsoft excel 2003. - Phương pháp phân tích kết quả RAPD Số liệu thu được sẽ được tổng hợp phân tích trên phần mềm Microsoft excel GenAlex 6.3 để xác định khoảng cách di truyền, trung bình dị hợp tử, alen đơn hình hay đa hình, giá trị đa dạng di truyền PIC, khoảng cách di truyền, chỉ số Shanmon sự phân tích tọa độ Principal coordinate Analysis (PCA). 3. Kết quả nghiên cứu thảo luận 3.1. Hình thái học Kết quả phân tích các chỉ tiêu hình thái về màu sắc, các phụ bộ của TCX Việt Nam Trung Quốc được thể hiện qua thông qua màu sắc, số chân ngực, chân bụng, vỏ giáp, cấu trúc chân ngực 2 đều không có sự khác biệt. Theo sự mô tả hình thái học loài Macrobrachium rosenbergii của Daisy Wowor (2007) cho thấy kết quả nghiên cứu hình thái học TCX trong nghiên cứu này mang những đặc điểm hình thái học của loài Macrobrachium rosenbergii. Tỷ lệ chiều dài Carapace (LC) chiều dài thân (LB) tôm Bảng 1. Tỷ lệ chiều dài Carapace chiều dài thân TCX Việt Nam Trung Quốc Loài Tôm Số mẫu (con) Tỷ lệ chiều dài cơ thể/chiều dài thân Việt Nam 30 0,66 ± 0,05a Trung Quốc 30 0,65 ± 0,04a Ghi chú: Số liệu được trình bày dạng số trung bình ± độ lệch chuẩn. Những giá trị trong cùng một cột mang những chữ cái giống nhau thì khác biệt không có ý nghĩa thống kê (p>0,05). Từ kết quả Bảng 1 cho thấy, tỷ lệ chiều dài Carapace chiều dài thân trung bình giữa hai nhóm TCX Việt Nam Trung Quốc không có sự khác biệt có ý nghĩa 138 So sánh sự đa dạng di truyền của tôm càng xanh… thống kê với mức ý nghĩa 95%. Số răng chủy TCX Trong quá trình phân tích mẫu cho thấy có một sự khác biệt duy nhất về số gai trên dưới chủy của TCX. Sự khác biệt này được thể hiện qua Bảng 2. Bảng 2. Số răng trên dưới chủy của TCX Việt Nam Trung Quốc Ghi chú: Số liệu được trình bày dạng số trung bình±độ lệch chuẩn. Những giá trị trong cùng một cột mang những chữ cái giống nhau thì khác biệt không có ý nghĩa thống kê (p>0,05). Qua Bảng 2 cho thấy, số gai trên chủy của hai quần đàn TCX Việt Nam Trung Quốc khác biệt không có ý nghĩa thống kê (p>0,05). Tuy nhiên, số gai dưới chủy của quần đàn TCX Việt Nam khác biệt có ý nghĩa thống kê (p<0,05) so với số gai dưới chủy của quần đàn TCX Trung Quốc. Qua đây cho thấy loài TCX Việt Nam trong nghiên này thuộc loài Macrobrachium rosenbergii. Còn loài TCX Trung Quốc trong nghiên cứu này có số gai trên chủy bằng với số gai trên chủy của loài Macrobrachium mirabile (Nguyễn Văn Thường Trương Quốc Phú, 2009). Tuy nhiên, số gai dưới chủy của TCX Trung Quốc trong nghiên cứu này không phù hợp với số gai dưới chủy của loài tôm nào. 3.2. Phân tích Microsatellite Hình 1. Điện di ADN ly trích trên gel agarose 1,8% với mồi Mbr-8 Chú thích: M-Thang ADN 1 kp, 1: Đối chứng âm, 2-8: TCXVN, 9-16 Từ kết quả điện di cho thấy việc sử dụng các cặp mồi theo đề nghị của Charoentawee et al. (2006) để khuếch đại ADN TCX Việt Nam Trung Quốc đã cho thấy TCXVN TCXTQ có cùng sự xuất hiện 1 vệt băng trên tất cả 6 mồi