Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae Agathe Urvoas 1 , Mireille Moutiez 1 , Cle ´ ment Estienne 1 , Joe¨ l Couprie 1 , Elisabeth Mintz 2 and Loı¨c Le Clainche 1 1 De ´ partement d’Inge ´ nierie et d’Etudes des Prote ´ ines, Direction des Sciences du Vivant, CEA Saclay, Gif sur Yvette, France; 2 Laboratoire de Biophysique Mole ´ culaire et Cellulaire, UMR 5090, CFA-CNRS, Universite Joseph Fourier, Direction des Sciences du Vivant, CEA Grenoble, France We studied the interaction of several metal ions with the copper chaperone from Enterococcus hirae (EhCopZ). We show that the stoichiometry of the protein–metal complex varies with the experimental conditions used. At high con- centration of the protein in a noncoordinating buffer, a dimer, (EhCopZ) 2 –metal, was formed. The presence of a potentially coordinating molecule L in the solution leads to the formation of a monomeric ternary complex, EhCopZ– Cu–L, where L can be a buffer or a coordinating mole- cule (glutathione, tris(2-carboxyethyl)phosphine). This was demonstrated in the presence of glutathione by electrospray ionization MS. The presence of a tyrosine close to the metal- binding site allowed us to follow the binding of cadmium to EhCopZ by fluorescence spectroscopy and to determine the corresponding dissociation constant (K d ¼ 30 n M ). Com- petition experiments were performed with mercury, copper and cobalt, and the corresponding dissociation constants were calculated. A high preference for copper was found, with an upper limit for the dissociation constant of 10 )12 M . These results confirm the capacity of EhCopZ to bind cop- per at very low concentrations in living cells and may provide new clues in the determination of the mechanism of the uptake and transport of copper by the chaperone EhCopZ. Keywords: copper transport; CopZ; metal binding; metal- lochaperone; selectivity. Copper is a first-row transition metal, which plays a fundamental role in living organisms. Although it is involved in the catalytic active site of several enzymes [1], its redox properties can also generate highly toxic hydroxy radicals in cells [2]. Therefore, its intracellular concentration has to be tightly regulated. Copper chaperones have recently been reported to be key proteins in the uptake and transport of copper in cells, and in the transfer of the metal ion to appropriate partners [3–5]. Many recent studies have provided data on their biological function, and an increas- ing number of 3D structures have been resolved for many members of this family both in the apo and metal- loaded state (vide infra). In this study, we focused on the protein CopZ, which has been reported to be involved in copper homoeostasis in Enterococcus hirae (hereafter referred to as EhCopZ) [6,7]. It belongs to the cop operon, which also encodes two copper ATPases, CopA and CopB, and a repressor CopY. EhCopZ has been shown to transfer two copper ions to CopY [8,9], thereby controlling the expression of the cop operon. The 3D NMR structure of apo EhCopZ has been resolved [10]. EhCopZ exhibits a ferredoxin-like fold (babbab) in which the four b-strands and the two a-helices are connected by loop regions exposed to the solvent. The metal-binding site is located at the C-terminal extremity of the first loop and on the first turn of helix a1 (Fig. 1). Its sequence is highly conserved in the family and consists of a consensus motif MXCXXC. The binding of the metal ion is mainly accomplished via the two sulfur atoms of the side chain of the two cysteine residues Cys11 and Cys14. Surprisingly, various stoichiometries have been reported so far for metal–chaperone complexes (Table 1). Monomeric compounds have been found in the case of BsCopZ–Cu (CopZ from Bacillus subtilis) [11] and with the homologous proteins MerP–Hg [12], Atx1–Cu [13] and Atx1–Hg [14], whereas dimers have been reported in the case of EhCopZ–Cu [10] and BsCopZ–Cu [15,16] and with the homologous protein HAH1 loaded with Cu, Cd or Hg [17]. Therefore, it would be interesting to determine the stoichiometry in solution of copper-loaded EhCopZ as it may offer a molecular basis for the copper-transfer mechanism from the copper chaperone to the target protein. Another relevant question is the selectivity of these metallochaperones for different metals. As it is well known that the MXCXXC motif can bind various metals [18], the determinants of the selectivity of these proteins for a specific ion remain poorly understood. For example, in vitro studies have shown that MNKr2, a copper-binding subdomain of the Menkes ATPase, is able to bind Ag(I) or Cu(I) but Correspondence to L. Le Clainche, De ´ partement d’Inge ´ nierie et d’Etudes des Prote ´ ines, Direction des Sciences du Vivant, CEA Saclay, 91191 Gif sur Yvette Cedex, France. Fax: + 33 0169089071, Tel.: + 33 0169084215, E-mail: leclainche@dsvidf.cea.fr Abbreviations: EhCopZ, copper chaperone from Enterococcus hirae; BsCopZ, copper chaperone from Bacillus subtilis;TCEP, Tris(2-carboxyethyl)phosphine. (Received 27 November 2003, revised 15 January 2004, accepted 19 January 2004) Eur. J. Biochem. 271, 993–1003 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04001.x cannot bind a larger ion such as Cd(II), as is the case for the protein HAH1 [19–21]. However, the metal-binding affinit- ies of any copper chaperone for metal ions have not been reported so far. Therefore, a study of the strength of interaction of EhCopZ with different metals and a com- parison with other proteins could provide a better under- standing of this selectivity. Here we describe a study of the binding of several metal ions to the protein EhCopZ. The stoichiometry of the metal- loaded chaperone was found to depend on the experimental conditions used, especially the concentration of the protein and the presence of an exogenous coordinating molecule. The dissociation constants for cadmium, mercury and cobalt were determined using fluorescence spectroscopy, and the upper limit of the dissociation constant for copper was also determined. Materials and methods Primer design for the synthetic gene Ehcopz Oligonucleotides (60-mer) were designed from the sequence of the gene Ehcopz (E. hirae copZ) with optimized codons for Escherichia coli; they were synthesized and purified by MWG-Biotech. The six oligonucleotides used for the syn- thetic gene construction were: copz-p1, (5¢-GGGCCGGC GGCCATGGCTAAACAGGAATTCTCGGTTAAAGG TATGTCTTGCAAC-3¢); copz-ap2, (5¢-GATACGACC AACAGCTTCTTCGATACGAGCAACGCAGTGGT TGCAAGACATACCTTTAAC-3¢); copz-p3, (5¢-GAA GCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTT AAAGTTCAGCTGAAGAAAGAAAAG-3¢); copz-ap4, (5¢-GGTAGCCTGAACGTTAGCTTCGTCGAATTTAA CAACAGCCTTTTCTTTCTTCAGCTGAAC-3¢); copz- p5, (5¢-GAAGCTAACGTTCAGGCTACCGAAATCTG CCAGGCTATCAACGAACTGGGTTACCAGGCT-3¢); copz-ap6, (5¢-GGGCCGGCGCGGTTAGATCTAAGCT TAGATAACTTCAGCCTGGTAACCCAGTTCGTT-3¢). Primers 1, 3 and 5 corresponded to the coding strand, respectively, for positions1–54, 76–135, 154–213. Primers 2, 4 and 6 corresponded to the complementary strand, respect- ively, for positions 34–93, 115–174, 193–220 of the coding strand. Each primer overlapped the following one by 27 bases. Restriction sites for NcoIandBglII were introduced, respectively, in the N-terminal primer copz-p1 and in the C-terminal primer copz-ap6. Fig. 1. 3D NMR structure of apo-EhCopZ (PDB ID: 1CPZ) and Cu(I)-loaded BsCopZ (PDB 10: 1K0V). apo-EhCopZ (right) BsCopZ (left). Hydrogens have been omitted for clarity, and only one of the multiple structures is represented for both proteins. Selected bond (A ˚ )andangles(°): S C13 –Cu 2.16, S C16 –Cu 2.17, S C13 –Cu–S C16 , 115.31. Table 1. Conditions used and observed stoichiometries for different metal–chaperone complexes. DTT, dithiothreitol, ICP-AES, inductively coupled plasma-atomic emission spectrometry. Protein [Protein] (l M ) Metal Buffer used Reducing agent Stoichiometry (metal:protein) Analytical method Reference EhCopZ 5, 10 Cu, Cd Mops No 0.5 Fluorescence, CD, UV This work EhCopZ 5, 10 Cu, Cd Mops TCEP 1 Fluorescence, CD, UV This work EhCopz 0.5 Cd, Cu, Co, Hg Mops No 1 Fluorescence This work EhCopZ 10 Cu Phosphate No 1 UV 9 BsCopZ 2000 Cu Phosphate DTT 0.77 ICP-AES 11 BsCopZ 300 Cu Mops No 0.5 Gel filtration 15 BsCopz 300 Cu Mops DTT 1 Gel filtration 15 MerP 1000 Hg Phosphate No 1 ICP-AES 12 yAtx1 2400 Cu, Hg Phosphate, Mes DTT removed 0.6–0.8 ICP-AES 25 yAtx1 100–400 Cu Tris/Mes phosphate No, DTT, GSH 1 ICP-AES 26 HAH1 500–1300 Cu, Cd, Hg Mes No 0.2–0.5 ICP-AES, X-Ray 17 994 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Construction of the synthetic gene Ehcopz and expression vector PQE- cop The six oligonucleotides were assembled in a first PCR step. The reaction was carried out in 25 lL, using 3 pmol of each oligonucleotide, 0.2 m M each dNTP, 1· Pfu buffer and 1.75 U Pfu turbo (Stratagene). The assembling PCR was performed in an MWG-Biotech Primus thermocycler with the following program: 94 °Cfor60 s;94 °Cfor45s,47°C for 30 s, 72 °C for 15 s (55 times); and 72 °C for 5 min. The assembled fragment was amplified by a second PCR step. The reaction was performed in 25 lL, using 7 pmol of the N-terminal and C-terminal oligonucleotides (1 and 6), 0.2 m M each dNTP, 1· Pfu buffer, 1.75 U Pfu turbo (Stratagene) and 1 lL of the previous PCR product. The PCR program was: 94 °C for 60 s; 94 °C for 45 s, 47 °Cfor 30 s, 72 °C for 35 s (30 times); and 72 °Cfor5min.After analysis of the PCR product on a 1.6% (w/v) agarose gel in a TAE buffer (40 m M Tris, 20 m M sodium acetate, 1 m M EDTA, pH 8.3), the 220-bp fragment of interest was digested with NcoIandBglII, purified using a Nucleospin extraction kit (Macherey Nagel) and ligated into PQE60 (Qiagen) digested with NcoIandBglII. The final construct PQE-cop was verified by DNA sequencing. E. coli XL1 blue (Stratagene) was used as the host strain for plasmid propagation. The expected molecular mass calculated by MassLynx from this sequence is thus 7592.9 Da. It is in good agreement with the experimental molecular mass found of 7592.3 ± 0.6 Da. It should be noted that the calculated mass of Eh-CopZ in the NCBI database (acces- sion No. 1361370) is 7521.8 Da. The 71-Da difference between this value and the experimental mass is due to the insertion of an N-terminal alanine during the primer design for the plasmid construction. Expression and purification of recombinant EhCopZ E. coli M15 (Qiagen) was used as the host strain for the expression of EhCopZ. The cells were grown at 37 °Cin Luria–Bertani medium containing 200 mgÆL )1 ampicillin and 25 mgÆL )1 kanamycin to an absorbance of 0.6 at 600 nm. Protein expression was induced by the addition of isopropyl b- D -thiogalactoside to a final concentration of 200 l M , and the cells were further incubated for 4 h. The cells were harvested, resuspended in 50 m M sodium phos- phate, pH 7.2, containing 5% glycerol, 2 m M EDTA, 5 m M dithiothreitol, and lysed by Eaton pressure cell. The cell extract was incubated for 1 h at 4 °Cwith1m M phenyl- methanesulfonyl fluoride, DNase I and RNase. After filtration on a 0.45-l M nitrocellulose membrane, it was loaded on to a 3 · 10 cm S15 Sepharose fast flow column (Pharmacia) equilibrated in buffer A (50 m M sodium phosphate, pH 7.2). EhCopZ was eluted with a linear gradient (0–1 M ) of NaCl in buffer A. The EhCopZ fractions were pooled and concentrated to less than 5 mL with an Amicon YM3 membrane, and stored at )20 °C after the addition of 2 m M dithiothreitol. The purity was checked by SDS/PAGE on 20% (w/v) polyacrylamide gels after silver staining. Gel filtration was performed to exchange the buffer before functional characterization of the protein. Protein and metal quantification for titration experiments Ameane 280 of 2000 M )1 Æcm )1 was determined by amino- acid quantification for EhCopZ in buffer C (20 m M Mops, 150 m M NaCl, pH 7.2) used for fluorescence experiments. Protein concentration was then measured using the UV absorbance at 280 nm for all titration experiments. All metal solutions were prepared in water except for Cu(I)Cl which was prepared as a 4 m M solution in acetonitrile or 0.1 M HCl/1 M NaCl [22]. Tris(2-carboxyethyl)phosphine (TCEP) was prepared in the buffer used for the titration. Metal titration by fluorescence Fluorescence measurements were performed with a Cary Eclipse spectrofluorimeter (Varian) in a thermostatically controlled cell holder, using a 1-cm-path-length quartz cell. All the experiments were carried out under argon. The spectra were recorded with a bandwidth of 5 nm for both excitation and emission beams at a scan rate of 250 nmÆ- min )1 . Intrinsic protein fluorescence measurements were recorded at 22 °C between 260 and 400 nm using an excitation wavelength of 278 nm. The protein was reduced in 5 m M dithiothreitol and desalted by gel filtration on Superdex 75 (Pharmacia) in buffer C (20 m M Mops, 150 m M NaCl, pH 7.2) or in the appropriate buffer for further functional characterization (NaHCO 3 ). The fluor- escence emission spectrum of EhCopZ exhibited a maxi- mum at 305 nm, which is consistent with its single tyrosine Tyr63. Typically 500 lLof5l M ,0.5l M or 50 n M EhCopZ in buffer C was titrated with additions of 0.5–1 lLCdCl 2 at the appropriate concentration. In some experiments, TCEP was added as a reducing agent. As no effect of CuCl, HgCl 2 or CoCl 2 was detected with direct fluorescence measure- ments, the titration of these metals was performed by competition in the presence of Cd. Equilibrium was established within 2 min of the addition of the metal. The data corresponding to the titration of EhCopZ with cadmium were fitted using either the binding isotherm or a Scatchard plot. In the first case, the isotherm corresponds to the equilibrium: CopZ + Cd « CopZ–Cd. At equilib- rium, the law of mass action gives: K d ¼ð½CopZ½CdÞ=½CopZÀ Cdð1Þ The fluorescence intensity of the protein can be written as: I ¼ I max ½CopZÀCd=½CopZ 0 ð2Þ where [CopZ] 0 is the