Microsatellite. Kết quả này phù hợp với kết quả nghiên cứu của Kancee Chareontawee et al. (2007) đã tiến hành miêu tả đặc điểm di truyền của loài Macrobrachium Loài tôm càng xanh Số mẫu (con) Số răng trên chủy Số răng dưới chủy Trung Quốc 30 13,5 ± 1,33a 11,20 ± 0,85a Việt Nam 30 13,8 ± 1,58a 12,67 ± 1,79b M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1 kb 500 bp 100 bp 734 bp NGUYỄN THÀNH TÂM, PHẠM THANH LIÊM 139 rosenbergii được thu tại các trại giống ở những vùng khác nhau của Thái Lan bằng phương pháp Microsatellite, kết quả cũng cho thấy các vệt băng ADN của những mẫu Macrobrachium rosenbergii không có sự khác biệt có ý nghĩa thống kê (p >0,05) kích thước các vệt băng nằm trong khoảng 210 – 945 bp. Từ đây cho thấy loài TCXVN và TCXTQ trong nghiên cứu này có thể cùng là loài Macrobrachium rosenbergii chứ không phải hai loài khác nhau. 3.3. Phân tích RAPD Khoảng cách di truyền Bảng 3. Khoảng cách di truyền (Nei, 1972) giữa hai loài TCX Việt Nam Trung Quốc Loài tôm Trung Quốc Việt Nam Trung Quốc 0,000 0,391 Qua kết quả Bảng 3 cho thấy khoảng cách di truyền giữa TCXVN TCXTQ là tương đối lớn (0,319). Điều này cho thấy, TCXTQ TCXVN có sự khác biệt di truyền cao hơn nhiều so với sự khác biệt di truyền giữa Macrobrachium rosenbergii ngoài tự nhiên trong các trại giống. Bảng 4. Các thông số di truyền của TCXVN TCXTQ Loài tôm Trung bình dị hợp tử Chỉ số Shanmon Trung Quốc 0,156 0,242 Việt Nam 0,179 0,279 Chỉ số đa dạng Shanmon của 2 nhóm tôm lần lượt là 0,242 (TCXTQ) 0,279 (TCXVN). Tương tự như tỷ lệ dị hợp tử, sự khác biệt về chỉ số Shanmon cho thấy có sự khác biệt di truyền tồn tại giữa 2 nhóm TCX Việt Nam Trung Quốc. TCX Việt Nam có chỉ số Shanmon cao hơn TCX Trung Quốc nên tính đa dạng về mặt di truyền ở quần thể TCX Trung Quốc sẽ thấp hơn so với quần thể TCX Việt Nam (Bảng 4). Số phân đoạn tần suất xuất hiện các phân đoạn Bảng 5. Tính đa hình về phân đoạn ADN TCXTQ được nhân bản trên 5 mồi ngẫu nhiên Mồi Số phân đoạn ADN Số phân đoạn đa hình Số phân đoạn đơn hình Tỷ lệ phân đoạn đa hình (%) G03 10 8 2 80 G05 11 8 3 72,7 G06 11 10 1 90,9 140 So sánh sự đa dạng di truyền của tôm càng xanh… G11 11 9 2 81,8 G12 10 8 2 80 Tổng 53 43 10 81,1 Kết quả tổng hợp trên Bảng 4 Bảng 6 cho thấy tổng số phân đoạn ADN của 30 mẫu TCXVN 30 mẫu TCXTQ phân tích trên 5 mồi ngẫu nhiên lần lượt là 53 (TCXTQ) 53 (TCXVN) phân đoạn, trong đó có 43 (TCXTQ) 46 (TCXVN). Kích thước các phân đoạn ADN được nhân bản trong khoảng từ 64 – 3.204 bp đối với cả 2 nhóm TCX Việt Nam Trung Quốc. Số lượng các phân đoạn tương ứng với mỗi mồi nằm trong khoảng 10 – 11 (TCXTQ TCXVN). Bảng 6. Tính đa hình về phân đoạn ADN TCXVN được nhân bản trên 5 mồi ngẫu nhiên Mồi Tổng số phân đoạn ADN Tổng số phân đoạn đa hình Tổng số phân đoạn đơn hình Tỷ lệ phân đoạn đa hình (%) G03 11 10 1 90,9 G05 11 10 1 90,9 G06 10 8 2 80 G11 10 8 2 80 G12 11 10 1 90,9 Tổng 53 46 7 86,8 Giá trị PIC được sử dụng khi phân