initial protein concentration and I max is maximum intensity corresponding to 100% of the complex in solution. At equilibrium, the concentrations in solution can be expressed as: ½CopZ¼½CopZ 0 À½CopZÀCd; ½Cd¼½Cd i À½CopZÀCd ð3Þ where [Cd] i is the concentration of added cadmium in solution. Inserting Eqn (3) into Eqn (1) leads to the equation: Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 995 ½CopZÀCd 2 Àð½CopZ 0 þ½Cd i þ K d Þ½CopZÀCd þ½CopZ 0 ½Cd i ¼ 0 which can be combined with Eqn (2) to give: I ¼ð1=2½CopZ 0 ÞI max  ðð½CopZ 0 þ½Cd i þ K d Þ À fð½CopZ 0 þ½Cd i þ K d Þ 2 À 4½CopZ 0 ½Cd i g 1=2 Þ A Scatchard plot is obtained by calculating the free and bound cadmium concentration at equilibrium with the following expressions: ½Cd free ¼½Cd I À½CopZ 0 ÂðI À I 0 Þ=ðI max À I 0 Þ; ½Cd bound ¼½CopZ 0 ÂðI À I 0 Þ=ðI max À I 0 Þ where I 0 and I max are, respectively, the initial and maximal fluorescence intensities. CD spectroscopy measurements CD measurements of EhCopZ were recorded on a JS 810 spectropolarimeter (Jasco). The scans were recorded using a bandwidth of 2 nm and an integration time of 1 s at a scan rate of 100 nmÆmin )1 . For near-UV measurements between 250 nm and 310 nm, a 1-cm-path-length quartz cell con- taining 2 mL protein sample was used. A total of 20 scans were recorded and averaged for each sample. All resultant spectra were baseline subtracted. Aliquots of volume 200 lL of these protein sample solutions were used for far-UV measurements between 190 nm and 250 nm in a 1-mm-path-length quartz cell. A total of 10 scans were recorded and averaged for each sample. Protein samples of concentration 20 l M were prepared in an anaerobic atmosphere in 40 m M Mops/10 m M NaCl, pH 7.0. CD spectra were recorded after each addition of 1 lL metal aliquots. The total volume added to the 2 mL- buffered protein solution was less than 20 lLofthemetal stock solution. The titration experiment was performed under argon. The pH and ionic strength of the reaction mixture remained unchanged throughout the titration. UV-vis absorption spectra UV-vis absorption spectra were recorded on a Lambda 35 spectrophotometer (Perkin–Elmer) using a 1-cm-path- length quartz cell. Protein samples of 10 l M or 20 l M apo-EhCopZ were prepared in buffer C. Optical spectra were recorded from 190 to 700 nm after each TCEP, GSH or metal addition. Corrected spectra were obtained after baseline subtraction. Sample preparation for electrospray ionization (ESI)-MS analysis For functional ESI-MS analysis under nondenaturing conditions, the protein samples were thawed on ice, reduced with 5 m M dithiothreitolanddesaltedbygelfiltrationona Superdex 75 column (Pharmacia) equilibrated in freshly prepared 20 m M NH 4 HCO 3 , pH 8.0. The fractions collec- ted were freeze-dried and stored under argon at 4 °Cbefore use. The protein was suspended in MS buffer (4 m M NH 4 HCO 3 , pH 8.0), centrifuged (7200 g) and quantified. For the functional ESI-MS study, the samples were prepared as 50 lL aliquots of 15 l M EhCopZ in 4 m M NH 4 HCO 3 (pH 8.0)/15% methanol with the appropriate metal or GSH concentrations. ESI-MS measurements ESI mass spectra were acquired using a Micromass Q-TOFII instrument under control of the MassLynx 3.5 data acquisition and analysis software (Micromass Ltd, Manchester, UK). The MS buffer was used as the electrospray carrier solvent. Samples were introduced into the ion source at a flow rate of 10 lLÆmin )1 ,andmass spectra were acquired from m/z 400–2200 in positive ionization mode with a scan time of 5 s. External calibration of the mass scale was performed with horse heart myoglobin (Sigma). The spectra were analyzed with MASSLYNX 3.5. Light-scattering measurements Dynamic light-scattering data were obtained with the DynaPro-801 instrument (Protein Solutions Inc, High Wycombe, Bucks, UK) using a 30 mW, 833 nm wave- length argon laser at 22 °C and equipped with a solid-state avalanche photodiode. During illumination, the photons scattered by proteins were collected at 90 °Cona10s acquisition time and were fitted with the analysis software, DYNAMICS . Intensity fluctuations of the scattered light resulting from Brownian motion of particles were analyzed with an autocorrelator to fit an exponential decay function and then measuring a translational diffusion coefficient D. For polydisperse particles, the autocorrelation function was fitted as the sum of contributions from the various size particles using the regularization analysis algorithm. D is converted into a hydrodynamic radius R through the Stokes–Einstein equation (R ¼ k B T/6pgD where g repre- sents the solvent viscosity, k B the Boltzmann constant, and T the temperature). R is defined as the radius of a hypothetical hard sphere that diffuses with the same speed as the particle under examination. However, the particle may be nonspherical and solvated. Therefore, the molecular mass M of a macromolecule is estimated using M vs. R calibration curves developed from standards of known molecular mass and size. Thus, the estimated mass of a given particle is subjected to error if it deviates from the shape and solvation of the molecules used as standards (globular proteins). The molecular mass for a protein is estimated from the curve that fits the equation M ¼ (1.68 · R) 2.3398 as implemented in the DYNAPRO software. Results The analysis of the 3D structure of EhCopZ shows that Cys11 and Cys14 were at 5.73 A ˚ Ca–Ca distance. This value is within the range of the average Ca–Ca distance of bridged cysteine residues generally found in proteins [23]. The spatial proximity between the two cysteine residues could make the protein very sensitive to oxidation. While these two residues are involved in the metal-binding site, it is crucial that the protein remains reduced throughout the experiment. A control experiment was performed under 996 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004 conditions favorable to oxidation: an apoprotein sample was left under aerobic conditions for 2 h and the free-thiol quantification using Ellman’s reagent showed that less than 8% of the protein was oxidized. Consequently, all the experiments described hereafter were performed within 2 h under argon to further minimize CopZ oxidation. Interaction between copper and EhCopZ In a first set of experiments the binding of copper to the chaperone was studied using CD and UV-vis spectroscopy. To a 20 l M solution of apo-EhCopZ in 40 m M Mops/ 10 m M NaCl, pH 7, were added aliquots of a solution of Cu(I), stabilized using 0.1 M HCl, under anaerobic condi- tions [22]. The far-UV region of the CD spectrum displayed no significant modification on the addition of the metal, indicating that the global fold of the protein was preserved throughout the titration. The dichroic signal at 265 nm increased with the concentration of copper, as could be expected with a change in the hydrophobicity of the local environment of Tyr63 and/or a contribution of the