tích thông tin đa hình. Số liệu Bảng 7 phù hợp với tỷ lệ đa hình của các phân đoạn ADN được nhân bản ở Bảng 5 Bảng 6. Giá trị PIC của mồi G03, G05 G12 ở TCXTQ thấp hơn TCXVN, riêng giá trị PIC của mồi G06 G11 ở TCXTQ cao hơn TCXVN. Tất cả các mồi đều cho tính đa hình cao (PIC >0,8). Điều này cho thấy mức độ đa dạng về phân đoạn ADN rất cao ở cả 2 nhóm TCX nghiên cứu. Bảng 7. Thông tin tính đa hình (PIC) của 60 mẫu TCXVN TCXTQ Mồi PIC TCXTQ TCXVN G03 0,85 0,87 G05 0,86 0,88 G06 0,88 0,86 G11 0,87 0,86 G12 0,84 0,86 NGUYỄN THÀNH TÂM, PHẠM THANH LIÊM 141 - Sự phân tích tọa độ thiết yếu (PCA) Thông qua PCA có thể quan sát được sự phân bố của những quần thể (Beaumont và Hoare, 2003). Mối quan hệ giữa hai quần đàn TCX Việt Nam Trung Quốc được thể hiện qua Hình 2. Tọa độ thứ 1 (65,11% )Tọa độ thứ 2 (9,73%)TQVN Hình 2. đồ tọa độ phân tích mối quan hệ giữa TCX VN TQ Qua Hình 2 cho thấy, thông qua tọa độ thứ 1 có sự khác biệt di truyền giữa hai quần đàn TCX VN TQ. Theo Dasy Wowor (2007) khi phân tích PCA giữa các quần đàn Macrobrachium rosenbergii ngoài tự nhiên trong trại giống tại Indonesia cho thấy tọa độ thứ nhất chiếm 28,89%. 4. Kết luận Qua phân tích Microsatellite cho thấy TCXVN TCXTQ cùng là loài Macrobrachium rosenbergii. Giữa TCX Việt Nam TCX Trung Quốcsự khác biệt di truyền thông qua các chỉ số đa dạng di truyền như tỷ lệ đa hình, tính dị hợp tử, chỉ số Shanmon, khoảng cách di truyền phân tích tọa độ PCA. Tôm càng xanh Trung Quốc là loài Macrobrachium rosenbergii có thể được thuần hóa trong thời gian lâu dài. TÀI LIỆU THAM KHẢO [1]. Kancee Chareontawee, Poompuang S, Na-Nakorn U, Kamonrat W, Genetic diversity of hatchery stocks of giant freshwater prawn (Macrobrachium rosenbergii) in Thailand. A. Center for Agricultural Biotechnology, Kasetsart University, Nakorn Pathom 73140, Thailand, B. Department of Aquaculture, Faculty of Fisheries, Kasetsart University, Bangkok 10900, Thailand, C Department of Fisheries, Ministry of Agriculture and Cooperatives, Bangkok 10900, Thailand, 2007. [2]. Nei, M., Genetic distance between populations, American. Naturalist 106: (1972), 283-292. [3]. Taggart, J.B., Hynes, R.A., Prodohl, P.A., Ferguson, A., Asimplified protocol of routine total DNA isolation from salmonid fishes, J. Fish Biol. 40, (1992), 963–965. [4]. Trương Quốc Phú Nguyễn Văn Thường, Ngư loại II, Khoa Thủy sản – Trường Đại 142 So sánh sự đa dạng di truyền của tôm càng xanh… học Cần Thơ, 2009. [5]. Wowor, D. & P. K. L. Ng, The giant freshwater prawns of the Macrobrachium rosenbergii species group (Crustacea: Decapoda: Caridea: Palaemonidae), The Raffles Bulletin of Zoology 55(2): (2007), 321-336. [6]. Charoentawee, K.; Poompuang, S.; Na-Nakorn, U., Isolation and characterization of microsatellites in giant freshwater prawn Macrobrachium rosenbergii, Molecular Ecology Notes. v. 6, n. 3, (2006), 823-825. [7]. Beaumont A.R. and K. Hoare, Biotechnology and