binding of the copper to the thiolates of the protein. A plot of the intensity of the signal at 265 nm against the concentration of added copper showed that a plateau was reached when 0.5 equivalents of copper had been added, compatible with a 2 : 1 EhCopZ–Cu complex (Fig. 2). The UV-vis spectrum of the reaction mixture in the presence of the metal ion exhibited strong absorption at 260 nm compatible with a metal to ligand charge transfer band (data not shown). The intensity of this band increased with the concentration of added copper in solution, and the plot of A 260 vs. concen- tration of copper indicated in this case also a 2 : 1 EhCopZ/ Cu ratio. This result is in contrast with the 1 : 1 stoichiometry reported for a similar UV-vis experiment described previ- ously [9]. Several hypotheses were explored to explain this difference. As mentioned above, experiments were per- formed under conditions in which the oxidation of EhCopZ is not significant. Partial oxidation of the protein can thereforebeexcludedtoexplainthe2:1proteintometal stoichiometry. Although precautions were taken to avoid any oxidation of the metal, a change in the oxidation state of the metal may be responsible for this unexpected stoichiometry. The CD experiment described above with Cu(I) was therefore repeated with Cu(II) in order to study the influence of the oxidation state of copper on the complex stoichiometry. The spectra showed an increase in the signal of the tyrosine at 265 nm with increasing concentrations of copper up to a plateau reached for 0.5 molar equivalents of Cu(II) added per protein. A similar experiment was described by Kihlken et al. [15] with BsCopZ. It was shown that Cu(II) was reduced to Cu(I) on coordination to the protein. A similar process cannot be excluded in our case. However, no difference in stoichiometry in the complex was detected using either Cu(I) or Cu(II). SDS/PAGE analysis of EhCopZ was performed under nondenaturing conditions for the protein in the presence of increasing copper equivalents. A band corresponding to the molecular mass expected for a dimer appeared in the presence of the metal, confirming the dimeric nature of the EhCopZ–Cu (Fig. 3). Lastly, in previous studies [11,15,24–26], reducing mole- cules such as dithiothreitol or TCEP were added in the solution of copper chaperone to prevent the formation of the disulfide bridge. The interaction of such a small organic molecule present in the solution with the metal center could greatly influence the stoichiometry by changing the form of the complex. As these compounds can compete with the protein to bind the metal ion, their influence on the stoichiometry of the complex EhCopZ–metal was studied. Cadmium was substituted for copper to avoid any redox reaction involving the metal ion. Although Cd(II) is not a usual substitute for Cu(I), the available 3D structures of a homologous protein, HAH1, show that the copper-loaded and cadmium-loaded structures of the chaperone are very similar (PDB ID: 1FEE and 1FE0, respectively [17]). Moreover, the single tyrosine Tyr63 located on loop 5 at the beginning of the last strand b4 is close to the Fig. 2. CD titration of EhCopZ against Cu(I). CD spectra of EhCopZ (20 l M ;40m M Mops/10 m M NaCl, pH 7) in the presence of Cu(I) (from top to bottom) at 0, 2, 4, 6, 8, 10, 12, 16, 20 l M . The insert shows the plot of the intensity of the dichroic signal at 265 nm vs. the con- centration of introduced copper. Fig. 3. SDS/PAGE analysis of the protein EhCopZ in the presence of various concentrations of copper. Left lane, MultiMarkÒ Multi- Colored standard (Invitrogen); lane 1, apo-EhCopZ; lane 2, in the presence of 1 equivalents CuCl 2 ; lane 3, in the presence of 4 equiva- lents CuCl 2 . Experiments were performed with a solution of 25 l M EhCopZ in 20 m M Mops/150 m M NaCl,pH 7.2.The6· sample buffer was:glycerol50%,BromophenolBlue0.5%,MopspH7.Samples containing 3 lg protein were loaded on a 4–12% NuPAGEÒ Bis/Tris gel (Invitrogen). The electrophoresis was performed with a Mes run- ning buffer (Invitrogen). Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 997 metal-binding cysteine Cys14 (distance OH Tyr63 –S c Cys14 ¼ 3.6 A ˚ ). Preliminary experiments showed that excitation of a solution of EhCopZ at k excit ¼ 278 nm led to a maximum in the fluorescence emission at 305 nm, which increased on addition of Cd(II) whereas no change was detected on addition of copper. Therefore, the fluorescence of Tyr63 was used as a probe to monitor the binding of metal ions to the protein. Study of the binding of Cd(II) to EhCopZ by fluorescence spectroscopy, dynamic light scattering and ESI-MS spectroscopy In the first experiment, a spectrofluorimetric titration of EhCopZ (5 l M solution in 20 m M Mops/150 m M NaCl, pH 7.2) against an aqueous acidic solution of Cd(II) was performed at room temperature. With a 278 nm excitation wavelength, the emitted fluorescence of the tyrosine in position 63 was observed. Its intensity was found to increase on addition of the metal up to a limit corresponding to 0.5 ± 0.1 equivalents cadmium added (Fig. 4). The change in the intensity of the tyrosine fluorescence may be attributed to the formation of a dimer in solution, as was the case with copper. To test the hypothesis of potentially coordinating exogenous ligands, a similar experiment was carried out in the presence of 5 molar equivalents TCEP, and the plateau was reached when 0.9 ± 0.1 equivalents Cd were added (Fig. 4). TCEP is often used as a reducing agent instead of dithiothreitol, and bears three carboxylate functions instead of thiols. If the change in the stoichiometry is due to the coordination of a molecule of TCEP to the metal ion via the phosphorous atom [26] or a carboxylate function [27], the use of a potentially coordinating buffer should provide the same result. Therefore, the Mops buffer was replaced by a sodium hydrogenocarbonate buffer. The carbonate function is well known as a coordinating group for which a great number of binding modes have been described [28]. In contrast, the sulfonate function of Mops is known as a poor ligand for transition metals and has recently been described as noncoordinating for copper [29]. The corresponding fluorimetric titration of EhCopZ (5 l M in 20 m M NaHCO 3 /150 m M NaCl, pH 7.2) was achieved in the absence of TCEP, and a 1 : 1 stoichiometry was also found in this case (Fig. 4). To confirm the nature of the oligomeric EhCopZ–Cd complex, dynamic light-scattering experiments were carried out on EhCopZ/cadmium solutions in the absence and presence of TCEP. Apparent molecular masses were found to be 13.6 ± 2 kDa (hydrodynamic radius R ¼ 18.5 ± 0.9 A ˚ ) in the case of the apoprotein in the absence and presence of 5 molar equivalents TCEP. On addition of cadmium to apo-EhCopZ, the apparent molecular mass increased to 23.7 ± 2.5 kDa (R ¼ 23.4±1.1A ˚ ). This increase is in the range that could be expected from dimerization and consistent with the results obtained by Wimmer et al. [10] for the complex EhCopZ–Cu. When cadmium was added to apo-EhCopZ in the presence of TCEP, the apparent molecular mass was 16.5 ± 2 kDa (R ¼ 20.0 ± 1.1 A ˚ ) close to the value obtained for the apoprotein and hence consistent with the formation of a monomeric complex in these conditions. Complementary studies of the interaction between EhCopZ and metal ions were performed using MS. High- quality ESI mass spectra of proteins can be obtained in a 4m M ammonium carbonate buffer, pH 8.0, in the presence of 15% (v/v) methanol [30]. In these conditions, EhCopZ retains its structure (CD data not shown) and is desorbed in the gas phase as multiply charged ions corresponding predominantly to the charge states +5 and +6. This charge distribution indicates a folded protein with fewer basic residues available for protonation [31]. The protein was incubated in the presence of increasing concentrations of cadmium, copper, mercury and cobalt, and a set of spectra were recorded for each metal ion. In each case, the spectrum displayed peaks with charge states of +5 and +6, only compatible with a 1 : 1 monomeric EhCopZ–metal com- plex (Fig. 5) [32]. Taken together, these results are compat- Fig. 4. Fluorimetric titration of EhCopZ against Cd(II) in the presence and the absence of TCEP. Normalized fluorescence intensities at 305 nm of EhCopZ (5 l M ) with increasing concentrations of Cd(II) in 20 m M Mops/150 m M NaCl,pH7,intheabsenceofTCEP(d), in 20 m M Mops/150 m M NaCl, pH 7, in the presence of 25 l M TCEP (m)andin20m M NaHCO 3 /150 m M NaCl,pH7,intheabsenceof TCEP (j). Fig. 5. MS of the EhCopZ–metal complexes. ESI-MS spectra of 15 l M EhCopZ in 4 m M NH 4 HCO 3 (pH 8.0)/15% methanol in the pre- sence of 0.75 equivalents (11.25 l M ) metal ions. (A) Apo-EhCopZ; (B) Cu(I)Cl; (C) Hg(II)Cl 2 ; (D) Cd(II)Cl 2 ; (E) Co(II)Cl 2 . 998 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004 ible with the formation of ternary complexes corresponding to the formula EhCopZ–Cd–L where L is an exogenous coordinating molecule (dithiothreitol, TCEP, buffer anion). On dilution of the reaction mixture in the absence of TCEP, the monomer/dimer equilibrium is expected to be displaced in favor of the monomeric species. The titration of a0.5l M solution of EhCopZ in 20 m M Mops/150 m M NaCl, pH 7.2, by a solution of Cd(II) led indeed to the detection of a 1 : 1 EhCopZ to Cd stoichiometry. A fit of the data by the binding isotherm led to a dissociation constant of 65 n M . To ensure that the monomer/dimer equilibrium is displaced to close to 100% monomer in solution, the concentration of the protein was decreased by another order of magnitude. Therefore, a new titration was carried out using a 50 n M protein solution. A Hill plot yielded a straight line with a slope n ¼ 1.05 confirming the formation of an adduct with a 1 : 1 stoichiometry. The corresponding Scatchard plot led to a dissociation constant of K d ¼ 30 ± 5 n M (Fig. 6). Interaction of EhCopZ with Co, Hg, Cu and determination of the apparent dissociation constants Of the metal ions tested, a change in fluorescence intensity of Tyr63 was only detected with Cd(II). Therefore compe- tition experiments were run to determine the dissociation constants of the metal–protein complexes with cobalt, mercury and copper. In a typical experiment, the mono- meric EhCopZ–Cd complex was formed (0.5 l M protein in 20 m M Mops/150 m M NaCl, pH 7.2) before the addition of the competing metal M. The concentration range of the protein was increased to 500 n M in order to have nearly 100% of the EhCopZ–Cd complex with the minimum amount of cadmium (‡ 1.5 equivalents vs. protein). The decrease in the fluorescence intensity of the cadmium complex was followed, and the dissociation constants were determined at half fluorescence intensity. In each case, the following reaction takes place in the solution: Cop ZÀCd þ M $ CopZÀM þ Cd(II) The corresponding reaction constant is: K R ¼ K d ðCdÞ=K d ðMÞ ¼ð½EhCopZÀM½Cd(II)Þ=ð½EhCopZÀCd½MÞ Starting from an initial intensity I 0 and an initial protein concentration C 0 , the concentrations of the compounds present in solution can be determined at I 0 ) [(I 0 ) I min )/2], where I min is the intensity at high [M]. At this point, the concentrations of free species in solution are: ½EhCopZÀCd¼C 0 =2; ½M¼C 0 ðN M À 0:5Þ; ½Cd¼C 0 ðN Cd À 0:5Þ; ½EhCopZÀCd¼C 0 =2 A new form of the reaction constant can be written as follows: K d ½M¼K d ðCdÞ ðN M À 0:5Þ ðN Cd À 0:5Þ in which N M is the number of equivalents of the competing metal M introduced at I ¼ I 0 ) [(I 0 ) I min )/2], and N Cd is the number of equivalents of cadmium in solution. This concentration of cadmium in solution is chosen as a function of the affinity of the competing metal for EhCopZ to obtain a value for N M different from 0.5 equivalents (Table 2). The competition curves obtained for Hg are shown in Fig. 7. The dissociation constant for mercury was K d (Hg) ¼ 2±0.5n M . In the case of cobalt, no significant change in the intensity of the tyrosine was detected up to 500 molar equiv. cobalt added. As EhCopZ precipitates at higher cobalt concentrations, the dissociation constant could therefore be estimated to be greater than 15 l M .This is in good agreement with the value of K d ¼ 20 l M obtained from ESI-MS titration previously described [32]. In the case of copper, the affinity appeared to be so high that the value found for N Cu (0.52) in the presence of 1000 equivalents of cadmium was still very close to 0.5 equiv. and could only lead to an estimation of a maximum value of the dissociation constant for copper of 10 )12 M .Ahigher initial concentration of cadmium led to precipitation of the protein. The fact that copper binds to the protein with higher affinity than cobalt or cadmium could be predicted from thermodynamic data. However, it was more surprising that mercury had a weaker affinity than copper. A confirmation Fig. 6. Fluorimetric titration of EhCopZ with Cd(II) at low concentra- tion. Fluorescence spectra of EhCopZ (50 n M in 20 m M Mops/150 m M NaCl, pH 7.2; k excit ¼ 278 nm) in the presence of increasing concen- trations of Cd(II) ions (from bottom to top: 0, 10, 20, 30, 40, 50, 75, 100, 150, 200, 400 n M ). The insert shows the corresponding Scatchard plot. Table 2. Dissociation constants between metal ions and CopZ. The K d values were calculated at half-intensity using competition fluorescence experiments between cadmium and other metal ions. For each experiment, the concentration of the protein CopZ was 0.5 l M . N M is the amount of competing metal at half-intensity. Competing metal ion [Cd(II] (l M ) N M Estimated K d Hg(II) 2.5 0.8 2 ± 0.5 n M Co(II) 0.75 >500 >15 l M Cu(I) 500 0.52 £ 10 )12 M Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 999 of this result was obtained using ESI-MS competition experiments. As it reported previously [32] cadmium can easily be displaced by copper and mercury but not by cobalt. Moreover, mercury can be displaced by copper leading to the order of affinity Cu > Hg > Cd > Co which is the same as we obtained in the fluorescence experiments. The coordination of an exogenous thiol to the EhCopZ– Cu complex was also studied by ESI-MS. Given the high concentration of glutathione in cells [33] and its ability to bind Cu(I) [34], it is a good candidate to act as the third ligand for the Cu(I) ion in the complex. The ESI-MS experiments were carried out in the ammonium carbonate buffer (15 l M EhCopZ, pH ¼ 8). The spectrum of apo-EhCopZ exhibits apeakatm/z ¼ 1519.2 corresponding to the +5 charged state of EhCopZ which shifts to m/z ¼ 1531.9 on addition of a stoichiometric amount of Cu(I). Subsequent addition of aliquots of glutathione to the reaction mixture led to the appearance of a new peak at m/z ¼ 1593.7 compatible with the formation of a ternary adduct of formula EhCopZ–Cu– GSH. Moreover, a mixture of Cu(I) with 2 molar equiv. glutathione exhibits a spectrum with peaks at m/z ¼ 613.1, 674.0 and 676.0 which correspond, respectively, to the oxidized glutathione dimer (GS) 2 and to both isotopes of the oxidized copper complex Cu(I)(GS) 2 . On addition of 1 equivalents EhCopZ in this solution, the peak at 674.0 disappears and new peaks at m/z ¼ 308.4, 1531.8 and 1592.9 are detected, corresponding, respectively, to free glutathione, EhCopZ–Cu and EhCopZ–Cu–GSH. Discussion Our understanding of copper trafficking within the cell took a great step forward with the discovery of metallochaperones. In the presence of an extremely low free copper concentration in cells under normal growth concentration ([Cu] free <10 )17 M ), copper chaperones have been shown to be key partners in the delivery of the metal ion to their target proteins [35]. These proteins have been studied extensively over the past few years. However, several characteristics remain to be determined. Among these is the metal-loaded form of the chaperone in vivo which is a key element to further understanding the mechanism of the metal transfer from a metallochaperone to its target protein. Another point of interest is the selectivity of the chaperone for one type of metal ion. We here present results from in vitro experiments in these two fields of interest using the protein EhCopZ. Our experiments show that, of the metals tested, EhCopZ has a high preference for copper; the following order of affinity was found: Cu(I) ) Hg(II) > Cd(II) ) Co(II). These results can be compared with those reported for the homologous protein MerP from CD analysis [36]. MerP shares the same consensus binding motif and a similar 3D structure. The higher affinity was found for Hg with a dissociation constant of 2.8 l M , and similar affinities were reported for Cu and Cd (respectively 5 and 20 l M ). The striking difference between these values and our results on EhCopZ may be due to the experimental conditions used by Veglia et al. [36]. All the measurements were made in the presence of 100 l M dithiothreitol, which can compete for the metal ions [37]. Surprisingly, whereas the metal-binding affinities of MerP follow the order found for inorganic thiolates (Hg > Cu > Cd > Co), this is not true for EhCopZ. As these two proteins share the same structural binding motif C-X-X-C (first co-ordination sphere), our results suggest that the molecular determinants for the preference for copper may lie in the second co-ordination sphere of the metal. The presence of different amino-acid side chains near the metal-binding site may play a major role in the discrimination between metal ions, as it would be a source of different local electrostatic properties. In parti- cular, several basic residues lie close to the metal-binding site of CopZ whereas there are none in this area in the 3D structure of MerP. As Hg(II) and Cu(I) differ by one charge, a small difference in the electrostatic potential generated by the nearby residues could generate a significant change in the affinity for the two ions. The molecular mechanism by which these different residues discriminate among metals requires further experiments, which are in progress in our laboratory. So far, metallochaperones have been reported to bind Cu(I) in different types of complex: monomers (protein– Cu), in which the copper ion is either two or three coordinated [11–14]; dimers, in which the metal ion is coordinated by the four cysteine residues of two protein molecules [15,17]. In this study we show that two distinct types of complex can be stabilized in solution, and that they are highly sensitive to the experimental conditions used. In the experiments performed in the absence of any coordinating molecule and at high concentration of protein (> 10 )6 M ), the titration curves showed a saturation at 0.5 equiv. metal added per protein monomer. Along with the change in intensity of the fluorescence of Tyr63 in the presence of cadmium and dynamic light-scattering analysis, these observations are consistent with the formation in this case of a homodimer. Such a ÔsandwichÕ complex has been reported in the crystal structure of the homologous protein Fig. 7. Binding competition experiment between Cd(II) and Hg(II) to EhCopZ. Fluorescence spectra of a mixture of EhCopZ (0.5 l M in 20 m M Mops/150 m M NaCl, pH 7.2; k excit ¼ 278 nm) and 2.5 l M CdCl 2 in the presence of increasing concentrations of Hg(II) ions (from top to bottom: 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 1, 1.2, 1.5, 2, 2.5 l M ). The insert shows the plot of the emission of fluorescence at 305 nm vs. the concentration of added Hg(II). 1000 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004 HAH1 loaded with Cd, Cu or Hg [17]. In contrast, a recent study has reported the formation of a monomeric complex between BsCopZ and its metal cargo in the presence of the reducing agent dithiothreitol [15]. To avoid any competi- tion between the thiols of the protein and the thiol of dithiothreitol, we chose to use TCEP as the reducing agent. In its presence, the titration curves showed saturation at 1 equiv. metal per protein corresponding to a monomeric protein complex, as shown by dynamic light-scattering experiments. These data suggest a probable interaction of such an exogenous molecule with the metal center which would therefore be coordinated by the thiols of Cys11 and Cys14 and by the phosphine of TCEP, as recently shown in the case of the homologous protein HAH1 [26]. The presence of a third ligand on the metal ion is also in agree- ment with the X-ray absorption fine structure (EXAFS) experiments recently reported by Cobine et al.[9],who showed that the copper ion is coordinated in a trigonal geometry by three atoms with an average distance of 2.241 A ˚ . Moreover, the substitution of Mops buffer by a more coordinating buffer molecule such as carbonate also led to the formation of a monomeric species. Banci et al. [38] have recently described an effect of the buffer on the coordinating geometry of a copper ion in a copper chaperone complex. Our results are in agreement with a complex in which the buffer molecule acts as a weak and labile ligand for the metallic center. When the protein concentration is lowered to 500 n M or less, the protein to metal stoichiometry is always 1 : 1. In this case, the copper ion may be bis-coordinated to the two sulfur atoms of the cysteine residues in a linear geometry. It may also be three- coordinated in a trigonal planar geometry, a water molecule completing the coordination sphere as a weak and labile ligand. This hypothesis is in good agreement with the 3D structures obtained for the copper complex of BsCopZ in the presence of dithiothreitol [11] and for the copper complex of the homologous protein Atx1 [13]. In these complexes, EXAFS studies have shown that the Cu(I) lies in a trigonal geometry [24,38]. In the 3D structure of Atx1-Cu, the Cu(I) is coordinated to the two thiols of the cysteine residues with an S c Cys15 –Cu–S c Cys18 of 120°. This angle is what would be expected for a perfect plane trigonal geometry of a three-coordinated copper with a buffer or solvent molecule as the third ligand. In yeast cells, the concentration of free copper is very low (<10 )17 M ), and the concentration of the chaperone is thought to range from 0.1 to 1 l M [2]. Assuming that this copper concentration is similar in other cells and that there is also a high concentration of free thiol, a EhCopZ–Cu–SG ternary complex could be the species present in vivo. Indeed, the ESI-MS results show the ability of the copper chaperone to extract copper from a Cu(GS) 2 complex which could be formed in cells and demonstrate the formation of such a ternary complex with glutathione. The origin of the metal supply to a chaperone is a question of great interest. A recent study on the copper chaperone Atx1 from Synecho- cystis PCC 6803 has shown that Atx1 acquires copper from another protein CtaA, but can also scavenge the metal from other sources [39]. Such a Cu(GS) 2 complex could be one of these sources. Taken together, these results suggest a mechanism for the transfer of copper to the protein CopY. In the presence of glutathione, EhCopZ may form a ternary complex with copper of formula EhCopZ–Cu–GSH. Transfer of the metal ion to CopY would then probably be achieved via a multiple ligand exchange with the cysteine residues of CopY helped by the geometry of the CopY active site and its higher affinity for copper, as proposed recently [9,40]. The very high affinities of EhCopZ, and consequently CopY, for copper are consistent with the recent studies of cadmium-regulatory and zinc-regulatory proteins (CadC [41],SmtB[42]andZntR[43]).Indeed,inthepresenceofa cellular overcapacity for binding of transition metals, high affinities for such metal-regulatory proteins appear to be critical for specific trafficking pathways in vivo [35]. Conclusion We have here described a study of the binding of several metal ions to the metallochaperone EhCopZ. In the presence of a metal ion, EhCopZ is able to form monomeric or dimeric compounds, and we have shown that the experimental conditions can be controlled to obtain either one form or the other. Under physiological conditions, the presence of potentially coordinating mole- cules probably leads to the formation of a monomeric ternary copper complex, EhCopZ–Cu–L. L is an exogen- ous molecule that may be glutathione or a phosphate or carbonate ion. The dissociation constant found for the protein–copper complex shows that the protein has a very high affinity for copper and may take up its copper ion from a potential intracellular Cu(GS) 2 species. These results suggest the possibility that, in vivo,thetransferof copper from EhCopZ to the target protein CopY could be achieved through a multiple ligand exchange mechanism between the glutathione molecule and the cysteine residues of the two proteins involved. A comparison between EhCopZ and MerP suggests that the determinants for the metal-binding selectivity do not reside only in the struc- tural binding motif, but the environment surrounding the metal-binding site has to be taken into account. We are currently extending this study to other metallochaperones to identify further molecular determinants of this metal- binding selectivity. Acknowledgements This work was supported by the Commissariat a ` l’Energie Atomique (CEA),whichprovidedaPh.D.fellowshiptoA.U.Wewouldliketo thank Dr V. Forge for giving us access to the spectropolarimeter and for helpful discussions, Dr S. Bressane for giving us access to light- scattering facilities, Dr B. Amekraz and Dr C. Moulin for giving us access to the Q-TOF mass spectrometer, Dr F. Rollin-Genetet for invaluable advice, and Professor A. Me ´ nez, Dr R. Sto ¨ cklin and Dr E. Que ´ me ´ neur for continuous support. References 1. Holm, R.H., Kennepohl, P. & Solomon, E.I. (1996) Reviews of Bioinorganic enzymology. Chem. Rev. 96, 2237–3042. 2. Lippard, S.J. (1999) Free copper ions in the cell? Science 284,748– 749. 3. Harrison, M.D., Jones, C.E., Solioz, M. & Dameron, C.T. (2000) Intracellular copper routing: the role of copper chaperones. Trends Biochem. Sci. 25, 29–32. Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 1001 4. O’Halloran, T.V. & Culotta, V.C. (2000) Metallochaperones, an intracellular shuttle service for metal ions. J. Biol. Chem. 275, 25057–25060. 5. Rosenzweig, A.C. (2001) Copper delivery by metallochaperone proteins. Acc. Chem. Res. 34, 119–128. 6. Lu, Z.H., Cobine, P., Dameron, C.T. & Solioz, M. (1999) How cells handle copper: a view from microbes. J. Trace Elem. Exp. Med. 347–360. 7. Wunderli, YeH. & Solioz, M. (1999) Copper homeostasis in Enterococcus hirae. Adv. Exp. Med. Biol. 448, 255–264. 8. Cobine, P., Wickramasinghe, W.A., Harrison, M.D., Weber, T., Solioz, M. & Dameron, C.T. (1999) The Enterococcus hirae copper chaperone CopZ delivers copper (I) to the CopY repressor. FEBS Lett. 445, 27–30. 9. Cobine, P.A., George, G.N., Jones, C.E., Wickramasinghe, W.A., Solioz, M. & Dameron, C.T. (2002) Copper transfer from the Cu(I) chaperone, CopZ, to the repressor, Zn(II) CopY: metal coordination environments and protein interactions. Biochemistry 41, 5822–5829. 10. Wimmer, R., Herrmann, T., Solioz, M. & Wuthrich, K. (1999) NMR structure and metal interactions of the CopZ copper cha- perone. J. Biol. Chem. 274, 22597–22603. 11. Banci, L., Bertini, I., Del Conte, R., Markey, J. & Ruiz-Duenas, F.J. (2001) Copper trafficking: the solution structure of Bacillus subtilis CopZ. Biochemistry 40, 15660–15668. 12. Steele, R.A. & Opella, S.J. (1997) Structures of the reduced and mercury-bound forms of MerP, the periplasmic protein from the bacterial mercury detoxification system. Biochemistry 36, 6885– 6895. 13. Arnesano, F., Banci, L., Bertini, I., Huffman, D.L. & O’Halloran, T.V. (2001) Solution structure of the Cu(I) and apo forms of the yeast metallochaperone, Atx1. Biochemistry 40, 1528–1539. 14. Rosenzweig, A.C., Huffman, D.L., Hou, M.Y., Wernimont, A.K., Pufahl, R.A. & O’Halloran, T.V. (1999) Crystal structure of the Atx1 metallochaperone protein at 1.02 A ˚ resolution. Struct. Fold. Des. 7, 605–617. 15. Kihlken, M.A., Leech, A.P. & Le Brun, N.E. (2002) Copper- mediated dimerization of CopZ, a predicted copper chaperone from Bacillus subtilis. Biochem. J. 368, 729–739. 16.Banci,L.,Bertini,I.,DelConte,R.,Mangani,S.&Meyer- Klaucke, W. (2003) X-ray absorption and NMR spectroscopic studies of CopZ, a copper chaperone in Bacillus subtilis:the coordination properties of the copper ion. Biochemistry 42, 2467– 2474. 17. Wernimont,A.K.,Huffman,D.L.,Lamb,A.L.,O’Halloran,T.V. & Rosenzweig, A.C. (2000) Structural basis for copper transfer by the metallochaperone for the Menkes/Wilson disease proteins. Nat. Struct. Biol. 7, 766–771. 18. Silver, S., Nucifora, G., Chu, L. & Misra, T.K. (1989) Bacterial resistance ATPases: primary pumps for exporting toxic cations and anions. Trends Biochem. Sci. 14, 76–80. 19. Smith, K. & Novick, R.P. (1972) Genetic studies on plasmid- linked cadmium resistance in Staphylococcus aureus. J. Bacteriol. 112, 761–772. 20. Lutsenko, S., Petrukhin, K., Cooper, M.J., Gilliam, C.T. & Kaplan, J.H. (1997) N-Terminal domains of human copper- transporting adenosine triphosphatases (the Wilson’s and Menkes disease proteins) bind copper selectively in vivo and in vitro with stoichiometry of one copper per metal-binding repeat. J. Biol. Chem. 272, 18939–18944. 21. Harrison, M.D., Meier, S. & Dameron, C.T. (1999) Character- ization of copper-binding to the second sub-domain of the Menkes protein ATPase (MNKr2). Biochim. Biophys. Acta 1453, 254–260. 22. Cobine, P.A., George, G.N., Winzor, D.J., Harrison, M.D., Mogahaddas, S. & Dameron, C.T. (2000) Stoichiometry of complex formation between Copper (I) and the N-terminal domain of the Menkes protein. Biochemistry 39, 6857–6863. 23. Richardson, J.S. (1981) The anatomy and taxonomy of protein structure. Adv. Protein. Chem. 34, 167–339. 24. Pufahl, R.A., Singer, C.P., Peariso, K.L., Lin, S.J., Schmidt, P.J., Fahrni, C.J., Cizewski, CulottaV., Penner-Hahn, J.E. & O’Hal- loran, T.V. (1997) Metal ion chaperone function of the soluble Cu(I) receptor Atx1. Science 278, 853–856. 25. Huffman, D.L. & O’Halloran, T.V. (2000) Energetics of copper trafficking between the Atx1 metallochaperone and the intracel- lular copper transporter, Ccc2. J. Biol. Chem. 275, 18611–18614. 26. Ralle, M., Lutsenko, S. & Blackburn, N.J. (2003) X-Ray absorption spectroscopy of the copper chaperone HAH1 reveals a linear 2-coordinate Cu(I) center capable of adduct formation with exogenous thiols and phosphines. J. Biol. Chem. 278, 23163– 23170. 27. Krezel, A., Latajka, R., Bujacz, G.D. & Bal, W. (2003) Coordination properties of tris(2-carboxyethyl)phosphine, a newly introduced thiol reductant, and its oxide. Inorg. Chem. 42, 1994–2003. 28. Cotton, F.A. & Wilkinson, G. (1988) Advanced Inorganic Chem- istry 5th edn. Wiley Interscience, New York. 29. Mash, H.E., Chin, Y.P., Sigg, L., Hari, R. & Xue, H. (2003) Complexation of copper by zwitterionic aminosulfonic (good) buffers. Anal. Chem. 75, 671–677. 30. Chazin, W. & Veenstra, T.D. (1999) Determination of the metal- binding cooperativity of wild-type and mutant calbindin D9K by electrospray ionization mass spectrometry. Rapid Commun. Mass Spectrom. 13, 548–555. 31. Dobo, A. & Kaltashov, I.A. (2001) Detection of multiple protein conformational ensembles in solution via deconvolution of charge-state distributions in ESI MS. Anal. Chem. 73, 4763–4773. 32. Urvoas, A., Amekraz, B., Moulin, C., Le Clainche, L., Sto ¨ cklin, R. & Moutiez, M. (2003) Analysis of the metal-binding selectivity of the metallochaperone CopZ from Enterococcus hirae by elec- trospray ionisation mass spectrometry. Rapid Commun. Mass Spectrom. 17, 1889–1896. 33. Tietze, F. (1969) Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: appli- cations to mammalian blood and other tissues. Anal. Biochem. 27, 502–522. 34. Corazza, A., Harvey, I. & Sadler, P.J. (1996) 1 H, 13 C-NMR and X-ray absorption studies of copper (I) glutathione complexes. Eur. J. Biochem. 236, 697–705. 35. Rae, T.D., Schmidt, P.J., Pufahl, R.A., Culotta, V.C. & O’Hal- loran, T.V. (1999) Undetectable intracellular free copper: the requirement of a copper chaperone for superoxide dismutase. Science 284, 805–808. 36. Veglia, G., Porcelli, F., DeSilva, T., Prantner, A. & Opella, S.J. (2000) The structure of the metal-binding motif GMTCAAC is similar in an 18-residue linear peptide and the mercury binding protein MerP. J. Am. Chem. Soc. 122, 2389–2390. 37.Krezel,A.,Lesniak,W.,Jezowska-Bojczuk,M.,Mlynarz,P., Brasun, J., Kozlowski, H. & Bal, W. (2001) Coordination of heavy metals by dithiothreitol, a commonly used thiol group protectant. J. Inorg. Biochem. 84, 77–88. 38. Banci, L., Bertini, I., Ciofi-Baffoni, S., D’Onofrio, M., Gonnelli, L., Marhuenda-Egea, F.C. & Ruiz-Duenas, F.J. (2002) Solution structure of the N-terminal domain of a potential copper-trans- locating P-type ATPase from Bacillus subtilis in the apo and Cu(I)- loaded states. J. Mol. Biol. 317, 415–429. 39. Tottey, S., Rondet, S.A.M., Borrelly, G.P.M., Robinson, P.J., Rich, P.R. & Robinson, N.J. (2003) A copper metallochaperone for photosynthesis and respiration reveals metal-specific targets, interaction with an importer, and alternative sites for copper acquisition. J. Biol. Chem. 277, 5490–5497. 1002 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004 [...]... FEBS 2004 EhCopZ metal binding and selectivity (Eur J Biochem 271) 1003 40 Harrison, M.D., Jones, C.E & Dameron, C.T (1999) Copper chaperones: function, structure and copper- binding properties J Biol Inorg Chem 4, 145–153 41 Busenlehner, L.S., Cosper, N.J., Scott, R.A., Rosen, B.P., Wong, M.D & Giedroc, D.P (2001) Spectroscopic properties of the metalloregulatory Cd(II) and Pb(II) sites of S aureus... Giedroc, D.P (2000) The zinc metalloregulatory protein Synechococcus PCC7942 SmtB binds a single zinc ion per monomer with high affinity in a tetrahedral coordination geometry Biochemistry 39, 11818–11829 43 Hitomi, Y., Outten, C.E & O’Halloran, T.V (2001) Extreme zincbinding thermodynamics of the metal sensor/regulator protein, ZntR J Am Chem Soc 123, 8614–8615 Supplementary material The following material... Outten, C.E & O’Halloran, T.V (2001) Extreme zincbinding thermodynamics of the metal sensor/regulator protein, ZntR J Am Chem Soc 123, 8614–8615 Supplementary material The following material is available from http://blackwell publishing.com/products/journals/suppmat/EJB/EJB4001/ EJB4001sm.htm . local environment of Tyr63 and/ or a contribution of the binding of the copper to the thiolates of the protein. A plot of the intensity of the signal at 265 nm against the. determination of the mechanism of the uptake and transport of copper by the chaperone EhCopZ. Keywords: copper transport; CopZ; metal binding; metal- lochaperone; selectivity. Copper