genetics of fisheries and aquaculture, Blackwell sciences, School of Ocean Science. University of Wales, Bangor, UK, 2003. COMPARING THE GENETIC DIVERSITY OF GIANT FRESHWATER PRAWN IN VIETNAM AND CHINA Nguyen Thanh Tam1, Pham Thanh Liem2 1Faculty of Applied Biology, Tay Do University 2College of Aquaculture and Fisheries, Can Tho University Abstract. The culture of giant freshwater prawn in Mekong Delta has experienced low productivity despite rapid expansion during the past several years. In recent years, Chinese giant freshwater prawn has been imported more and more into Vietnam. This paper aims to evaluate the genetic difference of giant freshwater prawn in Vietnam and China for the purpose of farming management of M. rosenbergii and native gene conservation of M. rosenbergii. Microsatellitte and Random amplified polymorphic DNA method was used to study the genetic diversity and to test the polymorphism among the two pupulations of giant freshwater prawn in Vietnam and China. Six microsatellite DNA loci and five Random amplified polymorphic DNA primers were used to assess the genetic diversity of two populations of freshwater prawn in Vietnam and China. The results showed that, for both populations only one band appears for every primer (by microsatelltite method). Both Vietnam and China populations exhibited relatively high genetic variation and were similar with an average of 14,9 (Chinese Giant freshwater prawn) to 12,9 alleles per locus and average expected heterozygosity at all loci of 0,156 (Chinese giant freshwater prawn) to 0,179, PIC value from 0,84 to 0,88 (Chinese giant freshwater prawn) and 0,86 to 0,88 (Vietnam giant freshwater prawn) and Shanmon’s index being 0,242 (Chinese giant freshwater prawn), 0,279 (Vietnam giant freshwater prawn). Thus, the Chinese giant freshwater prawn can be the Macrobrachium rosenbergii species that has been domesticated for a long time. Keywords: Macrobrachium rosenbergii, Genectic diversity, Microsatellite, Random amplified polymorphic DNA. . càng xanh Việt Nam và Trung Quốc và làm cơ sở cho việc quản lý, bảo tồn nguồn gen tôm càng xanh tại Việt Nam. Nghiên cứu này đã so sánh sự đa dạng di truyền giữa tôm càng xanh Việt Nam và tôm càng. giá sự đa dạng di truyền giữa các quần đàn tôm càng xanh Việt Nam và Trung Quốc. Trên cơ sở nghiên cứu về mặt di truyền học cho phép đề tài so sánh sự đa dạng di truyền của tôm càng xanh Việt. xanh Việt Nam và Trung Quốc được thực hiện. 136 So sánh sự đa dạng di truyền của tôm càng xanh 2. Vật liệu và phương pháp nghiên cứu 2.1. Đối tượng nghiên cứu Tôm càng xanh Việt Nam (thu
- Xem thêm -

Xem thêm: SO SÁNH SỰ ĐA DẠNG DI TRUYỀN CỦA TÔM CÀNG XANH VIỆT NAM VÀ TRUNG QUỐC doc, SO SÁNH SỰ ĐA DẠNG DI TRUYỀN CỦA TÔM CÀNG XANH VIỆT NAM VÀ TRUNG QUỐC doc, SO SÁNH SỰ ĐA DẠNG DI TRUYỀN CỦA TÔM CÀNG XANH VIỆT NAM VÀ TRUNG QUỐC doc

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn